Caffeine inheritance in interspecific hybrids of Coffea arabica x Coffea canephora (Gentianales, Rubiaceae)

PLANT GENETICS

RESEARCH ARTICLE

Caffeine inheritance in interspecific hybrids of Coffea arabica x Coffea canephora (Gentianales, Rubiaceae)

Regina H.G. Priolli^I; Paulo Mazzafera^II; Walter J. Siqueira^III; Milene Möller^III; Maria Imaculada Zucchi^III; Luis Carlos S. Ramos^III; Paulo B. Gallo^IV; Carlos A. Colombo^III

^IDepartamento de Genética, Escola Superior de Agricultura Luís de Queiroz, Universidade de São Paulo, Piracicaba, SP, Brazil

^IIDepartamento de Fisiologia Vegetal, Instituto de Biologia, Universidade Estadual de Campinas, Campinas, SP, Brazil

^IIICentro de Pesquisa e Desenvolvimento de Recursos Genéticos Vegetais, Instituto Agronômico de Campinas, Campinas, SP, Brazil

^IVAgência Paulista de Tecnologia do Agronegócio, Regional Nordeste Paulista, Mococa, SP, Brazil

^{Send correspondence to}

ABSTRACT

Caffeine inheritance was investigated in F₂ and BC₁F₁ generations between Coffea arabica var. Bourbon Vermelho (BV) and Coffea canephora var. Robusta 4x (R4x). The caffeine content of seeds and leaves was determined during 2004 and 2005. Microsatellite loci-markers were used to deduce the meiotic pattern of chromosome pairing of tetraploid interspecific hybrids. Genetic analysis indicated that caffeine content in seeds was quantitatively inherited and controlled by genes with additive effects. The estimates of broad-sense heritability of caffeine content in seeds were high for both generations. In coffee leaves, the caffeine content (BSH) from the same populations showed transgressive segregants with enhanced levels and high BSH. Segregation of loci-markers in BC₁F₁ populations showed that the ratios of the gametes genotype did not differ significantly from those expected assuming random associations and tetrasomic inheritance. The results confirm the existence of distinct mechanisms controlling the caffeine content in seeds and leaves, the gene exchange between the C. arabica BV and C. canephora R4x genomes and favorable conditions for improving caffeine content in this coffee population.

Key words: broad sense heritability, coffee breeding, microsatellite-markers, quantitative genes.

Introduction

The stimulant effect of coffee that makes it one of the most popular beverage in the world is due to the presence of caffeine (1,3,7-trimethylxanthine), an alkaloid synthesized from purines and found in the seeds. However, in spite of its importance, the literature on caffeine inheritance in coffee is scarce and inconclusive. Some genetic studies with coffee cultivars have revealed that the caffeine content of the seed is genotypically defined in a quantitative and polygenic manner and is only slightly influenced by exogenous factors (Charrier and Berthaud, 1975; Ravohitrarivo, 1985; Le Pierres, 1988). The mean caffeine content in Coffea hybrids is close to the arithmetical mean of the parents. Moreover, work with intra and inter-specific hybrids has shown that variability in the progeny depends on the degree of parental heterozygosity, which is more evident in out-breeding species. For example, Charrier and Berthaud (1975), reported that in a collection of cultivated Coffea trees the caffeine level was higher in Coffea canephora, an allogamous species, than in the autogamous species Coffea arabica. On average, the dry weight caffeine content of seeds from C. canephora varieties is 2.5%, more than twice as high as the 1.2% found in C. arabica varieties in. Therefore, breeding programs with C. canephora include intra- and inter-specific hybridization and selection of suitable genotypes with the aim of lowering its caffeine content (Leroy et al., 1993).

Transfer of desirable genes from C. canephora (2n = 2x = 22, allogamous) to C. arabica (2n = 4x = 44, autogamous) varieties through wide crosses is one of the breeding strategies used for coffee improvement. However, the ability to transfer useful traits from a related species to another by conventional methods depends on the crossability between the two species. Although C. arabica has a diploid-like meiotic behavior (Krug and Mendes, 1940; Lashermes et al., 2000), tetraploid interspecific hybrids resulting from the hybridization between C. arabica and an auto-tetraploid C. canephora obtained following colchicine treatment have been particularly favorable to intergenomic recombination and gene introgressions. Segregation analyses of restriction fragment length polymorphism (RFLP) loci-markers have indicated tetrasomic inheritance resulting from the pairing of homologous chromosomes in meiosis (Lashermes et al., 2000). In two BC₁F₁ populations, (C. arabica x C. canephora 4x) x C. arabica, segregations and co-segregation of RFLP and microsatellite loci-markers conformed to the expected ratio assuming random chromosome segregation and the absence of selection (Herrera et al., 2002).

Seeds of these hybrids have a considerable range of caffeine content (Mazzafera et al., 1992; Mazzafera and Carvalho, 1992; Bertrand et al., 2003), suggesting that this trait is under polygenic control. Montagnon et al. (1998) used intraspecific hybrids of C. canephora to evaluate genetic parameters related to several biochemical compounds, and found that while additive genetic effects were preponderant for most of the characters narrow-sense heritability was high (0.80) for caffeine content. The low-caffeine level (0.6-0.7%) found in the seeds of C. arabica var. Laurina, a spontaneous mutation of C. arabica var. Bourbon, has been suggested to be a qualitative trait and controlled by a recessive pair of lr lr alleles, with a strong pleiotropic effect on morphological characteristics (Carvalho et al., 1965). Barre et al. (1998) having investigated caffeine inheritance in the first and second generations of an interspecific cross between Coffea liberica var. Dewevrei and the caffeine-free wild species Coffea pseudozanguebariae and proposed that the absence of caffeine was controlled by cc alleles. Interestingly, the caffeine content of coffee seeds and leaves seems to be independently controlled (Mazzafera and Magalhães, 1991), with, in general, the caffeine content of leaves being lower than that of seeds even in coffee species with duplicated chromosome numbers (Silvarolla et al., 1999).

In this paper we describe the genetic variability and the inheritance pattern of the caffeine content of the seeds and leaves of hybrids between C. arabica and C. canephora 4x. Our results are also discussed in relation to the possibility of gene exchange between the homologous genomes in interspecific hybrids.

Material and Methods

Plant material

The F₁ tetraploid hybrid between Coffea arabica L. var. Bourbon Vermelho (BV, parent 1) and Coffea canephora var. Robusta 4x (R4x, parent 2), an artificial tetraploid obtained by Mendes (1947), has, since 1996, been advanced to F₂ by selfing three F₁ clones from the same plant, with some F₁ flowers having been backcrossed to the BV parent to also develop the backcross ((BV x R4x) x BV, generation BC₁F₁).

In the investigation described in this paper we used leaves and seeds collected from F₂ and BC₁F₁ plants in 2004 and 2005. All the segregating populations were grown in a field trial at a site near the municipality of Mococa (latitude 21°28’ S, longitude 47°01’ W and altitude 665 m) in the Brazilian state of São Paulo State and received treatment with inorganic fertilizer, and weed and pest control and all other treatments recommended for growing coffee under Brazilian conditions (Thomaziello et al., 1996).

Sample preparation and caffeine extraction

During 2004 and 2005 the total number of plants analyzed for caffeine content was 150 F₂ plus 88 BC₁F₁ with regard to the caffeine content of their leaves and 71 F₂ plus 24 BC₁F₁ in respect to the caffeine content of their seeds. In January and July of each year we collected leaves and fruits, respectively, of third and fourth leaf pairs from different sides of the tree canopy and red cherries (mature fruits) from F₂ and BC₁F₁ plants. The fruits were manually processed to remove the seeds, which were dried at 70 °C for two weeks and then finely ground with a blade grinder. Caffeine was extracted by adding 5 mL of 80% methanol to 100 mg samples of the ground material contained in test-tubes, the mixture being maintained for 60 min in a water bath a at 70 °C with occasional agitation. The same procedure was adopted for the leaves, except that a pestle and mortar was used to grind the leaves. The extracts were centrifuged and the supernatant was analyzed by reversed-phase high performance liquid chromatography (Shimadzu HPLC system), using a C18 column (Supelco, 5 Pm, 4 mm x 250 mm) with 0.5% (v/v) acetic acid in 50% (v/v) aqueous methanol as solvent, at a flow rate of 0.8 mL min^-1. Caffeine was detected with a diode array detector operating at 280 nm and quantification as a percentage of sample dry mass was carried out by comparing the sample data with known amounts of pure caffeine (Sigma, St Louis, USA). Every sample was analyzed twice and when the values differed by more than 5% a third analysis was made, hence each data point represents the mean of at least two determinations.

Microsatellite marker assay

In January 2005 we collected approximately 10 g of young leaves from 73 BC₁F₁ plants and isolated total genomic DNA from freeze-dried leaves as described by Ky et al. (2000). Eight microsatellites (32-2CTG, C2-2CTC, E8-3-CTG, M20, M27, M32, EST-SSR1, EST-SSR2) that have previously shown clear polymorphisms between BV and R4x in a preliminary screening (data not shown) were selected for use in this study. Six of these microsatellites, or simple sequence repeats (SSR), were identified in DNA clones derived from genomic libraries and obtained from Combes et al. (2000) and Rovelli et al. (2000). Two expressed sequence tags (EST) were developed from cluster consensus sequences derived from the Coffee Genome Project (Vieira et al., 2006) using the TROLL software (Castelo et al., 2002). Every forward primer was labeled with either blue (FAM) or green (JOE) fluorescent tags (Invitrogen, São Paulo, Brazil). The EST-SSR sequences used were EST-SSR 1 (forward 5’GAATACATCACTCCAGA GACG3’, reverse 5’CCTTAGCCAACTCCTGAAC 3’) and EST-SSR 2 (forward 5’CATAGCAACTTCAAACA CGC 3’, reverse 5’TCGACTATGAGAAGCTGAAGG3’). Polymerase chain reactions (PCR) were performed in a 15 µL final reaction volume containing 60 ng DNA, 0.2 µM of each forward and reverse primer, 200 µM of each dNTP, 2.0 mM MgCl₂, 10 mM Tris-HCl, 50 mM KCl, and 1.5 unit Taq DNA polymerase (Invitrogen, Brazil). Reactions were amplified on a PTC-200 thermocycler (MJ Research, USA) as follows: 95 °C for 5 min, followed by 30 cycles consisting of heating at 95 °C for 1 min, annealing for 1 min at a temperature specific for each primer (55 °C to 60 °C) and extension at 72 °C for 1 min, with a final elongation step at 72 °C for 10 min. Amplification products were separated on 5% (w/v) polyacrylamide gel (PAGE) in an ABI 377 DNA automatic sequencer (Applied Biosystems, USA). The data were collected automatically based on the differential fluorescence of the products and analyzed with the GeneScan/Genotyper programs (Applied Biosystems, USA). The amplification products representing the microsatellite loci were identified and interpreted as specific markers of either C. arabica or C. canephora by comparison with the amplification products produced by the parental accessions (Table 1).

Statistical analysis

To analyze the effect of years, the frequency and normal distributions of the caffeine content in seeds and leaves within each segregating population were compared using the Kolmogorov-Smirnov two-sample test (Snedecor and Cochran, 1989). Data for each trait were analyzed using the pooled means of both years (2004 and 2005). The caffeine content of seeds and leaves plotted as frequency histograms with a class interval (i) according to the formula i = A/k, where A is the amplitude of the variation between the maximum and minimum value observed in the dataset and k is the square root of the number of observations per dataset. The Shapiro-Wilk test was used to test for normality in the distributions.

The mean differences between generations were compared using the F-test with unequal variance as implemented in the PROC GLM routine of the SAS 8.0 program (SAS Institute, USA). Comparisons between means were carried out using the Tukey test at p = 0.05.

Broad sense heritability (BSH) of each F₂ population was estimated as BSH_F2 = (V_F2 – V_E)/V_F2 and for each BC₁F₁ population as BSH_BC1F1 = (V_BC1F1 – V_E)/ V_BC1F1, where V_F2, V_BC1F1 and V_E were the F₂, BC₁F₁ and environmental variances respectively (Falconer 1960). The environmental variance (V_E was estimated as V_E = (V_P1 + V_F1)/2, where V_P1 and V_F1 are the variances of the parent and F₁ hybrid respectively (Falconer, 1960). The BSH error was estimated according to Vello and Vencovsky (1974). Statistical analysis of the microsatellite data in the BC₁F₁ progeny compared observed genotypic frequencies to the expected frequencies predicted for tetrasomic inheritance models. The chi-squared test (c²) was used to check the goodness-of-fit between the observed and expected frequencies.

Results

In both years the Kolmogorov-Smirnov two-sample test detected no heterogeneity in the frequency distributions of caffeine content for each segregating population (Figure 1). However there was a greater tendency for the leaf caffeine content means to be homogenous than there was for the seed caffeine content means, probably due to the leaves being sampled from more plants (150 F₂ and 88 BC₁F₁ plants for each year) as compared to seeds (71 F₂ and 24 BC₁F₁ plants for each year). The absence of environmental effects allowed the 2004 and 2005 results to be pooled.

The distribution of the caffeine means for 2004 and 2005 are shown in Figure 2. Caffeine content in seeds of all segregating populations was distributed in a continuous manner and could not be classified into discrete classes. Segregation followed a normal distribution in the F₂ (Shapiro-Wilk test, p = 0.3318) but not in the BC₁F₁ (Shapiro-Wilk test, p = 0.0395). No transgressive segregation for low or high caffeine content was observed in any of the F₂ and BC₁F₁ populations (Figure 2A-B). The data for caffeine content in leaves for the F₂ and BC₁F₁ populations were also distributed continuously and could not be classified into discrete high or low caffeine content classes. However, none of them followed a normal distribution (p = 0.0021 to F₂ and p = 0.0325 to BC₁F₁) and transgressive segregants with enhanced levels of caffeine content were observed (Figure 2C-D).

Significant differences occurred between the generation means for the caffeine content of seeds but not for leaves, the mean seed caffeine content being high in the R4x parent, low in the BV parent and intermediate in the F₂ and BC₁F₁ generations (Table 2). However, while the two parents were significantly different (p = 0.05) from each other and the F₂ and BC₁F₁ generations in regard to mean seed caffeine content the F₂ and BC₁F₁ generations were not significantly different from each other (Table 2). For leaf caffeine content there were no statistically significant differences between any of the generations (Table 2).

The F₂ broad-sense heritability (BSH) was 0.91 for seeds and 0.83 for leaves, while the BC₁F₁ BSH was lower at 0.81 for seeds and 0.79 for leaves. The error associated with the BSH estimate was low, 0.12 for seeds and 0.11 for leaves.

The diagram of allele segregations in the BV x R4x hybrid was inferred from the analysis of the backcross progeny for eight microsatellite-loci (Table 3). For all loci except the M27 locus we identified two types of BC₁F₁ genotypes, one with PAGE gel segregation patterns similar to the three bands seen in the F₁ hybrid and another similar to the two bands occurring in the BV parent (see Table 1). The observed frequencies of each genotype were compared with the expected frequencies (Table 3). The genotype ratio tested was 1/4 of the BV profile and 3/4 of other profiles (others banding patterns in the tetraploid BC₁F₁ progeny), assuming random chromosome segregation, absence of a preferential chromosome pairing and tetrasomic inheritance. Of the eight loci tested, only three (C2-2CTC, M32 and M27) exhibited a significant deviation (p > 0.05) between observed and expected values.

Discussion

Both major and minor genes with additive gene effects appear to be involved in the variation of caffeine content in the seeds and leaves of the segregating populations studied, as shown by the data presented in Figure 2. The inability to classify caffeine content into discrete classes of high and low levels in the segregating populations studied is an indication that caffeine content in seeds and leaves is a quantitative trait.

The parent plants used by us to obtain the F₂ and BC₁ populations had contrasting seed caffeine contents (BV = 1.07%, R4x = 3.5%), which generated enough phenotypic variation to study the inheritance of caffeine in coffee. The seeds of the BV plants have been reported to contain 1.15% caffeine (Mazzafera et al., 1992), similar to the value determined by us, but the caffeine content of the tetraploid R4x has not been previously reported and has been shown by us to be higher (3.5%) than in diploid plants of C. canephora. In fact, it is known that there is considerable variation in the caffeine content of C. canephora seeds, ranging from the 0.81% to 3.26% reported by Mazzafera et al. (1997) to the 1.16% to 3.27% reported in the earlier study by Charrier and Berthaud (1975). In seeds, intraspecific studies with C. arabica (Charrier and Berthaud 1975), C. canephora (Ravohitrarivo, 1985, Le Pierres, 1988) and interspecific hybrids from several Coffea species (Mazzafera et al., 1992) have also presented a large range of distribution in the descendants, supporting the quantitative feature of this inheritance. Barre et al., (1998) studied caffeine inheritance in interspecific hybrids from a species with (Coffea liberica) and without (C. pseudozanguebariae) caffeine in the seeds and also came to the conclusion that the caffeine content appeared to be under polygenic control with a strong genetic effect. Caffeine content has often been described as an additive trait in intra- and inter-specific hybrids involving coffee species with caffeine, irrespective of the ploidy level (Capot, 1972, Charrier and Berthaud, 1975, Le Pierres, 1988).

The inheritance of caffeine in leaves was different to that in seeds and showed intermediate values as compared to the parents, although there were no statistically significant differences between the different generations (Table 2). However, the highest caffeine content in leaves occurred in the BV parent and not in the R4x parent, as was the case for seed caffeine content. Previous studies have shown similar values for caffeine in the leaves C. arabica used as P₁ (i.e., 1%: Mazzafera and Magalhães, 1991) and C. canephora R4x used as P₂ (i.e., 0.21%: Silvarolla et al., 1999). In our study, the occurrence of plants transgressive for caffeine in leaves indicate that the parents probably have major and minor genes for caffeine production. Moreover, the observed segregation seems to be a consequence of allogamy (heterozygosity) of the R4x parental line and suggests that this parent contributed with a greater number of alleles to the low caffeine content in leaves than did the other parental line.

The high BSH seen in our study indicates that caffeine levels are mainly controlled by genetic characters and that progress in these populations by selection should be feasible, even considering that BSH is an estimate that takes into account additive, dominant and epistatic effects in the model. Le Pierres (1988) reported high BSH (0.76) and narrow-sense heritability (NSH = 0.33) in C. canephora varieties, while Montagnon et al. (1998) found higher NSH heritability (0.80) for caffeine content in a factorial crossing scheme of C. canephora and attributed this value to the analytical method used and the genetic origin of the parents.

Although interspecific crosses have inherent limitations such as hybrid instability, infertility, non-Medelian segregation and low levels of intergenomic crossing-over (Stebbins, 1958), C. arabica x C. canephora R4x hybrids have been reasonably fertile (Berthaud, 1978; Owuor and Van der Vossen, 1981). In our study we were able to determine the caffeine in the seeds of 71 out of 150 F₂ plants and 24 out of 88 BC₁F₁ plants, indicating a certain degree of fertility. Additionally, our segregation analyses of eight microsatellite-loci markers showed genetic recombination, since five of these showed no differences between the observed and the expected frequencies. A similar conclusion was reported for C. arabica C. canephora R4x hybrids by Lashermes et al. (2000) using RFLP loci and Herrera et al. (2002) using RFLP associated microsatellite-loci.

Our results indicate that breeding for low, or high, caffeine content in seeds could be very efficient and might be accomplished starting from the F₂ or BC₁F₁ generations. We also found that the genetic control of the caffeine content of leaves is different to that for seeds and that the C. arabica BV x C. canephora R4x hybrid seems to be particularly favorable to intergenomic recombination events.

Acknowledgments

This work was supported by the Brazilian National Counsel for Scientific and Technological Development (Conselho Nacional de Desenvolvimento Científico e Tecnológico, CNPq) and The Brazilian national program for Coffee Research and Development (Programa Nacional de Pesquisa e Desenvolvimento do Café – PNP&D/CAFÉ). The authors thank Veronica Andrea Gonzalez-Lopes (Unicamp), Sergio Carbonel (IAC), Allison Chiorato (IAC) and Luís Antônio Stabile da Silva (ESALQ/USP) for help in the statistical data analysis.

Received: May 11, 2007; Accepted: November 8, 2007.

Associate Editor: Everaldo Gonçalves de Barros

• Barre P, Akaffou S, Lourarn J, Charrier A, Halmon S and Noirot M (1998) Inheritance of caffeine and heteroside in an interespecific cross between a cultivated coffee species Coffea liberica var. dewevrei and a wild species caffeine-free C. pseudozanguebariae Theor Appl Genet 96:306-311.
• Berthaud J (1978) Lhybridation interspécifique entre Coffea arabica L. et Coffea canephora Pierre. Obtention et comparaison des hybrides triploïdes arabusta et hexaploïdes. Café Cacao Thé 22:87-109.
• Bertrand B, Guyot B, Anthony F and Lashermes P (2003) Impact of the Coffea canephora gene introgression on beverage quality of C. arabica. Theor Appl Genet 107:387-394.
• Capot J (1972) Lamélioration du caféier en Côte dIvoire: Les hybrides Arabusta. Café Cacao Thé 16:3-18.
• Carvalho A, Tango JS and Monaco LC (1965) Genetic control of the caffeine content of coffee. Nature 205:314.
• Castelo AT, Martins W and Gao GR (2002) Troll-Tandem repeat ocorrence locates. Bioinformatics 18:634-636.
• Charrier A and Berthaud J (1975) Variation de la teneur em cafeíne dans le genre Coffea. Café Cacao Thé 19:251-264.
• Combes MC, Andrzejewski S, Anthony F, Bertrand B, Rovelli P, Graziosi G and Lashermes P (2000) Characterization of microsatellite loci in Coffea arabica and related coffee species. Mol Ecol 9:1178-1180.
• Falconer DS (1960) Introduction to Quantitative Genetics. Ronald Press Co, New York, 365 pp.
• Herrera JC, Combes MC, Anthony F, Charrier A and Lashermes P (2002) Introgression into the allotetraploid coffee (Coffea arabica L.) segregation and recombination of the C. canephora genome in the tetraploid interspecific hybrid (C. arabica x C. canephora). Theor Appl Genet 104:661-668.
• Ky CL, Barre P, Lorieux M, Trouslot P, Akaffou S, Louarn J, Charrier A, Hamon S and Noirot M (2000) Interspecific genetic linkage map segregation distortion and genetic conversion in coffee (Coffea sp.). Theor Appl Genet 101:669-676.
• Krug CA and Mendes AJT (1940) Cytological observations in Coffea - IV. J Genet 39:189-203.
• Lashermes P, Paczek V, Trouslot P, Combes MC, Couturon E and Charrier A (2000) Single-locus inheritance in the allotetraploid Coffea arabica L. and interspecific hybrid C. arabica x C. canephora J Hered 91:81-85.
• Le Pierres D (1988) Influence des facteurs génétiques sur le contrôle de la teneur en caféine du café. Proceedings of the XII Colloquiun Scientifique International sur la Chimie du Café Montreaux, pp 468-475.
• Leroy T, Montagnon C, Charrier A and Eskes AB (1993) Reciprocal recorrent selection applied to Coffea canephora Pierre. I: Characterization and evaluation of breeding populations and value of intergroup hybrids. Euphytica 67:113-125.
• Mazzafera P and Magalhães AC (1991) Cafeína em folhas e semente de espécies de Coffea e Paracoffea Rev Bras Bot 14:157-160.
• Mazzafera P and Carvalho A (1992) Breeding for low seed caffeine-content of coffee (Coffea L.) by interspecific hybridization. Euphytica 59:55-60.
• Mazzafera P, Carvalho A, Fazuoli LC and Medina-Filho HP (1992) Variabilidade do teor de cafeína em sementes de café. Turrialba 42:231-237.
• Mazzafera P, Silvarolla MB, Lima MMA and Medina-Filho HP (1997) Caffeine content of diploid coffee species. Ciênc Cult 49:216-218.
• Mendes AJT (1947) Observações citológicas em Coffea: Métodos de tratamento pela colchicina. Bragantia 7:221-230.
• Montagnon C, Guyot B, Cilas C and Leroy T (1998) Genetic parameters of several biochemical compounds from green coffee Coffea canephora Plant Breed 117:576-578.
• Owuor JBO and Van der Vossen HAM (1981) Interspecific hybridization between Coffea arabica L. and tetraploid Coffea canephora Pierre: I: Fertility in F₁ hybrids and backcrosses to C. arabica Euphytica 30:861-866.
• Ravohitrarivo CP (1985) Comportament hereditaire de la teneur en cafeine chez Coffea canephora Pierre ex-Froehner. Archives du Fofifa/Cenraderu 3:45-56.
• Rovelli RM, Mettulio R, Anthony F, Anzueto F, Lashermes P and Grazioli G (2000) Microsatellites in Coffea arabica L. In: Sera T, Soccol CR, Pandey A and Roussos S (eds) Coffea Biotechnology and Quality. Kluwer Academic Publishers, Dordrecht, pp 123-133.
• Silvarolla MB, Mazzafera P, Lima MMA, Medina-Filho HP and Fazuoli LC (1999) Ploidy level and caffeine content in leaves of Coffea Sci Agric 56:661-663.
• Snedecor GW and Cochran WG (1989) Statistical Methods. 8th edition. Iowa State University Press, Ames, 503 pp.
• Stebbins GL (1958) The inviability weakness and sterility in interspecific hybrids. Adv Genet 9:147-215.
• Thomaziello RA, Oliveira EG, Toledo Filho JA and Costa TE (1996) Cultura do Café. Fundação Cargill, Campinas, 69 pp.
• Vello NA and Vencovsky R (1974) Variâncias associadas às estimativas de variâncias genéticas e coeficiente de herdabilidade. Relatório Científico do Instituto de Genética 8:238-248.
• Vieira LGE, Andrade AC, Colombo CA, Moraes AHA, Metha A, Oliveira AC, Labate CA, Marino CL, Monteiro-VitorelloCB, Monte DC et al. (2006) Brazilian Coffee Genome Project An EST-based genomic resource. Braz J Plant Physiol 18:95-108.

Publication Dates

• Publication in this collection
  24 June 2008
• Date of issue
  2008

History

• Received
  11 May 2007
• Accepted
  08 Nov 2007