Fusarium oxysporum f. sp. phaseoli genetic variability assessed by new developed microsatellites

Abstract

Fusarium oxysporum f. sp. phaseoli (Fop) J.B. Kendrich & W.C. Snyder is the causal agent of Fusarium wilt of common bean (Phaseolus vulgaris L.). The objective of this study was to develop microsatellite markers (SSRs) to characterize the genetic diversity of Fop. Two libraries enriched with SSRs were developed and a total of 40 pairs of SSRs were characterized. Out of these, 15 SSRs were polymorphic for 42 Fop isolates. The number of alleles varied from two to ten, with an average of four alleles per locus and an average PIC (Polymorphic Information Content) of 0.38. The genetic diversity assessed by microsatellites for Fop was low, as expected for an asexual fungus, and not associated with geographic origin, but they were able to detect enough genetic variability among isolates in order to differentiate them. Microsatellites are a robust tool widely used for genetic fingerprinting and population structure analyses. SSRs for Fop may be an efficient tool for a better understanding of the ecology, epidemiology and evolution of this pathogen.

Keywords:
markers; common bean; simple sequence repeats; diversity

Introduction

Fusarium oxysporum f. sp. phaseoli (Fop), causal agent of fusarium wilt in common bean, is currently considered one of the most important bean diseases (Ramalho et al., 2012). The Fop fungus is the main bean soil pathogen and has been established in all bean producing areas of Brazil. Losses caused by this disease have been increasing mainly in areas under successive and irrigated plantations (Toledo-Souza et al., 2012). In addition to the lack of chemical control, this scenario is aggravated by the production of chlamydospores, fungal resistance structures that survive for many years in the soil, even in the absence of the host. For these reasons, the main alternative to control this disease is to obtain resistant cultivars (Cross et al., 2000) that are easily adopted by producers and do not present environmental risks (Gonçalves-Vidigal et al., 2013).

Fusarium species that cause vascular wilting are all classified as Fusarium oxysporum (Pereira, 2009), which forms a complex of soil fungi composed of patotypes classified into various forma specialis, based on pathogenic criteria. They are responsible for the disease in more than 100 plant species (Pantelides et al., 2013). Each forma specialis group is pathogenic to specific plant group, demonstrating the degree of host specificity (Nelson et al., 1983).

Fusariumoxysporum sp. phaseoli can penetrate an intact root tissue, but also penetrate into more developed parts of the root and hypocotyl tissues also occurs, usually through injury or natural openings (Paula Júnior et al., 2006). Fop penetrates plants through the root system and colonizes the xylem, causing wilting, vascular discoloration, chlorosis, dwarfism and premature plant death (Nelson et al., 1983).

In resistant plants, symptoms are few or less expressive; occluding material is observed in the xylem vessels of inoculated plants (Pereira et al., 2013) and it has been associated to a delay in fungal colonization in the host.

In bean plants, the variability of physiological races of the Fop fungus has been studied by several authors (Ribeiro and Hagedorn, 1979a; Ribeiro and Hagedorn, 1979b; Salgado and Schwartz, 1993; Salgado et al., 1995; Woo et al., 1996; Ito et al., 1997; Alves-Santos et al., 2002a). Several physiological races are described, but all authors report that further studies are needed.

There is a preference for microsatellite markers or simple sequence repeats (SSRs) in contrast to other types of markers, since they use the agility of the PCR technique, are codominant and randomly scattered in the genome with a relatively high frequency as well (Karaoglu et al., 2005). DNA sequences flanking microsatellites are generally conserved among individuals of the same species, or even between related species. These sequences are made up of one to six nucleotide repeats that occur naturally in the genome.

Microsatellites in fungi are more difficult to isolate and exhibit a lower polymorphism than in other organisms (Dutech et al., 2007). Bogale et al. (2005) described nine SSR markers developed for the study of Fusarium oxysporum. According to Cruz et al. (2018) there is a positive correlation between Fusarium diversity and its virulence in common bean. A major drawback of this study was that they used only seven polymorphic microsatellites out of eighteen tested to build the clustering and sustain their conclusions of positive correlation between virulence and diversity. A limitation of the use of SSRs in F. oxysporum f. sp. phaseoli, in general, is that very few markers were developed for the study of this fungus. Developing SSR markers is very laborious and costly because it traditionally involves the screening of enriched genomic libraries (Zane et al., 2002). Accurate identification and knowledge of the genetic diversity of pathogenic Fusarium oxyporum f. sp. phaseoli is important in the management of the disease and a large set of microsatellites in needed for providing full genome coverage.

Material and Methods

For the present study, 42 pathogenic isolates of F.oxysporum f. sp. phaseoli were collected in different states of Brazil. The study of diversity and genetic structuring was carried out with the 42 Fop isolates, 3 isolates collected in the State of Goiás, 24 isolates collected in the State of São Paulo, 1 isolate collected in the State of Pernambuco, 10 isolates collected in the State of Minas Gerais, 2 isolates collected in the State of Santa Catarina and 2 isolates collected in the State of Paraná (Table 1).

Table 1
Fusarium oxysporum f. sp. phaseoli isolates with their respective origins and codes.

ID number	Isolate code	City	State	Isolation year
01	IAC 11205	Casa Branca	SP	1999
02	IAC 11299	Capão Bonito	SP	1999
03	IAC 11173	Angatuba	SP	1999
04	IAC 11257	Capão Bonito	SP	1999
05	IAC 11233	Capão Bonito	SP	1999
06	IAC 11472	Itararé	SP	1999
07	IAC 11018	Esp. Santo do Pinhal	SP	1999
08	IAC 11178	Taquarituba	SP	1999
09	IAC 11293	Tarumã	SP	1999
10	IAC 11848	Votuporanga	SP	2000
11	FOP 46 Embrapa	Belém de São Francisco	PE	2001
12	IAC 12802	Capão Bonito	SP	2003
13	IAC 14296	Itapetininga	SP	2009
14	IAC 14353	Campos Novos	SC	2010
15	IAC 14428	Esp. Santo do Pinhal	SP	2010
16	IAC 14435	Pindorama	SP	2010
17	IAC 14352	Campos Novos	SC	2010
18	IAC 14437	Pindorama	SP	2010
19	FOP 42	Santo Antônio de Goiás	GO	2011
20	FOP 48	Foz do Jordão	PR	2011
21	FOP UFV 05 (FOP Canaã)	Canaã	MG	2011
22	FOP Coimbra 04 - UFV	Coimbra	MG	2011
23	FOP UFV 06 (FOP Coimbra)	Coimbra	MG	2011
24	FOP UFV 01	Coimbra	MG	2011
25	FOP UFV 02	Coimbra	MG	2011
26	FOP UFV 03	Coimbra	MG	2011
27	FOP UFV 04	Coimbra	MG	2011
28	IAC 14564	Mococa	SP	2011
29	FOP Coimbra03 -UFV	Coimbra	MG	2011
30	FOP UFV08 (FOP UNAI- UFV)	Unaí	MG	2011
31	IAC 14685	Adamantina	SP	2012
32	IAC 14645	Unaí	MG	2012
33	IAC 14675	Campinas	SP	2012
34	IAC 14629	Cerqueira César	SP	2012
35	IAC 14655	Cerqueira César	SP	2012
36	IAC 14671	Queda do Iguaçu	PR	2012
37	IAC 14684	Votuporanga	SP	2012
38	IAC 14714	Paranapanema	SP	2012
39	FOP UFV09 (UFV Vianópolis)	Vianópolis	GO	2013
40	IAC FOP 03/13	Colina	SP	2013
41	IAC FOP 04/13	Votuporanga	SP	2013
42	IAC FOP 05/13	Alto Paraíso do Goiás	GO	2013

Among the 42 Fop isolates used, 29 isolates belong to the mycoteca of the Phytopathology Laboratory of the Grains and Fiber Centre of the Agronomic Institute (IAC, Campinas, SP), five isolates belong to the micro-library of the Phytopathology Laboratory of EMBRAPA Rice and Beans (Goiânia, GO), and eight isolates belong to the Phytopathology Laboratory of the Federal University of Viçosa - UFV (Viçosa, MG, Table 1). The fungi were maintained in PDA (potato-dextrose-agar) culture medium in a growth chamber incubator at 24 °C.

In this study, two monosporic isolates of the pathogen were classified into physiological races according to the classification system proposed by Alves-Santos et al. (2002b). The same classification system and races were also used in the evaluation of 26 common bean genotypes for resistance to Fusarium oxysporum f. sp. phaseoli by Azevedo et al. (2015). Regarding the origin of the isolates, the first one named IAC 11173 (ID:3) was characterized as being from the American race or race I and the second one, named IAC 11233 (ID:5), characterized as a Brazilian race or race II, obtained from common bean plants with characteristic symptoms of the disease, collected in the municipalities of Angatuba and Capão Bonito, in the State of São Paulo, respectively.

Isolates IAC 11848 (ID:10) and IAC 12802 (ID:12) were used by Silva et al. (2014) in phylogenetic studies from molecular analyses of partial sequences of the elongation factor gene (EF-1α gene) and ribosomal intergenic spacer region (IGS rDNA) of Brazilian Fop strains, where the polyplyletic origin of the strains within both special form types of Fusarium oxysporum (f. sp. phaseoli and f. sp. vasinfectum) was demonstrated.

Isolates 11205 (ID:01), 11299 (ID:02), 11173 (ID:03), 11257 (ID: 4), 11472 (ID: 6), 11178 (ID: 8), Fop 46 (ID:11), 14435 (ID: 16), Fop 42 (ID: 19), Fop UFV01 (ID: 24), Fop UFV02 (ID: 25), Fop UFV03 (ID: 26), Fop UFV04 (ID: 27) and 14629 (ID: 34) were used by Cruz et al. (2018) in a study of molecular diversity in Fusarium oxysporum f. sp. phaseoli of bean fields in Brazil.

Henrique et al. (2015) described the use of three Brazilian pathogenic isolates in the characterization of Fop 46 (ID: 11), Fop 48 (ID: 20) and Fop 42 (ID: 19) of Fusarium oxysporum f. sp. phaseoli identified as races 2, 3 and 6, respectively, which were previously classified by Wendland et al. (2012) using the methodology of Alves-Santos et al. (2002b).

Two enriched microsatellite libraries (adapted from Billotte et al., 1999) were developed, one for race I (IAC 11173, American) and one for race II (IAC 11233, Brazilian) for Fop. Genomic DNA was extracted from fungi mycelium, according to the instructions of the Wizard Genomic DNA Purification kit (Promega). DNA was digested with an Afa I restriction enzyme (10 u/μL) (Invitrogen), followed by the ligation of the Afa 21 adapter fragments (5CTCTTGCTT ACGCGTGGACTA3) and Afa 25 (5TAGTCCACGCGT AAGCAAGAGCACA3). The enrichement process was performed by means of the hybridization of the probes conjugated with biotin, (CT)₈ and (GT)₈.

The fragments enriched for microsatellites were cloned into the plasmidial vector pGEM-T and the transformation to competent cells was performed using a protocol adapted from Avi Levy, 1991 (personal communication). For transformation, 100 μL of E. coli competent cell solution (JM109, Promega) was taken from the −80 °C freezer and placed on ice. Then 2 μL of the ligation and 8 μl of Transfobuffer (10X KCM and 10% PEG) were added, gently shaken, and left on ice for 30 min. After that, the solution was removed and kept at room temperature for 10 min. Then 450 μL of S.O.C. medium (Thermo Fisher Scientific) was added and incubated at 37 °C for 1 hour in a shaker at 225 rpm. Transformed cells were plated in solid LB medium containing ampicillin (50 mg/mL), 60 μL IPTG (24 mg/mL), 60 μL X-Gal (20 mg/mL). One volume of each (bacteria, X-Gal, IPTG) was placed on an opposite portion of the plate, spread with a Drigalsky handle until dry, and incubated overnight at 37 °C. The plates were then refrigerated for 1-2 h so that the colonies turned blue. Positive clones were selected using the β- galactosidase gene. The clones from each library (race I and race II) were sequenced in a 3730 DNA Analyzer (Applied Biosystems). The SSRs were designed using Primer3 Software.

The amplification reactions of the multiplex SSRs were performed in a final volume of 15 L, containing 6.5 μL PCR Master Mix 2x kit (Fermentas), 1 μL DNA (50ng) of each Fop isolate, and concentrations of the individual primer pairs (10 pmol each, Table 2), depending on the intensity of the amplified product. The amplifications were carried out in a thermocycler, with an initial denaturation step of the DNA at 94°C for 4 minutes, followed by 34 cycles at 94°C for 30 seconds, with an annealing temperature for 1 minute and extension of 72°C for 1 minute. At the end of the cycles, there was another extension at 72°C for 10 minutes.

Table 2
Characteristics (the 5’ end labeling fluorophores; F: the forward primer sequences; R: the reverse primer sequences; Ta: annealing temperature; sizes of the amplified fragments in base pairs-bp) of the microsatellites (SSRs) developed for Fusarium oxysporum f. sp. phaseoli isolates.

SSR/ fluorophores	Primer sequences (5’-3’)	Motifs	Number of Alleles	TA (°C)	Sizes of the amplified Fragments (bp)	PIC	GenBank Accession number
	FOP 01-B01 NED	F – CCGCCGATTTCCTTACCT	(AT)9	03	58	237-254	0.13	MK622886
R - GCACCCTTCAAACCTCCA
FOP 07-B01 PET	F - TGAGCGAATGGGAAGAGG	(GGAG)5	06	58	151-225	0.54	MK622887
	R - TGCCAAGGGAGTATCATTTC
FOP 10-B01 PET	F – ATGGGATAGGCGGTTTGG	(TC)3/(AG)3	05	58	236-255	0.77	MK602310
	R - ACTTGGGGTTGAGCGTTG
FOP 13-B01 6FAM	F - TTCTTGCTGATCGCCTCA	(GGCAT)5	02	59	152-167	0.37	MK602312
	R - CCTCCCCTGCAATAAGAGC
FOP 15-B01 NED	F - CCGTCTTCATCTTGGCGTCTA	(AGAT)4	03	54	209-225	0.09	MK622888
	R - TATCTAAGGGGTGGGACGGAG
FOP 16-B01 PET	F - CCGCGCTCTCGAGCAGGG	(ACT)3	02	54	202-205	0.35	MK602313
	R - TGCCGAAGTAAAAGCACGG
FOP 20-B01 6-FAM	F - CCGTTTGGCGCAAGTT	(GA)6	10	54	148-188	0.70	MK622889
	R - CGAGCGGCTTGTCTTCA
FOP 28-B01 PET	F - GTTGCGCTCCCCAATATG	(TC)3/(AT)3	02	56	204-208	0.09	MK622890
	R - CCTCCATTGCCATCCATTT
FOP 35-B01 NED	F - GGCTGGTGGTTTCAAGAGAG	(CAC)6	06	58	210-236	0.40	MK622891
	R – CAAGGCTTCTTCACGGGTAA
FOP 37-B01 NED	F - GCAACACAGGAGGTGGTA	(TGCT)3	04	54	180-192	0.29	MK622892
	R - CAAGGGTATTGGTGCTTG
FOP 08-B02 6-FAM	F - ACAGTGGCTCGTGACTCCA	(CT)3(TA)3	06	59	222-240	0.38	MK602309
	R - TGTTGGCACAGAGGCAGA
FOP 09-B02 NED	F - TGCAGCGATGAGATTGGA	(CCA)3	03	54	165-169	0.35	MK622893
	R - GCGTCATCTCGTGAATCG
FOP 11-B02 VIC	F - AACAGCCGAAGCCGATG	(AG)7	07	59	259-305	0.62	MK602311
	R - TTCACCTTCCACTTGCACA
FOP 18-B02 PET	F - AATGCGGCCACTGTGATT	(TCA)3/(ATC)2	04	59	151-164	0.33	MK602314
	R - GCAGAAGTTGCGGTTGTG
FOP 23-B02 NED	F - CAGGGGCACAGTTCGGTA	(TC)3/(AT)3	04	59	190-196	0.35	MK622894
	R - ATCGGCTGGGACATGAAG

For the automated analyzer genotyping, multiplex sets were formed, containing three to four microsatellite loci (1st multiplex: FOP 01-B01, FOP 10-B01, and FOP 13-B01; 2nd multiplex: FOP 07-B1, FOP 15-B01, and FOP 20-B01; 3rd multiplex: FOP08-B02, FOP11-B02, FOP18-B02, and FOP23-B02; the other primers were used alone). The selection of the oligonucleotides used in the multiplex assembling considered that the same primers do not have complementarity between their bases and the fluorescences had different colors. After assembling the multiplex system, the 5’ end labeling of the oligonucleotides was performed with the 6-FAM, NED, PET, and VIC fluorophores so that only the forward primer was labeled with a fluorophore. The samples used in the genotyping were prepared in a reaction containing 8.85 μL formamide (Applied Biosystems), 0.15 μL standard marker (LIZ 500®, Applied Biosystems) and 1 μL PCR product diluted 20 ×. The amplified fragments were genotyped on a 3730 DNA Analyzer automated sequencer (Applied Biosystems). Product analyses were performed using the Peak Scanner TM v.1 program (Applied Biosystems).

Statistical Analysis

The PIC (Polymorphism Information Content) was calculated based on the number of alleles and frequency. The PIC values were determined by the expression:

$$PIC={\displaystyle \sum _{i=1}^n{f}_i^2}=1{\displaystyle \sum _{j=i+1}^{n=i}2}{f}_i^2\times f_j^2$$

In the above expression, fi is the frequency of allele i in the population (Lynch and Walsh, 1998). The PIC provides an estimate of the discriminatory power of the locus, considering the number of alleles that are expressed and the relative frequencies of these alleles.

A binary data matrix 0 and 1 was generated from the coding of the presence (1) and absence (0) of polymorphic bands present in the isolates and then intrapopulational genetic diversity analyses calculated through the POPGENE (Yeh et al., 1997) were performed. Genetic diversity was inferred through the allelic richness and hierarchical analysis of the Fop isolates. The values of genetic diversity were estimated based on the number of haplotypes in relation to the total number of isolates and their subpopulations (location). To verify the genetic diversity within and between populations, the following were calculated: Total heterozygosity (H_T); Mean heterozygosity within the population (Hs), population differentiation coefficient (G_ST). The estimates of the number and frequency of haplotypes, AMOVA and Wright F_ST estimator (1978) were performed using the ARLEQUIN 3.1 software (Excoffier et al., 2005).

Genome synteny and functional annotation

Molecular markers were aligned to the Fusarium oxysporum f. sp. lycopersici strain 4287 (Ma et al., 2010) using the native nucleotide basic local alignment search tool (BLASTn) and default algorithm parameters (threshold E-value < 1 × 10^-10) from JGI (The Fungal Genomics Resource) version 1.0 (https://genome.jgi.doe.gov/Fusox1/Fusox1.home.html).

Data analysis

The genetic structure of the sample was investigated using the Bayesian clustering algorithm implemented by Structure v.2.3.4 (Pritchard et al., 2000). The No Admixture model was used on the whole dataset with no previous population information and the “no-correlated allele frequencies between populations” option. Ten runs were applied with a burn-in of 200,000 interactions and a run length of 500,000 iterations performed for several clusters varying from K=1 to K=6. To determine the most probable number of clusters, the ad hoc statistic ΔK defined by Evanno et al. (2005) was used. The mean of the absolute values of L’(K) was divided by the standard deviation, where L (K) stands for the mean likelihood plotted over ten runs for each K. A hierarchical analysis of variance was carried out to test the significance of the differentiation among the populations and clusters as defined by Structure software.

Dendrogram trees were produced using genotyping data with 14 SSRs markers using the unweighted neighbor-joining method, as implemented in the DARwin software (version 6.0.9).

Results

From 384 clones that showed good sequencing quality for library 1 (American race), 175 microsatellites were from the American race and from these, 61 clones did not have microsatellites, representing an enrichment of 54.2%. From the total microsatellites found for the American race, dinucleotides were the most abundant (82 sequences), followed by trinucleotides (72 sequences); and among the motifs, the AG dinucleotides were in greater number, followed by the trinucleotide TCA. For the Brazilian race, the most abundant motifs were also the dinucleotides (52 sequences), followed by trinucleotides (48 sequences); and among the motifs, GAG and GAT trinucleotides were found in a greater number, followed by AC dinucleotides (Table 2, Figure S1).

The perfect microsatellites presented the highest number (97 sequences), followed by the compounds (63 sequences) and the imperfect ones (15 sequences) for the American race library. For the Brazilian race library, the perfect microsatellites also presented the highest number (70 sequences), followed by the compounds (35 sequences) and the imperfect ones (11 sequences).

A total of 40 SSRs were developed, and out of these, 15 SSRs were polymorphic (Table 2). The number of alleles ranged from 2 to 10, with an average of four alleles per locus. The highest PIC (Polymorphic Information Content) value was 0.77 for Fop10-B01 (Table 2). The average PIC found was 0.38. In the genetic diversity analysis (Figure 1), the isolates were separated into two major clusters; each of these groups was divided into two smaller subgroups.

Figure 1
Dendrogram generated using genotyping data with 15 SSRs using the unweighted neighbor-joining method, as implemented in the DARwin software. Bootstrap node support was represented in percentages and showed clustering stability. Numbers (%) on the branches correspond to bootstrap values above 45%.

Population analysis performed by Structure software also reinforced these results (Figure 2). The best results were obtained at K = 2 (Figure S2) by Evanno et al. (2005). There was a great correspondence between the isolates grouped by clustering analysis and by population structure analysis except for Fop UFV 01, IAC Fop 05/13 and Fop UFV 02, which grouped externally in the dendrogram and fitted in the first group of Structure.

Figure 2
The genetic structure of the Fop isolates was investigated using the Bayesian clustering algorithm implemented by STRUCTURE v.2.3.4

The percentage of polymorphic loci in isolates within each state ranged from 4.17 to 84.32%, showing low genetic variability of the isolates collected in the states of Goiás (15.62%), Pernambuco (13.54%), Minas Gerais (34%), Santa Catarina (14%) and Paraná (4.17%). The isolates derived from the state of São Paulo presented the highest genetic variability with 84% polymorphic loci and the isolates from the state of Paraná presented the lowest genetic variability with 4.17% polymorphic loci (Table S1).

The estimated total heterozygosity (H_T) was intermediate (Table 3). The mean value obtained from F_ST (0.12) and G_ST (0.33), indicated the genetic structure in the total sample (Table 3). The distribution of genetic variability between and within Fop isolates was characterized by the genetic divergence of Nei (1978). The results of the AMOVA showed that 12% of the genetic variability was among the six States and 87% was within each state (Table 4).

Table 3
Mean and standard deviation of the genetic parameters of the Fusarium oxysporum f. sp. phaseoli isolates.

	HT	HS	GST	FST
Mean	0.13	0.09	0.33	0.12
Standard deviation	0.02	0.009

• H_T: total heterozygosity; H_S: mean gene diversity; G_ST: gene divergence among isolates; F_ST: inbreeding among isolates.

Table 4
Molecular variance analysis (AMOVA) of Fusarium oxysporum f. sp. phaseoli microsatellites.

Populations	DF*	MSSs**	Variance Components	% of the variance
Among isolates	04	19.58	0.30	12.09
Within isolates	38	84.05	2.21	87.91
Total	42	103.64	2.52

• ^*
  DF – Degrees of Freedom;
• ^**
  MSSs – mean sum of squares

Blasting of the expected sequence amplified by the SSRs against Fusarium oxysporum f. sp. Lycopersici genome identified sequences highly similar in chromosomes 1, 2, 4, 5, 7 and 8 (Table 5).

Table 5
Annotation of the SSRs on Fusarium oxysporum f. sp. phaseoli isolates.

Marker name	Organism	Chra	E-value	Gene symbol	Functional annotationb
FOP 01-B01	Fusarium oxysporum f. sp. lycopersici	5	0.0	FOXG_15195	Hypothetical protein
FOP 07-B01	Fusarium oxysporum f. sp. lycopersici	1	0.0	FOXG_00881	Cysteine synthase A
FOP 10-B01	Fusarium oxysporum f. sp. lycopersici	2	3e-164	FOXG_08277	26S proteasome regulatory subunit rpn-1
FOP 13-B01	Fusarium oxysporum f. sp. lycopersici	7	1e-73	FOXG_04761	Hypothetical protein
FOP 15-B01	Fusarium oxysporum f. sp. lycopersici	4	0.0	FOXG_07953	Hypothetical protein
FOP 16-B01	Fusarium oxysporum f. sp. lycopersici	2	8e-155	FOXG_08472	Hypothetical protein
FOP 20-B01	Fusarium oxysporum f. sp. lycopersici	2	0.0	FOXG_11588	Hypothetical protein
FOP 28-B01	Fusarium oxysporum f. sp. lycopersici	2	1e-107	FOXG_08344	Nudix_Hydrolase
FOP 35-B01	Fusarium oxysporum f. sp. lycopersici	8	0.0	FOXG_18524	Hypothetical protein
FOP 37-B01	Fusarium oxysporum f. sp. lycopersici	7	4e-99	FOXG_05342	Hypothetical protein
FOP 08-B2	Fusarium oxysporum f. sp. lycopersici	1	0.0	FOXG_01377	Hypothetical protein
FOP 09-B02	Fusarium oxysporum f. sp. lycopersici	Unknown	0.0	FOXG_17405	Hypothetical protein
FOP 11-B02	Fusarium oxysporum f. sp. lycopersici	2	0.0	FOXG_08568	Ribokinase
FOP 18-B02	Fusarium oxysporum f. sp. lycopersici	1	0.0	FOXG_11114	Hypothetical protein
FOP 23-B02	Fusarium oxysporum f. sp. lycopersici	5	0.0	FOXG_01709	Hypothetical protein

Discussion

Fusarium oxysporum f. sp. phaseoli (Fop) occurs in almost all common bean Brazilian fields (Toledo-Souza et al., 2012), reducing the yield significantly. In the case of Fop, many questions are still open, especially in what concerns the amount of diversity present within this forma specialis. Accurate and rapid identification of Fop is a needed for appropriate disease management. DNA-based techniques have increasingly become the tool of choice for understanding the genetic diversity and phylogeny relationships of Fusarium spp. (Huang et al., 2013; Cruz et al., 2018; Petkar et al., 2019). Microsatellites have been used because of the high resolution they provide (Dutech et al., 2007; Cruz et al., 2018); however, obtaining an acceptable level of polymorphism is generally more difficult in fungi than in other organisms (Dutech et al., 2007). According to Gao et al. (2008), most SSRs found in fungi are dinucleotides and trinucleotides, located in non-coding regions of the genome. This is in accordance to what we have found in both Brazilian and American race libraries. The size of the fungi genome (~59.9 Mb for Fusarium oxysporum) is smaller than those of plants and the longer the genome sequence, the longer the repeated units (Hancock, 2002). Indeed, the relative abundance of SSRs in fungi is low compared with the human genome, and long SSRs in fungi are rare (Karaoglu et al., 2005)

The genetic diversity among the isolates of Fop in this study was low which is in accordance to literature (Bogale et al., 2006). The Fusarium oxysporum species presents asexual reproduction and does not present variation due to meiotic recombination (Ming et al., 1966). Cruz et al. (2018) showed that there was no relationship between the location and the genetic groups found by SSRs clustering. In our study, both the dendrogram and the Bayesian analysis showed that differences between the isolates were not related to their geographical origin. In fact, the introduction of the pathogen into different areas occurs mainly by infected seeds (Fonseca et al., 2002). Common bean seeds of the previous crop are used for planting in the next crop, usually without control of the phytosanitary quality. The exchange and trade of these seeds is a common practice among farmers. Therefore, the absence of strong genetic structure at different spatial scales might be likely related to the spread of the pathogen through human activities. In addition to the nonrandom distribution of SSR clusters in the genome (Vieira et al., 2016), Fop transfer of specific genomic regions (Ma et al., 2010) might contribute to this low isolation by location. In relation to the intermediate estimated total heterozygosity (H^T, Table 3), the species seems to have a reasonable reserve of genetic variability and the AMOVA showed higher genetic variability within each state (Table 4). In fact, Cruz et al. (2018) used SSRs to characterize the genetic diversity of F. oxysporum collected from common bean in different Brazilian states and reported that it was not possible to group them by collected location, or by their pathogenicity.

One of the problems in the characterization of isolates in the F. oxysporum species complex is the assumption that there is a link between pathogenicity and a specific host or a group of host species and sub-species taxa. In most cases this assumption is either incorrect or an oversimplification of the actual situation (Bogale, 2006). Non-pathogenic F. oxysporum isolates are genetically diverse and make up a significant component of the species complex (Bao et al., 2002). Moreover, many phylogenetic studies have shown that some pathogenic isolates are more closely related to non-pathogenic strains than to other pathogenic strains in the same formae speciales or races (Mohammadi et al., 2004; Pasquali et al., 2004). This suggests that pathogenicity may be governed by a few genes, and that most likely, pathogenic genotypes in F. oxysporum arise by transfer of “pathogenicity chromosomes” (Ma et al., 2010). Consequently, the use of pathogenicity as a sole characteristic for grouping F. oxysporum isolates is flawed (Skovgaard et al., 2002).

The average marker's polymorphic information content (PIC) was higher than the one reported by Cruz et al. (2018) and much alike to the one reported by Bogale et al. (2005), who found an allelic diversity for nine microsatellite loci of 0.003-0.895 and a total of 71 alleles among 64 F. oxysporum isolates.

According to the annotation performed, it was found homology to a nudix hydrolase (FOP28-B01, Table 5), which constitutes a large family of proteins that hydrolyze nucleoside diphosphate derivatives. Nudix effectors have been reported in plant pathogenic oomycetes, fungi, and bacteria suggesting that these effectors might be important virulence components in the “toolbox” of plant pathogens (Ge and Xia, 2008; Dong and Wang, 2016).

The Fop10-B01 sequence had high homology with Fusarium oxysporum f. sp. lycopersici 4287 26S proteasome regulatory subunit RPN-1 mRNA (99% identity, E-value 3e-164, Table 5). RPN1a is required for basal defense and R protein-mediated defense (Yao et al., 2012). Some subunits of the 26S proteasome were found to be involved in innate immunity in Arabidopsis and probably in Fusarium oxysporum too.

In Brazil, Fusarium oxysporum f. sp. phaseoli (Fop) occurs in almost all common bean-producing areas (Batista et al., 2016), significantly reducing the yield. The difficulty in obtaining resistant genotypes to Fop is due to the diversity of physiological races that the pathogen presents, making necessary the study of the genetic and physiological variability of the pathogen. Several control methods are available, but none are efficient. There is no completely resistant common bean cultivar available on the market and no dominant resistance gene has been properly identified yet. The development of tools allowing early detection of the pathogen and effective disease control relies on the knowledge of the pathogen diversity. This study is expected to serve as an important groundwork for further genetic variation research on F. oxysporum f. sp. phaseoli.

Acknowledgments

The authors would like to thank the São Paulo Research Foundation (FAPESP - Fundação de Amparo à Pesquisa do Estado de São Paulo, grants 2011/05786-7; 2011/12416-1) for funding and supporting this research and providing the scholarship to the first author.

References

• Alves-Santos FM, Ramos B, Garcia-Sanchez MA, Eslava AP and Diaz-Minguez JMA (2002a) DNA - based procedure for in plant detection of Fusarium oxysporium f. sp. phaseoli Phytopathology 92:237-244.
• Alves-Santos FM, Cordeiro-Rodrigues L, Sayagués JM, Martin-Dominguez R, Garcia-Benavides P, Díaz-Mínguez JM and Eslava AP (2002b) Pathogenicity and race characterization of Fusarium oxysporium f. sp. phaseoli isolates from Spain and Greece. Plant Pathol 51:605-611.
• Azevedo CVG, Ribeiro T, Silva DA, Carbonell SAM and Chiorato AF (2015) Adaptabilidade, estabilidade e resistência a patógenos em genótipos de feijoeiro. Pesq Agropec Bras 50:912-922.
• Batista RO, Oliveira AMCE, Silva JLO, Nicoli A, Carneiro PCS, Carneiro JES, Paula Júnior TJ and Queiroz MV (2016) Resistance to Fusarium wilt in common bean. Crop Breed Appl Biotechnol 16:226-233.
• Bao JR, Fravel DR, O’Neill NR, Lazarovits G and van Berkum P (2002) Genetic analysis of pathogenic and non-pathogenic Fusarium oxysporum from tomato plants. Can J Bot 80:271-279.
• Billotte N, Lagoda PJL, Risterucci AM and Baurens FC (1999) Microsatellite-enriched libraries: applied methodology for the development of SSR markers in tropical crops. Fruits 54:277-288.
• Bogale M (2006) Molecular characterization of Fusarium isolates from Ethiopia. PhD Thesis, University of Pretoria, Pretoria, 164 p.
• Bogale M, Wingfield BD, Wingfield MJ and Steenkamp ET (2005) Simple sequence repeat markers for species in the Fusarium oxysporum complex. Mol Ecol 5:622-624.
• Bogale M, Wingfield BD, Wingfield MJ and Steenkamp ET (2006) Characterization of Fusarium oxysporum isolates from Ethiopia using AFLP, SSR and DNA sequence analyses. Fungal Divers 23:51-66.
• Cross H, Brick MA, Schwartz HF, Panella LW and Byrne PF (2000) Inheritance of resistance to Fusarium wilt in two common bean races. Crop Sci 40:954-958.
• Cruz AF, Silva LF, Sousa TVS, Nicoli A, Junior TJDEP, Caixeta ET and Zambolim L (2018) Molecular Diversity in Fusarium Oxysporum isolates from common bean fields in Brazil. Eur J Plant Pathol 152:343-354.
• Dutech C, Enjalbert J, Fournier E, Delmonte F, Barrès B, Carleir J, Tharreau D and Giraud T (2007) Challenges of microsatellite isolation in fungi. Fungal Genet Biol 44:933-949.
• Dong S and Wang Y (2016) Nudix effectors: A common weapon in hte arsenal of plant pathogens. PLoS Pathog 12:e1005704.
• Evanno G, Regnaut S and Goudet J (2005) Detecting the number of clusters of individuals using the software Structure: A simulation study. Mol Ecol 14:2611-2620.
• Excoffier L, Laval G and Schneider S (2005) Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evol Bioinform 1:47-50.
• Fonseca JR, Vieira EHN and Vieira RF (2002) Algumas características do feijão coletado na zona da Mata de Minas Gerais. Rev Ceres 49:81-88.
• Gao LZ and Xu HY (2008) Comparisons of mutation rate variation at genome-wide microsatellites: evolutionary insights from two cultivated rice and their wild relatives. BMC Evol Biol 8:11.
• Ge XM and Xia Y (2008) The role of AtNUDT7, a Nudix hydrolase, in the plant defense response. Plant Signal Behav 3:119-120.
• Gonçalves-Vidigal MC, Cruz AS, Lacanallo GF, Vidigal Filho PS, Sousa LL, Pacheco CMNA, Gepts P and Pastor-Corrales MA (2013) Co-segregation analysis and mapping of the anthracnose co-10 and angular leaf spot Phg-on disease-resistance genes in the common bean cultivar Ouro Negro. Theor Appl Genet 126:2245–2255.
• Hancock JM (2002) Genome size and the accumulation of simple sequence repeats: implications of new data from genome sequencing projects. Genetics 97:93-103.
• He HH, Meyer CA, Hu SS, Chen MW, Zang C, Liu Y, Rao PK, Fei T, Xu H, Long H et al. (2014) Refined DNase-seq protocol and data analysis reveals intrinsic bias in transcription factor footprint identification. Nat Methods 11:73-78.
• Henrique FH, Carbonell SAM, Ito MF, Gonçalves JGR, Sasseron GR and Chiorato AF (2015) Classification of physiological races of Fusarium oxysporum f. sp. phaseoli in common bean. Bragantia 74:84-92.
• Huang CH, Roberts PD, Gale LR, Elmer WH and Datnoff LE (2013) Population structure of Fusarium oxysporum f. sp. radicis-lycopersici in Florida inferred from vegetative compatibility groups and microsatellites. J Plant Patho 136:509-521.
• Ito MF, Carbonell SAM, Pompeu AS, Ravagnani RC, Lot RC and Rodrigues LCN (1997) Variabilidade de Fusarium oxysporium f. sp. phaseoli. Fitopatol Bras 22:270-271.
• Karaoglu H, Lee MY and Meyer W (2005) Survey of simple sequence repeats in completed fungal genomas. Mol Biol 22:639-649.
• Lynch M and Walsh JB (1998) Genetics and analysis of quantitative traits. Sinauer Associates, Sunderland, 980 p.
• Ma LJ, Van Der Does HC, Borkovich KA, Coleman JJ, Daboussi MJ, Di Pietro A, Dufresne M, Freitag M, Grabherr M, Henrissat B et al. (2010) Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium Nature 464:367-373.
• Mace ME, Bell AA and Beckman CH (1981) Fungal wilt diseases of plants. Academic Press, New York, 654 p.
• Mohammadi M, Aminipour M and Banhashemi Z (2004) Isozyme analysis and soluble mycelial protein pattern in Iranian isolates of several formae speciales of Fusarium oxysporum J Phytopathol 152:267-276.
• Nei M (1978) Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89:583-590.
• Nelson PE, Toussoun TA and Marasas WFO (1983) Fusarium species: an illustrated manual for identification. Pennsylvania State University Press, State College, 193 p.
• Pantelides IS, Jamos SET, Pappa S, Kargakis M and Paplomatas EJ (2013) The ethylene receptor ETR1 is required for Fusarium oxysporum pathogenicity. Plant Pathol 62:1302-1309.
• Pasquali M, Marena L, Gullino L and Garibaldi A (2004) Vegetative compatibility grouping of the Fusarium wilt pathogen of paris daisy (Argyranthemum frutescens L.). J Phytopathol 152:257-259.
• Paula Júnior TJ, Lobo Júnior M, Sartorato A, Vieira RF, Carneiro JES and Zambolim L (2006) Manejo integrado de doenças do feijoeiro em áreas irrigadas: guia técnico. Empresa de Pesquisa Agropecuária de Minas Gerais, Viçosa, 48 p.
• Pereira AC, Cruz MFA, Paula-Júnior TJ, Rodrigues FA, Carneiro JES, Vieira RF and Carneiro PCS (2013) Infection process of Fusarium oxysporum f. sp. phaseoli on resistant, intermediate and susceptible bean cultivars. Trop Plant Pathol 38:323-328.
• Pereira MJZ, Ramalho MAP and Abreu AFB (2009) Inheritance of resistance to Fusarium oxysporum f. sp. phaseoli Brazilian race 2 in common bean. Sci Agric 66:788-792.
• Petkar A, Harris-Shultz K, Wang H, Brewer MT, Sumabat L and Ji P (2019) Genetic and phenotypic diversity of Fusarium oxysporum f. sp. niveum populations from watermelon in the southeastern United States. PLoS One 14:e0219821.
• Pritchard JK, Stephens M and Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155:945-959.
• Ramalho MAP, Abreu AFB, Carneiro JES, Wendland A, Paula Junior TJ, Vieira RF, Del Peloso MJ, Lobo Junior M and Pereira AC (2012) Murcha de fusário. In: Paula Junior TJ and Wendland A (eds) Melhoramento genético do feijoeiro-comum e prevenção de doenças. Empresa de Pesquisa Agropecuária de Minas Gerias, Viçosa, pp 127-138.
• Ribeiro RLD and Hagedorn DJ (1979a) Screening for resistance to and pathogenic of Fusarium oxyporium f. sp. phaseoli, the causal agent of bean yellows. Phytopathology 69:272-276.
• Ribeiro RLD and Hagedorn DJ (1979b) Inheritance and nature of resistance in beans to Fusarium oxysporum f. sp. phaseoli. Phytopathology 69:859-861.
• Salgado MO and Schwartz HF (1993) Physiological specialization end effects of inoculum concentration on Fusarium oxysporium f. sp. phaseoli in common beans. Plant Dis 79:492-496.
• Salgado MO and Schwartz HF (1995) Inheritance of resistance to a Colorado race of Fusarium oxysporium f. sp. phaseoli in common bens. Plant Dis 79:279-281.
• Silva FPDA, Vechiato MH and Harakava R (2014) EF-1α gene and IGS rDNA sequencing of Fusarium oxysporum f. sp. vasinfectum and F. oxysporum f. sp. phaseoli reveals polyphyletic origin of strains. Trop Plant Pathol 39:64-73.
• Skovgaard K, Bødker L and Rosendahl S (2002) Population structure and pathogenicity of members of the Fusarium oxysporum complex isolated from soil and root necrosis of pea (Pisum sativum L.). FEMS Microbiol Ecol 42:367-374
• Toledo-Souza ED, Silveira PM, Café-Filho AC and Lobo-Júnior M (2012) Fusarium wilt incidence and common bean yield according to the preceding crop and the soil tillage system. Pesqui Agropecu Bras 47:1031-1037.
• Vieira MC, Santini L, Diniz AL and Munhoz CF (2016) Microsatellite markers: what they mean and why they are so useful. Genet Mol Biol 39:312-328.
• Wendland A, Möller PA, Cortes MVB, Lobo MJR, Melo LC, Pereira HS, Costa JGC and Faria LC (2012) Novas raças de Fusarium oxysporum f. sp. phaseoli identificadas via detecção específica por PCR. Summa Phytopathol 38:249.
• Woo SL, Zoina A, Del Sorbo G, Lorito M, Nanni B, Scala F and Noviello C (1996) Characterization of Fusarium oxysporium f. sp. phaseoli by pathogenic races, VCGs, RFLP, and RAPD. Phytopathology 86:966-973.
• Yao C, Wu Y, Nie H and Tang D (2012) RPN1a, a 26S proteasome subunit, is required for innate immunity in Arabidopsis. Plant J 71:1015-1028.
• Yeh FC, Yang RC and Boyle T (1997) POPGENE Version 1.32. Microsoft Windows – Based Freeware for Population Genetic Analysis. University of Alberta, Edmonton.
• Zane L, Bargelloni L and Patarnello T (2002) Strategies for microsatellite isolation: a review. Mol Ecol 11:1-16.

Internet Resources

• Ming YN, Lin PC and Yu TF (1966) Heterokaryosis in Fusarium fujikuroi (Saw.) Wr. Scientia Sinica Online, http://migre.me/7oI41 (accessed 16 January 2020).
  » http://migre.me/7oI41

Supplementary Material

The following online material is available for this article:

Figure S1

- Electropherogram with the peak of the allele of the microsatellite.

Figure S2

- Number ideal cluster's according to the methodology of EVANO et al. (2005).

Table S1

- Mean, standard deviation of the genetic parameters obtained for the 14 microsatellites.

• Associate Editor:

  Célia Maria de Almeida Soares

Publication Dates

• Publication in this collection
  29 May 2020
• Date of issue
  2020

History

• Received
  11 Aug 2019
• Accepted
  11 Mar 2020