SciELO - Scientific Electronic Library Online

 
vol.18 issue6Thrombospondin in protein malnutrition induced hypoplasiaPossible thrombogenic mechanisms of hyperhomocysteinemia and its nutritional treatment author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

  • Portuguese (pdf)
  • Article in xml format
  • How to cite this article
  • SciELO Analytics
  • Curriculum ScienTI
  • Automatic translation

Indicators

Related links

Share


Revista de Nutrição

Print version ISSN 1415-5273On-line version ISSN 1678-9865

Rev. Nutr. vol.18 no.6 Campinas Nov./Dec. 2005

http://dx.doi.org/10.1590/S1415-52732005000600004 

ORIGINAL ORIGINAL

 

Transcrição reversa na determinação da expressão do mRNA para a enzima conversora de angiotensina testicular em animais tratados com zinco

 

Assessment of the reverse transcriptase polymerase chain reaction technique in the determination of the mRNA expression for the testicular angiotensin-converting enzyme in zinc treated rats

 

 

Gilberto Simeone HenriquesI, 1; Adriana Gisele Hertzog da SilvaI; Rosário Dominguez Crespo HirataII; Mario Hiroiuki HirataII; Sílvia Maria Franciscato CozzolinoI

ILaboratório de Nutrição-Minerais, Departamento de Alimentos e Nutrição Experimental, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo. Av. Lineu Prestes, 580, Bloco 14, 05389-970, São Paulo, SP, Brasil
IILaboratório de Biologia Molecular Aplicada ao Diagnóstico, Departamento de Análises Clínicas e Toxicológicas, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo. São Paulo, SP, Brasil

 

 


RESUMO

OBJETIVO: O objetivo deste trabalho foi otimizar as condições reacionais capazes de ocasionar variabilidade e de introduzir erros sistemáticos na reação em cadeia pela polimerase aplicada à análise da expressão gênica da isoforma testicular da enzima conversora de angiotensina.
MÉTODOS: Avaliaram-se a concentração de cDNA, a concentração dos iniciadores, a temperatura de hibridização e o número de ciclos de desnaturação, hibridização e extensão. Para tanto, extraiu-se o RNA total por meio da reação com fenol-clorofórmio e isotiocianato de guanidina de amostras de testículos de ratos Wistar alimentados com uma ração contendo zinco. Em seguida, gerou-se o cDNA por transcrição reversa. Utilizando-se iniciadores específicos, amplificaram-se o gene de interesse (isoforma testicular da enzima conversora de angiotensina) e o gene controle Gliceraldeído-3-Fosfato-Desidrogenase. As amostras foram então aplicadas em gel de agarose e submetidas à eletroforese, coradas em brometo de etídio e visualizadas sob luz ultravioleta.
RESULTADOS: Demonstrou-se que a melhor condição reacional para a reação em cadeia pela polimerase da isoforma testicular da enzima conversora de angiotensina e do Gliceraldeído-3-Fosfato-Desidrogenase foi: (1) concentração inicial de cDNA de 2µg, (2) concentração de iniciadores de 200nM, (3) temperatura de hibridização entre 57,5ºC e 60,1ºC e (4) 33 ciclos.
CONCLUSÃO: Com essa otimização pôde-se minimizar as interferências sobre a técnica, contribuindo-se para a obtenção de dados comparativos a respeito da expressão gênica da enzima conversora de angiotensina testicular.

Termos de indexação: dieta, enzima conversora de angiotensina, expressão gênica, reação em cadeia de polimerase via transcriptase reversa, zinco.


ABSTRACT

OBJETIVE: The aim of the present work was to optimize the reaction conditions capable of generating variability and introducing systematic errors in the chain reaction of the polymerase used to analyze the gene expression for the testicular isoform of the angiotensin-converting enzyme.
METHODS:The cDNA concentration, primer concentration, hybridization temperature and number of denaturation, hybridization and extension cycles were evaluated. For this purpose, samples of testis from Wistar rats fed a zinc containing diet were used to extract total RNA using the phenol-chloroform-isothiocyanate reaction. Stable cDNA was then generated by the reverse transcription reaction. Using specific primers, the gene of interest (testicular isoform of the angiotensin-converting enzyme) and the housekeeping gene for the expression of Glyceraldehyde-3-Phosphate Dehydrogenase were amplified. The samples were then submitted to gel eletrophoresis in agarose gel, stained with ethide bromide and visualized in a UV chamber.
RESULTS: The results showed that the best reaction conditions for the chain reaction by the testicular isoform polymerase of the angiotensin-converting enzyme and for Glyceraldehyde-3-Phosphate Dehydrogenase were: (1) initial cDNA concentration of 2 µg, (2) primer concentration of 200nM, (3) hybridization temperature between 57.5ºC and 60.1ºC and (4) 33 cycles.
CONCLUSION: It was concluded that this optimization minimized interference of the technique, contributing to the production of true, comparative data for the testicular angiotensin- converting enzyme gene expression.

Indexing terms: diet, angiotensin-converting enzyme, gene expression, reverse transcriptase polymerase chain reaction, zinc.


 

 

INTRODUÇÃO

Historicamente, vários estudos têm sido conduzidos com o objetivo de experimentar e se possível validar métodos e medidas de avaliação do estado nutricional relativo ao zinco. Dentre esses, estão aqueles que buscam mensurar parâmetros funcionais e de expressão de enzimas dependentes desse elemento. Álcool desidro-genase, anidrase carbônica, fosfatase alcalina e enzima conversora de angiotensina parecem ser as enzimas mais promissoras e capazes de fornecer dados bioquímicos e moleculares que reflitam de maneira precisa o efeito da biodisponibilidade do metal sobre tecidos-alvo1. Levando-se em conta que a regulação da expressão gênica de proteínas chave para o metabolismo dos organismos vivos pode ser mensurada com acurácia por técnicas de biologia molecular, tornou-se possível o estabelecimento de protocolos para avaliação da variação desse parâmetro de acordo com a ingestão dietética de zinco2,3.

Zinco e Expressão da ECA testicular

A isoforma testicular da enzima conversora de angiotensina (ECA) é exemplo desse tipo de interação, estando sujeita a um controle regulatório pelo zinco, a ponto de a deficiência do metal poder causar a redução do RNA mensageiro (mRNA) que codifica para a ECA. A diminuição da expressão do mRNA correlaciona-se positivamente com a redução da atividade enzimática4. A ECA é uma metaloenzima dependente de zinco expressa nos órgãos que compõem o sistema reprodutor masculino quando os animais atingem a puberdade, período no qual ocorre grande aumento em sua atividade, estabilizando-se na idade adulta5. Trata-se de um polipeptídeo constituído de 732 resíduos de aminoácidos, dos quais os primeiros 67 aminoácidos aminoterminais são exclusivos dessa isoforma, enquanto o restante da proteína é idêntica à metade carboxiterminal da isoforma sistêmica da enzima6.

Diversos métodos freqüentemente são utilizados para a avaliação da expressão gênica em vários tipos de tecidos. O método de RT-PCR tem-se mostrado um dos mais versáteis e eficazes7. Porém, padronizações são necessárias para que se possa atingir graus elevados de precisão e confiabilidade.

Baseando-se nesses fatos, o presente trabalho objetivou padronizar as condições reacionais que poderiam levar a uma grande variabilidade e introduzir erros sistemáticos à técnica de transcrição reversa seguida da reação em cadeia pela polimerase (Reverse Transcriptase Polymerase Chain Reaction - RT-PCR) aplicada à avaliação da expressão gênica da isoforma testicular da enzima conversora de angiotensina como parâmetro da biodisponibilidade de zinco em dietas experimentais.

 

MÉTODOS

Foram selecionadas amostras de testículos de 12 ratos Wistar provenientes de um estudo no qual se administrou zinco por meio de dietas semipurificadas semelhantes à AIN-93. A composição centesimal média da ração experimental (n=5) apresentou concentração de 16,25% (r=0,88) de proteínas, 11,00% (r =0,79) de lipídios, 32,53 (r =5,04) mg/kg de zinco, percentual de umidade de 8,14 (r 0,16) e de cinzas totais de 3,02 (r= 0,12). Todos os animais cujas amostras foram utilizadas para este trabalho receberam em média 35mg de Zn/kg de ração, segundo a recomendação do American Institute of Nutrition8. Os testículos foram retirados sob anestesia (Sódio-Pentobarbital, 50mg/kg de peso), 50 dias após o desmame e armazenados congelados com nitrogênio (-80º) até a extração de RNA.

Extração do RNA total das amostras de testículo coletadas

O RNA total foi obtido a partir da extração com isotiocianato de guanidina, fenol e clorofórmio baseado no método de Chomczynsky & Sacchi9, utilizando-se o reagente TRIZOL®. Pesou-se em média 70mg de tecido (corte contendo uma secção do testículo revestido pelo epidídimo) ainda congelado, transferindo-o para um tubo homogeneizador de Potter. Em seguida, adicionou-se 1mL de reagente TRIZOL® (1mL para cada 50 a 80mg de tecido) e iniciou-se a extração do tecido, pressionando um pistilo de vidro esmerilhado contra as paredes do tubo. Transferiu-se o homogeneizado para tubos Ependorff, e com o auxílio de uma seringa estéril de 3mL, completou-se a homogeneização, puncionando gentilmente o seu conteúdo. Adicionaram-se então 200µL de clorofórmio e incubaram-se as amostras homogeneizadas por cinco minutos à temperatura ambiente, quando, então, elas foram centrifugadas a 12.000 x g por 15 minutos sob temperaturas de 2 a 8ºC. Após essa fase, o RNA encontrava-se na fase aquosa. Removeu-se a fase aquosa com uma pipeta automática equipada com ponteira de barreira física, tomando-se o cuidado de não remover a interface. Em seguida, precipitou-se o RNA, utilizando 500µL de álcool isopropílico para cada 1mL de reagente TRIZOL® adicionado anteriormente. Incubaram-se as amostras por dez minutos a uma temperatura entre 15 e 30ºC, centrifugando-as em seguida a 12.000 x g por 10 minutos, sob temperaturas de 2 a 8ºC. O sobrenadante foi desprezado, e o sedimento foi redissolvido com 1mL de etanol a 75%; os tubos foram agitados e centrifugados a 7.500 x g por 5 minutos a temperaturas de 2 a 8ºC. Finalmente, redissolveu-se o RNA em 50µL de água tratada com dietilpirocarbonato (DEPC), aliquotando-o em frações de 15µL e procedendo-se à leitura espectrofotométrica das soluções nos comprimentos de onda 260 e 280nm para a determinação da concentração de RNA total em cada amostra extraída e de uma estimativa do seu grau de pureza a partir da relação A260/A280.

Avaliação eletroforética do RNA total extraído

A integridade das amostras de RNA foi verificada por eletroforese em gel de agarose a 1,00% contendo formaldeído a 2,2M e tampão MOPS [MOPS a 20mM (pH 7,0), acetato de sódio a 8mM e EDTA a 1mM (pH 8,0)] preparado com água esterelizada tratada com DEPC, segundo as recomendações de Sambrook et al.10. Pipetou-se em tubos de microcentrífuga de 0,2mL, 4,5µL de RNA total, 2µL de tampão MOPS [MOPS a 100mM (pH 7,0), acetato de sódio a 40mM e EDTA a 5 mM (pH 8,0)], 3,5µL de formaldeído a 37,00% e 10µL de formamida. A seguir, os tubos foram incubados por quinze minutos a 65ºC e imediatamente transferidos para um banho de gelo. Após rápida centrifugação, 2µL do tampão de amostra preparado com água tratada com DEPC [glicerol a 50,00%, azul de bromofenol a 0,25%, xilenocianol FF a 0,25% e EDTA a 1mM (pH 8,0)] foram acrescentados a cada tubo. Em seguida, as amostras foram aplicadas no gel imerso em tampão MOPS [MOPS a 20mM (pH 7,0), acetato de sódio a 8mM e EDTA a 1mM (pH 8,0)], previamente submetido a pré-eletroforese por cinco minutos a 5V/cm. Aplicaram-se também 5µL do marcador de tamanho molecular de RNA de 0,24 a 9,5kb diluído 1:6 em tampão de amostra. A separação eletroforética foi feita a 4 V/cm até que o corante azul de bromofenol migrasse 8cm, utilizando a fonte modelo EPS 200. Após a separação eletroforética, cada gel foi cuidadosamente removido e visualizado por meio da incidência de radiação ultravioleta em uma câmara escura equipada com um transluminador e uma câmera digital acoplada a um microcomputador dotado de um software de captura e análise de imagens em tempo real (ChemImagerTM). Após os devidos ajustes de exposição cada imagem foi documentada e armazenada em formato digital.

Transcrição reversa (RT) - Síntese do cDNA

Para obter-se o DNA complementar (cDNA) que serviria posteriormente como molde para amplificação pela reação em cadeia pela polimerase (PCR), uma alíquota equivalente a 1µg de RNA total foi utilizada na reação de transcrição reversa, utilizando-se os seguintes reagentes: - Tampão 5X concentrado (Tris/HCl a 250mM, pH 8,3; KCl a 375mM; MgCl2 a 15mM e ditiotreitol a 100mM), mistura de desoxinucleotídeos (dATP, dCTP, dGTP e dTTP) com concentração de 10mM cada, iniciadores randômicos (2µL, 200ng), 200 unidades (1µL) de transcriptase reversa - MMLV (vírus da mieloblastose de aves murino, produzida em bactéria E. coli) SuperScript II®. Seguiu-se o seguinte protocolo experimental, recomendado pelo fabricante da enzima: Em tubos eppendorf de 0,2mL distribuíram-se alíquotas de 1µL da mistura de desoxinucleotídeos, 1µL da solução de iniciador randômico e 2µg de RNA total extraídos dos testículos, completando-se o volume do tubo para 12µL, com água destilada estéril. Essa mistura foi então aquecida por cinco minutos a 65ºC, resfriando-a logo em seguida em um banho de gelo. Adicionaram-se então 5µL de tampão de RT (5X) e 2µL de DTT (100 mM), misturando o conteúdo e submetendo-o a novo aquecimento a 42ºC por dois minutos, após os quais adicionou-se 1µL da enzima transcriptase reversa (MMLV), deixando-a reagir por 50 minutos à temperatura de 42ºC. Aqueceu-se ainda a solução a 70ºC por 15 minutos, para que ocorresse a inativação da reação.

Amplificação do cDNA, utilizando-se a reação em cadeia pela polimerase (PCR) em duplex

A amplificação dos segmentos de cDNA foi feita utilizando iniciadores que flanqueiam uma região da seqüência correspondente à isoforma testicular da ECA, conforme descrito por Ramaraj et al.11. Concomitantemente, utilizaram-se iniciadores para um gene constitutivo (GAPDH) como controle da reação, de acordo com o trabalho de Tokunaga et al.12. Adicionaram-se a 2µL da mistura diluída de cDNA de cada gene obtido por transcrição reversa, 5µL de tampão de PCR (Tris/HCl a 75mM, pH 9,0; KCl a 50mM; MgCl2 a 2,0mM, (NH4)2SO4 a 20mM), 2,0µL de mistura de desoxinucleotídeos a 0,4mM cada (dATP, dCTP, dGTP e dTTP), 1µL de cada iniciador específico (sense e antisense) a 200nM, 1,0µL de Taq DNA polimerase (1U/µL), completando-se o volume final para 50µL, com água deionizada estéril.

Os iniciadores específicos para o gene da ECA testicular foram sintetizados nos laboratórios da Life Technologies (São Paulo, Brasil). A seqüência de bases dos iniciadores utilizados na amplificação por PCR e suas respectivas posições nas seqüências do DNA complementar de origem foram (5' ® 3'): ECA - Isoforma Testicular - CTGAGTCAGGTGGCCACTGA (sense, posição 79 - 98), e GGGCATACAAGTGCCATTTG (anti-sense, posição 551-570). GAPDH - GAAGGTGAAGGTCGGAGTC (sense) e GAAGATGGTGATGGGATTC (anti-sense).

A reação em cadeia pela polimerase foi realizada em um termociclador modelo PTC-200, obedecendo-se à seqüência de um ciclo de desnaturação inicial a 98ºC por 3 minutos, seguido de 30 ciclos compostos de desnaturação a 94ºC por 1 minuto, hibridação a 60ºC por um minuto e 30 segundos e extensão a 72ºC por 1 minuto e 30 segundos e finalmente um ciclo de extensão final a 72ºC por 10 minutos. Terminada a etapa dos ciclos, a reação foi interrompida por resfriamento a 4ºC. Todas as etapas necessárias à padronização dessas condições estão descritas no item resultados.

Avaliação eletroforética dos produtos de amplificação

A partir da obtenção dos produtos da reação de PCR, alíquotas de 5µL de cada amostra foram adicionadas a 1µL de tampão de amostra (azul de bromofenol a 0,25%, xilenocianol-FF a 0,25% e glicerol a 30,00%) e então analisadas por meio de eletroforese em gel de agarose a 2,00% em tampão TBE (Tris-Borato-EDTA) contendo Tris-HCl a 0,45mM, ácido bórico a 0,45mM e ácido etilenodiaminotetraacético (EDTA) a 2,5mM em pH 8,0. Os parâmetros de eletroforese adotados foram 100 V de corrente por 30 minutos. O número de bases do DNA amplificado foi determinado por comparação a um marcador de tamanho molecular de DNA de 100bp.

Após a separação eletroforética, cada gel foi cuidadosamente removido e corado por imersão em uma solução de brometo de etídio a 0,5µg/mL por 3 minutos. Dessa solução os géis de agarose contendo os produtos de PCR eram lavados com água destilada (dez minutos) e visualizados por meio da incidência de radiação ultravioleta em uma câmara escura equipada com um transluminador e uma câmera digital acoplada a um microcomputador dotado de um software de captura e análise de imagens em tempo real (ChemImagerTM). Após os devidos ajustes de exposição cada imagem foi documentada e armazenada em formato digitalizado, tornando-se disponível para a etapa de análise de imagem.

Medida semiquantitativa da expressão gênica da ECA

Após a documentação, os géis foram submetidos à análise densitométrica utilizando-se o software ChemImagerTM.

Para as provas finais, utilizaram-se os géis nos quais amplificaram-se concomitantemente o gene de interesse (ECA testicular) e o gene constitutivo utilizado como controle (GAPDH), possibilitando o cálculo da expressão relativa do gene de interesse. O GAPDH foi escolhido como controle pelo fato de ser expresso de maneira constante e abundante nas células de mamíferos. A medida da expressão do RNA mensageiro da ECA foi obtida em valores relativos (expressão relativa) entre a densidade óptica da banda correspondente ao produto de amplificação do gene da ECA e a densidade óptica da banda correspondente ao produto de amplificação do gene da GAPDH. Selecionaram-se áreas iguais para cada banda analisada e a interferência de fundo foi corrigida pela medida de dez pontos em torno da região utilizada como branco da reação.

Controle de qualidade das análises moleculares

Verificou-se a cada amplificação realizada a partir da reação em cadeia pela polimerase (PCR) o aparecimento de bandas que não representassem os genes para os quais os iniciadores haviam sido desenhados e o acontecimento de reações inespecíficas. Utilizou-se o controle de reagentes, colocando-se no tubo controle todos os reagentes para a reação de amplificação, exceto o cDNA. Para a obtenção das provas finais, mais de 10% das reações foram repetidas aleatoriamente. A contaminação com DNA genômico durante a execução da técnica de RT-PCR foi excluída utilizando-se oligonucleotídeos desenhados exclusivamente, tomando-se por referência as seqüências de exons do cDNA dos genes em estudo. Sendo assim, evidenciaria-se a presença de DNA genômico por meio da amplificação de fragmentos maiores contendo também os iintrons. Utilizou-se também o controle de reagentes durante as reações de transcrição reversa.

A descrição estatística dos dados foi realizada com o auxílio do software Statistica 5.0®. A variação total dos dados de cada tratamento foi decomposta a partir de uma análise de variância de uma via (Anova one-way). As diferenças entre as médias foram testadas aplicando-se o teste "t" não pareado.

 

RESULTADOS E DISCUSSÃO

Para que se pudesse fazer a determinação da expressão do mRNA da isoforma testicular da enzima conversora de angiontensina, uma série de testes e de padronizações foram necessárias para que o procedimento fosse realizado com acurácia e precisão. A aplicação conjunta dos cDNA's do gene de interesse e do gene controle (técnica duplex) foi utilizada para que se diminuísse ao máximo a variabilidade intra e interensaio13. Com base no trabalho de Kessler et al.14 e nas temperaturas de desnaturação dos iniciadores, foram determinadas as condições iniciais da PCR. Quatro parâmetros básicos foram avaliados: (1) A concentração inicial de RNA total necessária para a amplificação do cDNA; (2) a concentração de iniciadores; (3) a temperatura de hibridização dos genes de interesse e controle e (4) o número de ciclos de desnaturação, hibridização e extensão para cada um deles.

Primeiramente, variou-se a quantidade de RNA utilizado para a síntese do cDNA, mantendo-se as concentrações dos demais reagentes da RT e PCR constantes. Como pode ser observado na Figura 1, há uma diferença significativa porém pequena na amplificação quando comparadas as três concentrações de RNA utilizadas. Quando utilizou-se a concentração de 2µg de RNA de partida, observou-se uma melhor amplificação quando comparada com 1 ou 3µg, ainda que para as três condições avaliadas a relação ECA/GAPDH tenha sido baixa. A quantidade de RNA de partida necessária à detecção da expressão gênica da ECAt parece ser influenciada pelo estado nutricional relativo ao zinco. Stallard & Reeves15, trabalhando com ratos Wistar deficientes em zinco, só conseguiram obter dados significativos de expressão da ECAt ao utilizar concentrações maiores do que 3µg de RNA total de partida, indicando menor expressão do gene de interesse.

 

 

Em seguida avaliou-se a concentração de iniciadores de 100, 200 ou 300nM na amplificação dos genes da ECA testicular e da GAPDH. Como se pode observar na Figura 2, encontrou-se uma diferença significativa entre o primeiro tratamento (100nM) e os demais (200 e 300nM). Esses últimos apresentaram a melhor amplificação para ambos os genes, o que pode ser comprovado pela análise densitométrica, revelando relações ECA/GAPDH iguais (a diferença encontrada não foi estatisticamente significativa ao nível de p<0,05).

 

 

As temperaturas de hibridização para os genes estudados também foram analisadas. Para tanto, utilizou-se um gradiente de temperatura que permitiu variar a temperatura de hibridização em cada tubo separadamente. Continuou-se utilizando amostras escolhidas para os ensaios anteriores, que haviam amplificado de maneira satisfatória para que se pudesse determinar a melhor temperatura de hibridização. Como se pode observar no gel (Figura 3), a temperatura em que o fragmento apareceu mais nítido e que apresentou a melhor relação densitométrica ECA/GAPDH encontrou-se entre 57,5 e 60,1ºC, havendo diferença significativa (p<0,05) entre esses dois tratamentos. A partir de 62ºC notou-se que a amplificação do gene da ECA diminuiu sensivelmente.

 

 

A partir da definição da temperatura ideal de hibridização, partiu-se para a determinação do número de ciclos da reação de PCR necessário para a amplificação dos segmentos de cDNA de interesse. Isso implicou determinar um número de ciclos constante de um intervalo que compreendesse um sinal mínimo de amplificação (como o que pode ser visto aos 27 ciclos na Figura 4) e um sinal máximo (como pode ser visto aos 33 ciclos também na Figura 4, mais notadamente para o gene da GADPH). Aos 33 ciclos, a reação apresentou a melhor relação densitométrica ECA/GAPDH, existindo diferenças significativas ao nível de p<0,05 entre todos os tratamentos avaliados. Trabalhos que avaliaram a expressão gênica de metaloproteínas frente à suplementação com zinco por meio da RT-PCR obtiveram resultados significativos de amplificação com um número de ciclos semelhante (30 ciclos para as metalo-tioneínas)16. O contrário acontece quando os animais são deficientes em zinco15,17, observando-se um aumento do número de ciclos de PCR necessários à amplificação do gene de interesse, o que por si só pode se constituir um importante limitante da técnica, pela probabilidade de amplificação de segmentos inespecíficos do DNA complementar.

 

 

Após o estabelecimento das condições experimentais acima descritas, foi possível determinar de forma rápida a expressão do mRNA da isoforma testicular da enzima conversora de angiontensina em amostras de testículos de ratos Wistar submetidos à alimentação com uma ração experimental contendo zinco a partir de parâmetros seguros de aplicação da técnica de RT-PCR (Figura 5).

 

 

CONCLUSÃO

A partir dos dados obtidos pode-se concluir que com a otimização de parâmetros da técnica de RT-PCR, como a concentração inicial de cDNA, a concentração de iniciadores, a temperatura de hibridização, o número de ciclos da reação além de ajustes em outras variáveis (e.g. concentrações de DNTP e de MgCl2) foi possível minimizar interferências importantes que influenciam negativamente a avaliação da expressão gênica da ECA testicular, levando à obtenção de dados mais precisos e passíveis de comparação científica confiável.

 

AGRADECIMENTO

À Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP).

 

REFERÊNCIAS

1. Henriques GS, Hirata MH, Cozzolino, SMF. Aspectos recentes da absorção e biodisponibilidade do zinco e suas correlações com a fisiologia da isoforma testicular da Enzima Conversora de Angiotensina. Rev Nutr. 2003; 16(3):333-45.         [ Links ]

2. Blanchard RK, Cousins RJ. Diferencial display of intestinal mRNA's regulated by dietary zinc. Proc Acad Sci USA. 1996; 93:6863-8.         [ Links ]

3. Blanchard RK, Cousins RJ. Regulation of intestinal gene expression by dietary zinc: induction of uroguanylin mRNA by zinc deficiency. J Nutr. 2000; 130(5 Suppl):1393S-98S.         [ Links ]

4. Stallard L, Reeves PG. Zinc deficiency in adult rats reduces the relative abundance of testis-specific angiotensin-converting enzyme mRNA. J Nutr. 1997; 127(1):25-9.         [ Links ]

5. Strittmatter SM, Thiele EA, De Souza EB, Snyder SH. Angiotensin-converting enzyme in the testes and epididymis: differential development and pituitary regulation of isozymes. Endocrinology. 1985; 117(4):1374-9.         [ Links ]

6. Ehlers MR, Fox EA, Strydom DJ, Riordan JF. Molecular cloning of human testicular angiotensin-converting enzyme: the testis isozyme is identical to the C-terminal half of endothelial angiotensin-converting enzyme. Proc Natl Acad Sci USA. 1989; 86(20):7741-5.         [ Links ]

7. Siebert P. The PCR technique: RT-PCR. BioTechniques Books, Eaton Publishing; 1998.         [ Links ]

8. Reeves PG, Nielsen FH, Fahey GC. AIN-93 purified diets for laboratory rodents: final report of the American Institute of Nutrition Ad Hoc Writing Committee on the reformulation of the AIN-76A rodent diet. J Nutr. 1993; 123(11):1939-51.         [ Links ]

9. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extractcion. Anal Biochem. 1987; 162(1):156-9.         [ Links ]

10. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. New York: Cold Spring Harbor (CSH); 1989. v.1. cap. 7 - Extraction, purification and analysis of messenger RNA from eukaryotic cells. p. 7.3-7.87.         [ Links ]

11. Ramaraj P, Kessler SP, Colmenares C, Sen GC. Selective restoration of male fertility in mice lacking angiotensin-converting enzymes by sperm-specific expression of the testicular enzyme. J Clin Invest. 1998; 102(2):371-8.         [ Links ]

12. Tokunaga K, Nakamura Y, Sakata K, Fujimori K, Okubo M, Sawada S. Enhanced expression of a glyceraldehydes-3-phosphate dehydrogenase gene in human lung cancers. Cancer Res. 1987; 47(21):5616-9.         [ Links ]

13. Spencer WE, Christensen MJ. Multiplex relative RT-PCR method for verification of differential gene expression. BioTechniques. 1999; 27(5):1044-6, 1048-50, 1052.         [ Links ]

14. Kessler SP, Rowe TM, Blendy JA, Erickson RP, Sen GC. A cyclic AMP response element in the angiotensin-converting enzyme gene and the transcription factor CREM are required for transcription of the mRNA for the testicular isozyme. J Biol Chem. 1998; 273(16):9971-5.         [ Links ]

15. Stallard L, Reeves PG. Zinc deficiency in adult rats reduces the relative abundance of testis-specific Angiotensin-converting enzyme mRNA. J Nutr. 1997; 127(1): 25-9.         [ Links ]

16. Sullivan VK, Burnett FR, Cousins RJ. Metallothionein expression is increased in monocytes and erythrocytes of young men during zinc supplementation. J Nutr. 1998; 128(4): 707-13.         [ Links ]

17. Reeves PG, Rossow KL. Zinc deficiency affects the activity and protein concentration of angiotensin-converting enzyme in rat testes. Proc Soc Exp Biol Med. 1993; 203(3):336-42.         [ Links ]

 

 

Recebido para publicação em 15 de março e aceito em 15 de dezembro de 2004.

 

 

1 Correspondência para/Correspondence to: G.S. HENRIQUES. E-mail: <nativo@usp.br>.

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License