Txnip inhibits porcine adipocyte differentiation through PPARγ and impairs the induction of glucose via ChREBP

ABSTRACT

To explore the functions of Txnip and its mechanism in adipocyte differentiation, the preadipocytes were isolated from subcutaneous adipose tissue of three-day-old piglets and induced into adipogenic differentiation. The expression of Txnip and ChREBP was silenced, and the Txnip overexpression was achieved in the cells with transfection of the recombinant lentivirus strategies. Txnip silencing promoted the differentiation of porcine preadipocytes and PPARγ expression, and a PPARγ inhibitor reduced this facilitation. Instead, Txnip overexpression exerted a suppressive effect on the cell differentiation and PPARγ expression, and the PPARγ agonist offset this inhibition. High glucose stimulated the preadipocyte differentiation and expressions of ChREBP and Txnip. In contrast, Txnip expression was reduced by ChREBP silencing, suggesting glucose-regulated Txnip expression through the mediation of ChREBP. Moreover, the expressions of ChREBP and Glut4 induced by high glucose and glucose uptake of the cells were reduced by Txnip-overexpression, but increased by Txnip silencing, while these changes of Txnip did not alter their expressions under low glucose. Collectively, Txnip could be an inhibitor of porcine preadipocyte differentiation, which attenuated the adipogenesis through the negative feedback regulation on PPARγ. Txnip impaired the induction of glucose on the preadipocyte differentiation through decreasing Glut4 expression and glucose uptake and subsequent decrease of the expression and transcriptional activity of ChREBP.

Keywords:
adipose tissue; lipid; pig

1. Introduction

The body fat deposition in animals is characterized by the increment in adipogenesis at a cellular level. Adipogenesis is a comprehensive result of preadipocyte proliferating and differentiating into adipocytes. The adipocyte differentiation is regulated by a complex and coordinated gene expression program and many protein factors are involved in this process. Thioredoxin-interacting protein (Txnip), as the endogenous inhibitor, inhibits the reduction activity of thioredoxin (Trx) and then regulates many fundamental cellular processes, including differentiation (Hsiao et al., 2022), apoptosis (Schuster et al., 2018), and metabolism (Kim et al., 2018). Increasing evidence suggests Txnip plays a key physiological role in cell development (Chutkow and Lee, 2011; Park et al., 2018). However, it is unclear the function of Txnip and its mechanism in the adipogenesis of porcine adipocytes, are the primary cells for de novo lipogenesis.

The carbohydrate diet is the main energy source and substrate for de novo lipogenesis in pigs. It has been reported that glucose promoted Txnip expression in 3T3-L1 cells (Robinson et al., 2013) and cancer cells (Waldhart et al., 2017). A study on 3T3-L1 cells showed that ChREBP activation induces peroxisome proliferator-activated receptor γ (PPARγ) activity and promotes adipocyte differentiation by controlling the generation of PPARγ endogenous fatty acid ligand, which is regulated by de novo synthesis and desaturation of fatty acids (Witte et al., 2015). PPARγ is considered the main transcription factor regulating adipogenesis and plays a central role in adipocyte differentiation (Stachecka et al., 2019). The PPARγ activation invokes the expression of target genes related to adipogenesis, resulting in continuous fat accumulation (Mueller, 2014). Consequently, Txnip might participate in the induction of glucose on adipogenesis through ChREBP, which is interesting in regulating fat deposition in pigs.

In this report, we presented a mechanism whereby Txnip inhibited porcine adipocyte differentiation through the negative feedback regulation of PPARγ expression and transcriptional activity. Moreover, we confirmed that Txnip expression in the adipocyte was promoted by glucose. In turn, it hindered glucose uptake of the cells via down-regulating Glut4 expression, which reduced expression and activity of ChREBP and impaired the porcine adipocyte adipogenesis induced by glucose.

2. Material and Methods

2.1. Experimental animals

This research was carried out in Lanzhou, Gansu, China (Latitude 36°03' N and Longitude 103°40' E). Three-day-old male crossbred piglets (Duroc × Landrace × Large White) from different litters were used in this study. Research on animals was conducted according to the institutional committee on animal use (case no. 0307/2018).

2.2. Primary cell culture

Primary preadipocytes were prepared as previously described (Zhang et al., 2015) and maintained in the basal medium, DMEM/F12 medium (GIBCO/BRL, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, ScienCell, Carlsbad, CA, USA), at 37 °C in humidified atmosphere with 5% CO₂. The cells grown to confluence were incubated to initiate differentiation with the adipogenic medium, containing 100 nmol L⁻¹ insulin (Sigma-Aldrich), 1 μmol L⁻¹ dexamethasone (Sigma-Aldrich), and 0.5 mmol L⁻¹ IBMX (Sigma-Aldrich) in the basal medium, for three days. Then, a differentiation medium with 100 nmol L⁻¹ insulin (Sigma-Aldrich) in the basal medium was used until sample collection. The medium was changed every other day.

2.3. Construction and transfection of recombinant lentivirus expression vector

The coding region of porcine Txnip gene was generated by gene synthesis according to the Genebank (No. NM_001044614.2) and cloned into the lentivirus transfer vector pGLV5 (EF-1aF/GFP&Puro) by restriction endonuclease digestion with NotI and NsiI to construct recombinant Txnip overexpression lentivirus LV5-Txnip. After transformed into competent E. coli DH5α cells and identified by restriction enzyme digestion and sequencing, the lentivirus LV5-Txnip was obtained by the homologous recombination between EF-1aF/GFP&Puro and packaging plasmid (pGag/Pol, pRev and pVSV-G) (GenePharma, Shanghai, China). The recombinant lentivirus was packaged and amplified in 293T cells. After purification, a virus titer was detected by the green fluorescent protein (GFP)-labeled method. An empty lentivirus vector (LV5-GFP) was used as the control. The primary porcine preadipocytes at 30 to 40% confluence were transfected with the lentivirus with polybrene (8 μg mL⁻¹) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.

2.4. Lentivirus siRNA construction and transfection

The recombinant lentivirus harboring shRNA against porcine Txnip were designed by using a lentivirus system, and the sequences of the oligonucleotides used to create Txnip-siRNA were as follows: Txnip-shRNA-F is 5'-GATCCGGATCTAGTGGATGTCAATACttcaagagaGTATTGACATCCACTAGATCCTTTTTTG-3' and Txnip–shRNA-R is 5'-AATTCAAAAAAGGATCTAGTGGATGTCAATACtctcttgaaGTATTGACATCCACTAGATCCG-3'. Negative siRNAs did not share sequence similarity with any reported S. Scrofa gene sequences and was used as control. Control-shRNA-F is 5'-GATCCGTTCTCCGAACGTGTCACGtttcaagagaACGTGACACGTTCGGAGAACTTTTTTG-3' and control-shRNA-R is 5'-AATTCAAAAAAGTTCTCCGAACGTGTCACGttctcttgaaACGTGCACGTTCGGAGAACG-3'. The nucleotides were subcloned into the BamHI/EcoRI site of Lentiviral vector (pGLV3/H1/GFP+Puro). All the shRNA were confirmed by DNA sequencing. Porcine preadipocytes at density of 30-40% were transfected with Txnip-siRNA or control-siRNA using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.

ChREBP-siRNA was constructed in our laboratory before, and the detailed information is described in the study by Zhang et al. (2015).

2.5. Cell treatments and determination of glucose content

The cultured preadipocytes transfected with Txnip-siRNA, ChREBP-siRNA, or LV5-Txnip grew to 70-80% confluence and were exposed to the adipogenic medium with 5 mmol L⁻¹ glucose (0 d). The cells were harvested on 0-10 d after adipogenic inducing for the Oil Red O staining, real-time RT-PCR, and Western blotting assays.

To determine the role of PPARγ in the adipocyte differentiation regulated by Txnip, the Txnip silencing cells and the Txnip overexpression cells were treated separately with the PPARγ inhibitor GW9662 (15 μmol L⁻¹) and agonist rosiglitazone (1 μmol L⁻¹) for 48 h, and then the cellular lipid content was measured.

To investigate the effect of both Txnip silencing and overexpression on glucose uptake and utilization, the cells were cultured for 48 h under low glucose (5 mmol L⁻¹), and then cultured for 48 h in the medium containing 20 mmol L⁻¹ glucose (Sigma-Aldrich). The medium was collected to determine glucose content by ELISA (Jonln, Shanghai, China). The relevant information of cell treatments sequence was described in detail in the corresponding legend of resulting graph.

2.6. Cellular lipid content measurement

At indicated times (see the legend of figures), the cellular lipid content analysis was performed according to a modified Oil Red O staining extraction from Ramírez-Zacarías et al. (1992). In brief, the cells cultured in 24-cell plates were rinsed twice with Ca²⁺ and Mg²⁺-free PBS, and fixed in 10% neutralized formalin for 30 min. Cells were stained for 2 h by complete immersion in 0.2% Oil Red O (Sigma-Aldrich) prepared in 60% isopropanol solution followed by exhaustive rinse with water. Cell morphology was examined and photographed with a microscope. The stained culture dishes were subjected to dye extraction with isopropanol. The optical density (OD) of the solution was measured at 510 nm for quantification, using a UV-2102 PC ultraviolet spectrophotometer (Unico Instrument Co., Ltd., Shanghai, China).

2.7. Real-time PCR

Total cellular RNA was extracted using Trizol reagent using standard techniques (Gibco/BRL, Grand Island, NY) and the cDNA obtained using a reverse transcription kit (Invitrogen). Real-time PCR was performed using a Superscript RT III enzyme kit (Invitrogen). SYBR Green was used as the detection reagent for quantification. The relative expression of each target gene was expressed using the comparative threshold cycle (2^−ΔΔCT) method and β-actin as an internal control. The specificity of the PCR amplification was always verified with melting curve analysis. The information of specific primers used in this study was listed in Table 1.

Table 1
Primer for real-time PCR

Gene	Accession no.	Primer sequence (5' to 3')	Product length (bp)
Txnip	NM_001044614.2	S: AACAGGGGAGAATGAGATGGTG	167
		A: CTTGAGTTGGCTGGCTTGG
ChREBP	DQ372586.1	S: GCTCAACGCTGCCATCAA	88
		A: GTCCCGCATCTGGTCAAAG
PPARγ	NM_214379.1	S: AGGACTACCAAAGTGCCATCAAA	142
		A: GAGGCTTTATCCCCACAGACAC
Glut4	NM_001128433	S: AGTGGCTGGGAAGGAAGAAG	164
		A: TGAGGAACCGTCCAAGAATG
ACC1	NM_001114269.1	S: AAGGGCTGCCTCTAATG	287
		A: GATGTAAGCGCCGAACT
β-actin	AF054837	S: GATCGTGCGGGACATCAA	180
		A: AGGAAGGAGGGCTGGAAGAG

2.8. Western blotting

The cultured cells were scraped with protein lysis buffer (RIPA, Beyotime, Shanghai, China) supplemented by a protease inhibitor (Pierce, Rockford, IL, USA). Lysates were then quantitated, and twenty micrograms of protein were subjected to SDS-PAGE and transferred to PVDF membrane (Millipore, USA). Membranes were incubated with antibodies against PPARγ and β-actin (Santa Cruz Biotechnology).

2.9. Statistical analysis

Data was presented as mean±SEM. Data were analyzed by ANOVA using SPSS version 17.0 software (SPSS science, Chicago, IL, USA). Duncan's multiple range tests was used for statistical comparisons. P<0.05 was regarded as statistically significant.

3. Results

3.1. Txnip expression silencing promoted porcine preadipocyte differentiation

To determine the function of Txnip in the differentiation of the porcine preadipocytes, lentivirus-mediated Txnip interference system was constructed. The silencing efficiency for Txnip expression in the preadipocytes transfected with Txnip-siRNA reached around 75%. The lipid content increased significantly with the adipogenic differentiation, and the content was higher in Txnip silencing cells than in control cells on days 4 to 8 (P<0.05) (Figure 1A). The increment effect of Txnip silencing on adipogenic differentiation on day 8 was also shown by the Oil Red O staining (Figure 1B). As expected, the lipid accumulation markedly increased by silencing of Txnip expression. Consistent with the lipid content in the cells, the mRNA expression of PPARγ increased significantly when Txnip expression was silenced. Txnip silencing did not affect the expressions of ChREBP and Glut4 throughout the differentiation stage, although their expressions increased gradually with the preadipocyte differentiation (Figure 1C). In agreement with the mRNA expression, the expression level of PPARγ protein on day 6 increased significantly compared with that on day 2 in both control and Txnip-silencing cells and was significantly higher in Txnip-silencing cells than in control cells (Figure 1D).

Figure 1
Txnip silencing expression promoted porcine preadipocyte differentiation.

Moreover, on day 4 after adipogenic inducing, the adipocytes transfected with Txnip-siRNA were exposed to 15 μmol L⁻¹ of GW9662 (a PPARγ inhibitor) for 48 h, and the differentiation of the cells decreased markedly compared with that of untreated cells, which implied that the differentiation promoted by Txnip silencing was abated by the reduced PPARγ activity (Figure 1E).

3.2. Txnip overexpression inhibited porcine preadipocyte differentiation

The lentivirus-mediated Txnip overexpression system was established further to investigate the role of Txnip in porcine preadipocyte differentiation. The preadipocytes were transfected with LV5-Txnip, and Txnip mRNA level was raised by about 80 folds compared with the cells transfected with LV5-GFP. Txnip overexpression inhibited porcine preadipocyte differentiation, which was verified by the decreased amount of lipid accumulation in the Oil Red O staining assay performed on 0-8 d after adipogenic inducing (Figures 2A and B). The mRNA expression of PPARγ was significantly lower in cells infected with LV5-Txnip than in cells infected with LV5-GFP on days 2 to 8 (P<0.05). In accordance with this, the PPARγ protein expression level decreased significantly in the cells of Txnip overexpression (Figures 2C and D). Txnip overexpression had no effect on the expressions of ChREBP and Glut 4 throughout the differentiation (Figure 2C).

Figure 2
Txnip overexpression inhibited porcine preadipocytes differentiation.

Txnip-overexpression cells were exposed to 1 μmol L⁻¹of rosiglitazone for 48 h, and the differentiation of the cells increased markedly compared with that of untreated cells, although it was still lower than that of the control cells (Figure 2E), which implied that the differentiation impaired by Txnip overexpression was relieved by the heightened PPARγ activity.

3.3. Differentiation and Txnip expression of porcine preadipocyte was promoted by glucose

Porcine preadipocytes growing to confluence were exposed to the adipogenic medium containing 5 mmol L⁻¹glucose (control) or 20 mmol L⁻¹ glucose (high glucose), and the differentiation was determined (Figure 3A). The lipid content in both control and high-glucose-treated cells increased significantly at the onset of adipogenic induction, respectively (P<0.05). However, the lipid content was higher in high-glucose-treated cells than in control cells from d 4 (P<0.05), which showed high glucose promoted the differentiation of porcine preadipocytes.

Figure 3
Effect of glucose on adipogenesis.

In addition, the expressions of PPARγ, Glut4, ChREBP, and Txnip increased with the prolonged culture time in both control and high-glucose-treated cells (P<0.01) (Figure 3B). The expressions of PPARγ, Glut4, and Txnip reached a maximum on day 6 after adipogenic induction (P<0.05), and the PPARγ expression decreased on days 8 and 10 compared with that on d 6 (P<0.05). ChREBP expression increased significantly from day 2 (P<0.05), and reached a maximum on day 8. Compared with low glucose, high glucose treatment significantly improved the expressions of PPARγ, ChREBP, and Txnip from days 2 to 10, and Glut4 expression from days 4 to 8 after adipogenic induction (P<0.05). Thus, high glucose facilitated the expressions of PPARγ, Glut4, ChREBP, and Txnip.

3.4. ChREBP mediated the expression of Txnip induced by glucose

The previous studies showed that ChREBP is the main mediator of glucose-induced adipogenesis. To understand whether glucose regulates the expression of Txnip through ChREBP, preadipocytes transfected with ChREBP-siRNA were treated with high glucose, and then Txnip expression was detected (Figure 4). In low-glucose condition, there was no difference in the Txnip expression between control and ChREBP silencing cells (P>0.05). When cultured in high-glucose concentration, the Txnip expression in control-siRNA cells increased significantly on days 2 to 8 (P<0.05). In ChREBP silencing cells, however, Txnip expression was not affected by high-glucose treatment (P>0.05) and was markedly lower than in control-siRNA cells (P<0.01), indicating that ChREBP silencing decreased the Txnip expression induced by high glucose.

Figure 4
ChREBP silencing decreased the Txnip expression in differentiating porcine adipocytes induced by high glucose.

Furthermore, considering that high glucose stimulated PPARγ expression, we tested whether the Txnip mRNA expression induced by high glucose was affected by PPARγ activity. When the differentiating adipocytes transfected with control-siRNA were treated with rosiglitazone or with GW9662, the high glucose-induced Txnip expression was not altered. Similarly, the decreased Txnip expression by ChREBP silencing under high glucose was not changed by rosiglitazone or GW9662 (Figure 4B). These data suggested that transcription factor ChREBP, other than PPARγ, mediated Txnip expression induced by high glucose.

3.5. Txnip inhibited glucose uptake in the porcine adipocytes via Glut4

To determine the effect of Txnip on glucose uptake and utilization, the differentiating adipocytes were treated with 20 mmol L⁻¹ of glucose for 48 h. Then the expressions of Glut4, ChREBP, and ACC1 in the cells and the glucose content in the medium surrounding the cells were detected. Glucose content in the surrounding medium was higher in Txnip-overexpression cells than in the cells transfected with LV5-GFP (P<0.01), indicating glucose uptake was decreased by Txnip overexpression (Figure 5A). Instead, Txnip silencing decreased the glucose content in the surrounding medium (P<0.05), which showed glucose uptake of the cells was promoted (Figure 5A). The expressions of Glut4, ChREBP, and ACC1 induced by high glucose were significantly decreased in Txnip-overexpression cells compared with LV5-GFP cells (P<0.05), and were increased in Txnip-siRNA cells compared with control-siRNA cells (Figure 5B), although the expressions of Glut4 and ChREBP were not affected by both Txnip overexpression and silencing under low glucose condition (P<0.01) (Figures 1C and 2C). These data suggested that Txnip overexpression could reduce glucose uptake of the cells through downregulation of Glut4 expression, thereby decreasing the expression and transcriptional activity of ChREBP, while Txnip silencing exerted the opposite effects.

Figure 5
Effect of Txnip overexpression or silencing on the glucose uptake (A) and relative mRNA expressions (B) of differentiating adipocytes.

4. Discussion

The thioredoxin system, which is composed of NADPH, thioredoxin reductase (TrxR), and thioredoxin (Trx), is a key antioxidant system in defense against oxidative stress through its disulfide reductase activity regulating protein dithiol/disulfide balance (Dagdeviren et al., 2023). Thioredoxin-interacting protein (Txnip) directly binds to Trx and inhibits its reducing activity through disulfide exchange, regulating cellular redox status and linking between redox regulation and the pathogenesis of diseases (Yoshihara et al., 2014). Here, we showed that the differentiation of porcine preadipocytes was significantly reduced by Txnip overexpression and stimulated by Txnip silencing, which suggested Txnip was an inhibitor of adipocyte differentiation. Other studies also supported this view. Chutkow and Lee (2011) reported that Txnip inhibited the differentiation of 3T3-L1 preadipocytes and endogenous Txnip protein was rapidly degraded at the onset of adipogenesis, and loss of Txnip increased adipogenesis in culture and adiposity in vivo. Txnip influenced adipocyte development in vivo, and played an important role in glucose homeostasis and lipid metabolism (Chutkow and Lee, 2011; Kim et al., 2007).

PPARγ is a member of the nuclear receptor superfamily of ligand-dependent transcription factors and is highly expressed in adipose tissue of humans and animals, and its expression is markedly induced during adipogenesis (Lee et al., 2019). Several studies have established that PPARγ is a molecular switch for adipocyte development both in vitro and in vivo (Aprile et al., 2018; Mueller, 2014). PPARγ was induced during the adipogenic differentiation of 3T3-L1 cells, a prerequisite for adipocyte differentiation (Poulsen et al., 2012). In this study, PPARγ expression in porcine preadipocytes increased rapidly at the early stage of differentiation (2 d), peaked at the middle stage (6 d), and decreased significantly at the late stage (8-10 d), which was consistent with the results observed in 3T3-L1 preadipocytes (Ji et al., 2015). Furthermore, it was observed that Txnip overexpression resulted in a remarkable downregulation of PPARγ expression in transcript and protein levels, and conversely, its expression markedly increased after the silencing of Txnip expression. In addition, when the Txnip overexpression cells were treated with rosiglitazone to activate PPARγ, the inhibition of Txnip overexpression on adipocyte differentiation was partially restored. However, when Txnip silencing cells were treated with GW9662 to inhibit PPARγ activity, the enhanced cell differentiation was abated. It was suggested that Txnip inhibited the differentiation of porcine preadipocytes by reducing the expression and transcriptional activity of PPARγ. Txnip promoter contained multiple PPARγ binding sites, and Txnip expression was negatively regulated by PPARγ (Qi et al., 2009). Txnip expression was highly upregulated when PPARγ was depleted from anaplastic thyroid cancer cells (Morrison et al., 2014). Chutkow et al. (2010) also demonstrated that Txnip was a negative regulator of PPARγ expression, and in turn, PPARγ activation suppressed Txnip expression. Therefore, Txnip could inhibit the differentiation of porcine preadipocytes through negative feedback to regulate PPARγ expression.

Glucose, the main substrate for lipogenesis in mammals that utilize carbohydrates as the major energy source, induced adipocyte differentiation and de novo lipogenesis. ChREBP is a glucose-responsive transcription factor that plays a critical role in converting excess carbohydrates to triglycerides through de novo lipogenesis (Herman et al., 2012; Uyeda and Repa, 2006). ChREBP has been established to be a key transcription factor in adipogenesis induced by glucose in hepatocytes, 3T3-L1 cells, and rat adipocytes (Burgess et al., 2008; Herman et al., 2012; Iizuka et al., 2012). Glucose stimulated ChREBP expression and activated its transcriptional activity through the intermediate glucose-6-phosphate, and thus regulated the expressions of target genes, including Txnip and ACC1 (Jeong et al., 2011; McFerrin and Atchley, 2012). In the present study, the adipogenesis was significantly stimulated, and the expressions of ChREBP and Txnip were upregulated in porcine adipocytes when treated with high glucose. In accordance with the result, ChREBP and Txnip expressions in 3T3-L1 and human adipocytes were elevated by high glucose concentrations (Peshdary et al., 2019; Witte et al., 2015). However, Txnip expression in ChREBP-silencing cells was not affected by high glucose. Although PPARγ activation suppressed Txnip expression (Chutkow et al., 2010), Txnip expressions in both control cells and ChREBP-silencing cells under high glucose were not altered by PPARγ inhibitor or agonist. There are two ChoREs on the promoter of Txnip gene (Yu and Luo, 2009), and the glucose-stimulated Txnip expression was mediated by ChREBP (Cha-Molstad et al., 2009). Thereupon, it was indicated that glucose promoted the Txnip expression through ChREBP in porcine adipocytes; that is, ChREBP, rather than PPARγ, is a mediator of glucose-induced Txnip expression.

Txnip has been described as a major regulator of glucose metabolism (Gunes et al., 2015; Parikh et al., 2007). However, how Txnip regulated the adipocyte differentiation induced by glucose was unclear. Therefore, we investigated the effect of Txnip on expressions of ChREBP, Glut4, and ACC1 in differentiating adipocytes, as well as on glucose uptake. Glut4 is generally regarded as the main glucose transporter in adipocytes, skeletal muscle cells, and other cells with high glucose metabolism, and the high concentration of glucose enhances glucose uptake and metabolism by inducing Glut4 expression (Ehebauer et al., 2020; Jung and Bu, 2020; Kwon et al., 2020). Aguiari et al. (2008) found that high glucose significantly improved the expression of Glut4 in primary rat adipose-derived stem cells. The expressions of ChREBP and Glut4 induced by high glucose were reduced by Txnip overexpression and further increased by Txnip silencing, while their basal expression under the low glucose culture was not altered by these changes of Txnip. Meanwhile, the uptake of cells to glucose in the surrounding medium was reduced by Txnip overexpression and raised by Txnip silencing. As a physiologic regulator of peripheral glucose uptake, Txnip overexpression repressed cellular glucose uptake, while Txnip silencing increased glucose uptake in adipocytes and skeletal muscle (Parikh et al., 2007; Wu et al., 2013). Similarly, Txnip negatively regulated glucose uptake in cells, and excessive glucose entering the cell induced Txnip protein to limit glucose uptake (Waldhart et al., 2017). A glucose-sensing module (GSM), composed of a low-glucose inhibitory domain (LID) and a glucose-response activation conserved element (GRACE), in ChREBP structure mediated glucose responsiveness of ChREBP. The transactivation activity of GRACE was inhibited by LID under low glucose concentration, and this inhibition was reversed by high glucose in an orientation-sensitive manner (Li et al., 2006). Accordingly, downregulation of Glut4 expression resulted in a decreased glucose uptake in the adipocytes, which reduced the expression and transactivation activity of ChREBP, thus decreasing the expressions of its target genes related to adipogenesis, such as ACC1. These results showed that Txnip impaired the induction of glucose on the porcine preadipocyte differentiation through decreasing Glut4 expression and glucose uptake and subsequent decrease of the expression and transcriptional activity of ChREBP.

5. Conclusions

Our results suggested that Txnip could be an inhibitor of porcine preadipocyte differentiation, which attenuated adipogenesis of the cells through a negative feedback regulation on PPARγ. Glucose induced the Txnip expression by the mediation of ChREBP. However, Txnip hindered glucose uptake of the cells via decreased Glut4 expression, resulting in a decreased expression and activity of ChREBP, which impaired the porcine adipocyte adipogenesis induced by glucose. The present study provides a reference for investigating the adipogenesis regulated by glucose.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (31860633) and the Natural Science Foundation of Gansu Province (20JR5RA504).

References

• Aguiari, P.; Leo, S.; Zavan, B.; Vindigni, V.; Rimessi, A.; Bianchi, K.; Franzin, C.; Cortivo, R.; Rossato, M.; Vettor, R.; Abatangelo, G.; Pozzan, T.; Pinton, P. and Rizzuto, R. 2008. High glucose induces adipogenic differentiation of muscle-derived stem cells. Proceedings of the National Academy of Sciences of the United States of America 105:1226-1231. https://doi.org/10.1073/pnas.0711402105
  » https://doi.org/10.1073/pnas.0711402105
• Aprile, M.; Cataldi, S.; Ambrosio, M. R.; D'Esposito, V.; Lim, K.; Dietrich, A.; Bluher, M.; Savage, D. B.; Formisano, P.; Ciccodicola, A. and Costa, V. 2018. PPARγΔ5, a naturally occurring dominant-negative splice isoform, impairs PPARγ function and adipocyte differentiation. Cell Reports 25:1577-1592. https://doi.org/10.1016/j.celrep.2018.10.035
  » https://doi.org/10.1016/j.celrep.2018.10.035
• Burgess, S. C.; Iizuka, K.; Jeoung, N. H.; Harris, R. A.; Kashiwaya, Y.; Veech, R. L.; Kitazume, T. and Uyeda, K. 2008. Carbohydrate-response element-binding protein deletion alters substrate utilization producing an energy-deficient liver. Journal of Biological Chemistry 283:1670-1678. https://doi.org/10.1074/jbc.M706540200
  » https://doi.org/10.1074/jbc.M706540200
• Cha-Molstad, H.; Saxena, G.; Che, J. and Shalev, A. 2009. Glucose-stimulated expression of Txnip is mediated by carbohydrate response element-binding protein, p300, and histone H4 acetylation in pancreatic beta cells. Journal of Biological Chemistry 284:16898-16905. https://doi.org/10.1074/jbc.M109.010504
  » https://doi.org/10.1074/jbc.M109.010504
• Chutkow, W. A.; Birkenfeld, A. L.; Brown, J. D.; Lee, H. Y.; Frederick, D. W.; Yoshioka, J.; Patwari, P.; Kursawe, R.; Cushman, S. W.; Plutzky, J.; Shulman, G. I.; Samuel, V. T. and Lee, R. T. 2010. Deletion of the α-arrestin protein Txnip in mice promotes adiposity and adipogenesis while preserving insulin sensitivity. Diabetes 59:1424-1434. https://doi.org/10.2337/db09-1212
  » https://doi.org/10.2337/db09-1212
• Chutkow, W. A. and Lee, R. T. 2011. Thioredoxin regulates adipogenesis through thioredoxin-interacting protein (Txnip) protein stability. Journal of Biological Chemistry 286:29139-29145. https://doi.org/10.1074/jbc.M111.267666
  » https://doi.org/10.1074/jbc.M111.267666
• Dagdeviren, S.; Lee, R. and Wu, N. 2023. Physiological and pathophysiological roles of thioredoxin interacting protein: a perspective on redox, inflammation and metabolism. Antioxidants & Redox Signaling 38:442-460. https://doi.org/10.1089/ars.2022.0022
  » https://doi.org/10.1089/ars.2022.0022
• Ehebauer, F.; Ghavampour, S. and Kraus, D. 2020. Glucose availability regulates nicotinamide N-methyltransferase expression in adipocytes. Life Sciences 248:117474. https://doi.org/10.1016/j.lfs.2020.117474
  » https://doi.org/10.1016/j.lfs.2020.117474
• Gunes, A.; Iscan, E.; Topel, H.; Avci, S. T.; Gumustekin, M.; Erdal, E. and Atabey, N. 2015. Heparin treatment increases thioredoxin interacting protein expression in hepatocellular carcinoma cells. The International Journal of Biochemistry & Cell Biology 65:169-181. https://doi.org/10.1016/j.biocel.2015.05.025
  » https://doi.org/10.1016/j.biocel.2015.05.025
• Herman, M. A.; Peroni, O. D.; Villoria, J.; Schön, M. R.; Abumrad, N. A.; Blüher, M.; Klein, S. and Kahn, B. B. 2012. A novel ChREBP isoform in adipose tissue regulates systemic glucose metabolism. Nature 484:333-338. https://doi.org/10.1038/nature10986
  » https://doi.org/10.1038/nature10986
• Hsiao, P. F.; Huang, Y. T.; Lu, P. H.; Chiu, L. Y.; Weng, T. H.; Hung, C. F. and Wu, N. L. 2022. Thioredoxin-interacting protein regulates keratinocyte differentiation: Implication of its role in psoriasis. FASEB Journal 36:e22313. https://doi.org/10.1096/fj.202101772R
  » https://doi.org/10.1096/fj.202101772R
• Iizuka, K.; Tomita, R.; Takeda, J. and Horikawa, Y. 2012. Rat glucagon receptor mRNA is directly regulated by glucose through transactivation of the carbohydrate response element binding protein. Biochemical and Biophysical Research Communications 417:1107-1112. https://doi.org/10.1016/j.bbrc.2011.12.042
  » https://doi.org/10.1016/j.bbrc.2011.12.042
• Jeong, Y. S.; Kim, D.; Lee,Y. S.; Kim, H. J.; Han, J. Y.; Im, S. S.; Chong, H. K.; Kwon, J. K.; Cho,Y. H.; Kim, W. K.; Osborne, T. F.; Horton, J. D.; Jun, H. S.; Ahn, Y. H.; Ahn, S. M. and Cha, J. Y. 2011. Integrated expression profiling and genome-wide analysis of ChREBP targets reveals the dual role for ChREBP in glucose-regulated gene expression. PLoS One 6:e22544. https://doi.org/10.1371/journal.pone.0022544
  » https://doi.org/10.1371/journal.pone.0022544
• Ji, S.; Doumit, M. E. and Hill, R. A. 2015. Regulation of adipogenesis and key adipogenic gene expression by 1, 25-dihydroxyvitamin D in 3T3-L1 cells. PLoS One 10:e0126142. https://doi.org/10.1371/journal.pone.0126142
  » https://doi.org/10.1371/journal.pone.0126142
• Jung, Y. H. and Bu, S. Y. 2020. Suppression of long chain acyl-CoA synthetase blocks intracellular fatty acid flux and glucose uptake in skeletal myotubes. Biochimica et Biophysica Acta – Molecular and Cell Biology of Lipids 1865:158678. https://doi.org/10.1016/j.bbalip.2020.158678
  » https://doi.org/10.1016/j.bbalip.2020.158678
• Kwon, E. B.; Kang, M. J.; Ryu, H. W.; Lee, S.; Lee, J. W.; Lee, M. K.; Lee, H. S.; Lee, S. U.; Oh, S. R. and Kim, M. O. 2020. Acacetin enhances glucose uptake through insulin-independent GLUT4 translocation in L6 myotubes. Phytomedicine 68:153178. https://doi.org/10.1016/j.phymed.2020.153178
  » https://doi.org/10.1016/j.phymed.2020.153178
• Kim, D. O.; Byun, J. E.; Seong, H. A.; Yoon, S. R.; Choi, I. and Jung, H. 2018. Thioredoxin-interacting protein-derived peptide (TN13) inhibits LPS-induced inflammation by inhibiting p38 MAPK signaling. Biochemical and Biophysical Research Communications 507:489-495. https://doi.org/10.1016/j.bbrc.2018.11.069
  » https://doi.org/10.1016/j.bbrc.2018.11.069
• Kim, S. Y.; Suh, H. W.; Chung J. W.; Yoon, S. R. and Choi, I. 2007. Diverse functions of VDUP1 in cell proliferation, differentiation, and diseases. Cellular & Molecular Immunology 4:345-351.
• Lee, J. E.; Schmidt, H.; Lai, B. and Ge, K. 2019. Transcriptional and epigenetic regulation of adipogenesis. Molecular and Cellular Biology 39:e00601-e00618. https://doi.org/10.1128/MCB.00601-18
  » https://doi.org/10.1128/MCB.00601-18
• Li, M. V.; Chang, B.; Imamura, M.; Poungvarin, N. and Chan, L. 2006. Glucose-dependent transcriptional regulation by an evolutionarily conserved glucose-sensing module. Diabetes 55:1179-1189. https://doi.org/10.2337/db05-0822
  » https://doi.org/10.2337/db05-0822
• McFerrin, L. G. and Atchley, W. R. 2012. A novel N-terminal domain may dictate the glucose response of Mondo proteins. PLoS One 7:e34803. https://doi.org/10.1371/journal.pone.0034803
  » https://doi.org/10.1371/journal.pone.0034803
• Morrison, J. A.; Pike, L. A.; Sams, S. B.; Sharma, V.; Zhou, Q.; Severson, J. J.; Tan, A. C.; Wood, W. M. and Haugen, B. R. 2014. Thioredoxin interacting protein (TXNIP) is a novel tumor suppressor in thyroid cancer. Molecular Cancer 13:62. https://doi.org/10.1186/1476-4598-13-62
  » https://doi.org/10.1186/1476-4598-13-62
• Mueller, E. 2014. Understanding the variegation of fat: novel regulators of adipocyte differentiation and fat tissue biology. Biochimica et Biophysica Acta – Molecular Baisis of Disease 1842:352-357. https://doi.org/10.1016/j.bbadis.2013.05.031
  » https://doi.org/10.1016/j.bbadis.2013.05.031
• Park, J. W.; Lee, S. H.; Woo, G. H.; Kwon, H. J. and Kim, D. Y. 2018. Downregulation of TXNIP leads to high proliferative activity and estrogen-dependent cell growth in breast cancer. Biochemical and Biophysical Research Communications 498:566-572. https://doi.org/10.1016/j.bbrc.2018.03.020
  » https://doi.org/10.1016/j.bbrc.2018.03.020
• Parikh, H.; Carlsson, E.; Chutkow, W. A.; Johansson, L. E.; Storgaard, H.; Poulsen, P.; Saxena, R.; Ladd, C.; Schulze, P. C.; Mazzini, M. J.; Jensen, C. B.; Krook, A.; Bjornholm, M.; Tornqvist, H.; Zierath, J. R.; Ridderstrale, M.; Altshuler, D.; Lee R. T.; Vaag, A.; Groop, L. C. and Mootha, V. K. 2007. TXNIP regulates peripheral glucose metabolism in humans. PLoS Medicine 4:e158. https://doi.org/10.1371/journal.pmed.0040158
  » https://doi.org/10.1371/journal.pmed.0040158
• Peshdary, V.; Gagnon, A.; Landry, A.; Ma, L. and Sorisky, A. 2019. Elevated carbohydrate response element-binding protein beta (ChREBPβ) and thioredoxin interacting protein (TXNIP) levels in human adipocytes differentiated in high glucose concentrations. Canadian Journal of Diabetes 43:215-220. https://doi.org/10.1016/j.jcjd.2018.09.009
  » https://doi.org/10.1016/j.jcjd.2018.09.009
• Poulsen, L.; Siersbæk, M. and Mandrup, S. 2012. PPARs: fatty acid sensors controlling metabolism. Seminars in Cell & Developmental Biology 23:631-639. https://doi.org/10.1016/j.semcdb.2012.01.003
  » https://doi.org/10.1016/j.semcdb.2012.01.003
• Qi, W.; Chen, X.; Holian, J.; Tan, C. Y. R.; Kelly, D. J. and Pollock, C. A. 2009. Transcription factors Krüppel-like factor 6 and peroxisome proliferator-activated receptor-γ mediate high glucose-induced thioredoxin-interacting protein. The American Journal of Pathology 175:1858-1867. https://doi.org/10.2353/ajpath.2009.090263
  » https://doi.org/10.2353/ajpath.2009.090263
• Ramírez-Zacarías, J. L.; Castro-Muñozledo, F. and Kuri-Harcuch, W. 1992. Quantitation of adipose conversion and triglycerides by staining intracytoplasmic lipids with oil red O. Histochemistry 97:493-497. https://doi.org/10.1007/BF00316069
  » https://doi.org/10.1007/BF00316069
• Robinson, K. A.; Brock, J. W. and Buse, M. G. 2013. Posttranslational regulation of thioredoxin-interacting protein. Journal of Molecular Endocrinology 50:59-71. https://doi.org/10.1530/JME-12-0091
  » https://doi.org/10.1530/JME-12-0091
• Stachecka, J.; Nowacka-Woszuk, J.; Kolodziejski, P. A. and Szczerbal, I. 2019. The importance of the nuclear positioning of the PPARG gene for its expression during porcine in vitro adipogenesis. Chromosome Research 27:271-284. https://doi.org/10.1007/s10577-019-09604-2
  » https://doi.org/10.1007/s10577-019-09604-2
• Schuster, S.; Johnson, C. D.; Hennebelle, M.; Holtmann, T.; Taha, A. Y.; Kirpich, I. A.; Eguchi, A.; Ramsden, C. E.; Papouchado, B. G.; McClain, C. J. and Feldstein, A. E. 2018. Oxidized linoleic acid metabolites induce liver mitochondrial dysfunction, apoptosis, and NLRP3 activation in mice. Journal of Lipid Research 59:1597-1609. https://doi.org/10.1194/jlr.M083741
  » https://doi.org/10.1194/jlr.M083741
• Uyeda, K. and Repa, J. J. 2006. Carbohydrate response element binding protein, ChREBP, a transcription factor coupling hepatic glucose utilization and lipid synthesis. Cell Metabolism 4:107-110. https://doi.org/10.1016/j.cmet.2006.06.008
  » https://doi.org/10.1016/j.cmet.2006.06.008
• Waldhart, A. N.; Dykstra, H.; Peck, A. S.; Boguslawski, E. A.; Madaj, Z. B.; Wen, J.; Veldkamp, K.; Hollowell, M.; Zheng, B.; Cantley, L. C.; McGraw, T. E. and Wu, N. 2017. Phosphorylation of TXNIP by AKT mediates acute influx of glucose in response to insulin. Cell Reports 19:2005-2013. https://doi.org/10.1016/j.celrep.2017.05.041
  » https://doi.org/10.1016/j.celrep.2017.05.041
• Wu, N.; Zheng, B.; Shaywitz, A.; Dagon, Y.; Tower, C.; Bellinger, G.; Shen, C. H.; Wen, J.; Asara, J.; McGraw, T. E.; Kahn, B. B. and Cantley, L. C. 2013. AMPK-dependent degradation of TXNIP upon energy stress leads to enhanced glucose uptake via GLUT1. Molecular Cell 49:1167-1175. https://doi.org/10.1016/j.molcel.2013.01.035
  » https://doi.org/10.1016/j.molcel.2013.01.035
• Witte, N.; Muenzner, M.; Rietscher, J.; Knauer, M.; Heidenreich, S.; Nuotio-Antar, A. M.; Graef, F. A.; Fedders, R.; Tolkachov, A.; Goehring, I. and Schupp, M. 2015. The glucose sensor ChREBP links de novo lipogenesis to PPARγ activity and adipocyte differentiation. Endocrinology 156:4008-4019. https://doi.org/10.1210/EN.2015-1209
  » https://doi.org/10.1210/EN.2015-1209
• Yoshihara, E.; Masaki, S.; Matsuo, Y.; Chen, Z.; Tian, H. and Yodoi, J. 2014. Thioredoxin/Txnip: redoxisome, as a redox switch for the pathogenesis of diseases. Frontiers in Immunology 4:514. https://doi.org/10.3389/fimmu.2013.00514
  » https://doi.org/10.3389/fimmu.2013.00514
• Yu, F. X. and Luo, Y. 2009. Tandem ChoRE and CCAAT motifs and associated factors regulate Txnip expression in response to glucose or adenosine-containing molecules. PLoS One 4:e8397. https://doi.org/10.1371/journal.pone.0008397
  » https://doi.org/10.1371/journal.pone.0008397
• Zhang, G. H.; Lu, J. X.; Chen, Y.; Guo, P. H.; Qiao, Z. L.; Feng, R. F.; Chen, S. E.; Bai, J. L.; Huo, S. D. and Ma, Z. R. 2015. ChREBP and LXRα mediate synergistically lipogenesis induced by glucose in porcine adipocytes. Gene 565:30-38. https://doi.org/10.1016/j.gene.2015.03.057
  » https://doi.org/10.1016/j.gene.2015.03.057

Publication Dates

• Publication in this collection
  24 Nov 2023
• Date of issue
  2023

History

• Received
  28 Feb 2022
• Accepted
  28 Oct 2022