SciELO - Scientific Electronic Library Online

 
vol.17 issue4Turkey Wattle Temperature Response to Distinct Environmental FactorsMolecular Diagnosis of Beak and Feather Disease in Native Brazilian Psittacines author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Brazilian Journal of Poultry Science

Print version ISSN 1516-635XOn-line version ISSN 1806-9061

Rev. Bras. Cienc. Avic. vol.17 no.4 Campinas Oct./Dec. 2015

http://dx.doi.org/10.1590/1516-635X1704445-450 

Articles

Prevalence of Shiga Toxin-Producing and Enteropathogenic Escherichia coli in Wild and Pet Birds in Iran

A KoochakzadehI 

M Askari BadoueiII 

T Zahraei SalehiI 

S AghasharifIII 

M SoltaniIV 

MR EhsanIV 

IDepartment of Microbiology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran

IIDepartment of Pathobiology, Faculty of Veterinary Medicine, Garmsar Branch, Islamic Azad University, Garmsar, Iran

3III Faculty of Veterinary Medicine, Garmsar Branch, Islamic Azad University, Garmsar, Iran

4IV Department of Poultry Diseases, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran


ABSTRACT

The aim of this study was to investigate the prevalence of Shiga toxin-producing Escherichia coli (STEC) and enteropathogenic E. coli (EPEC) strains and to identify the stx gene types in wild captive and companion birds. In total,657 E. coli isolates from 219 birds belonging to 38 different species were investigated for the presence of STEC and EPEC strains. It was shown that five birds (2.28%) carried strains positive for one or more of the virulence factors investigated. The results indicated that 1.8% (n=4) and 0.45% (n=1) of the birds carried STEC and EPEC strains, respectively. All STEC strains harbored the stx2f and eae genes and this finding reveals the role of other birds, in addition to pigeons, as reservoirs of STEC. The only EPEC strain in this study was isolated from a Myna. Based on our knowledge, this is the first report of Stx2f-producing STEC in Geese, Duck and Lesser kestrel. In conclusion, the results indicate a low frequency of STEC carriage in wild and companion birds, and point out the need of additionally screening for the presence of stx2f in all the eae-harboring strains from birds.

Keywords: EPEC; STEC; stx2f; pet birds; wild birds

INTRODUCTION

Escherichia coli belongs to the intestinal bacterial flora in most animal species. Although most E. coli strains are nonpathogenic, some strains may cause diarrhea and other intestinal diseases (Law, 1988). For instance, enteropathogenic E. coli (EPEC) have been considered as one of the most important strains that cause diarrhea in humans (Norazah et al., 1998). EPEC strains may express the outer membrane protein intimin (94-97 KDa), which is encoded by the eae gene and causes the attaching and effacing lesions in the epithelial cells of the intestine and resulting diarrhea in humans (Adu-Bobie et al., 1998). Some studies have shown the carriage of EPEC strains in birds (Kobayashi et al., 2009; Oh et al., 2011).

Shiga toxin-producing Escherichia coli strains (STEC) harbor Shiga toxin (stx) genes (Kobayashi et al., 2002) and are also able to cause diarrhea in humans and some animal species. They are linked to hemorrhagic colitis (HC), hemolytic uremic syndrome (HUS) and thrombotic thrombocytopenic purpura (TTP) in humans, which require hospitalization and intensive care with considerable mortality in children and elderly patients (Gyles, 2007). The ability of STEC strains to cause serious diseases in humans is related to the production of one or more Shiga toxins (Stx1, Stx2, or their variants), which inhibit protein synthesis in host cells leading to cellular damage (O'Brien et al., 1992).

While ruminants are the main reservoir of STEC, other domestic animals such as cats, dogs and pigs may also carry STEC and EPEC strains (Beutin et al., 1995; Zahraei Salehi et al., 2011). Moreover, some studies have also investigated STEC strains in wild birds and poultry in different countries (Kobayashi et al., 2002; Schmidt et al., 2000; Morabito et al., 2001; Ghanbarpour et al., 2011). More recently, a new subtype of stx, called stx2f, has been described in STEC in pigeons (Schmidt et al., 2000). Strains harboring the stx2f gene have been considered as emerging pathogens (Prager et al., 2009). Various methods have been applied for identification of STEC strains in birds, but most of them were unable to target the stx2f subtype (Askari Badouei et al., 2014; Ziebell et al., 2002; Feng et al., 2011).

Due to the wide geographical distribution, migratory habits, and the great diversity of avian species, the role of different bird species in carriage of eae and stx possessing Escherichia coli is poorly understood. Nevertheless, most birds, including pet birds, domestic fowl, and even raptors kept by humans may be potential unnoticed reservoirs of these enteric pathogens. To our knowledge, there are no studies on the prevalence and molecular characteristics of STEC and EPEC strains derived from pet and wild birds in Iran. Therefore, the aim of this study was to assess the role of birds as STEC and EPEC reservoirs in Iran.

MATERIALS AND METHODS

Sample collection and culture

A total number of 219 birds belonging to 38 different species were sampled in pet shops, zoological parks (Saei park) and birds referred to veterinary clinics (Table 1). The samples were collected from fresh droppings, or directly from the cloacae, using sterile swabs (Table 1). The samples were transported in Amies transport media (BBL, USA) to the laboratory and immediately streaked on MacConkey agar (Merck, Germany). After overnight incubation at 37oC, up to four well-separated lactose-fermenting colonies were picked from each plate. The confirmation of the suspected isolates was performed by biochemical tests, including conventional lactose and glucose fermentation (using TSI medium), urease, indol, methyl red, Voges Proskauer, citrate and lysine decarboxylase (Quinn et al., 2011).

Table 1   Fecal samples obtained from various birds in Iran assessed for the presence of Escherichia coli harboring eae and stx genes. 

Bird (Common Name) Bird (Scientific name) No. of samples tested No. of eae-positive isolates No. of stx-positive isolates
Sulphur-crested Cockatoo Cacatua galerita 2
Green-winged Macaw Ara chloropterus 1
Lesser Kestrel Falco naumanni 7 1 1
Alexandrian Parrot Psittacula eupatria 1
Eurasian Eagle-Owl Bubo bubo 1
Fischer's Lovebird Agapornis fischeri 3
Chukar Partridge Alectoris chukar 5
African Grey Parrot (AGP) Psittacus erithacus 18
Pet Chicken Gallus gallusdomesticus 8
Common Buzzard Buteo buteo 1
Common Myna or Indian Myna Acridotheres tristis 34 1
White-eared Bulbul Pycnonotusleucotis 2
Domestic Canary Serinuscanariadomestica 2
Common Magpie Pica pica 2
Budgerigar Melopsittacus undulatus 3
Blue and Yellow (Gold) Macaw Ara ararauna 1
Eastern Rosella Platycercus eximius 1
Cockatiel Nymphicus hollandicus 1
Domestic Duck Anas platyrhynchos domesticus 30 1 1
Domestic Pigeon Columba liviadomestica 6
Hooded Crow Corvus cornix 8
Saker Falcon Falco cherrug 1
Steppe Eagle Aquila nipalensis 2
Eurasian Sparrowhawk Accipiter nisus 2
Eurasian Woodcock Scolopax rusticola 1
Caspian Gull Larus cachinnanas 1
Orange-winged Amazon Amazona amazonica 1
Scaly-breasted Lorikeet Trichoglossus chlor lepidotus 1
Helmeted Guinea Fowl Numida meleagris 2
Muscovy Duck Cairina moschata 5
Common Pheasant Phasianus colchicus 7
Black Swan Cygnus atratus 2
Blue Peafowl Pavo cristatus 4
Japanese Quail Coturnix japonica 1
Ring-necked Parakeet Psittacula krameri 31
Domestic goose Anser anser domesticus 21 2 2
Total 219 5 4

DNA extraction

Isolates confirmed as E. coli were sub-cultured on LB Agar. After an 18-20 hours incubation at 37oC, DNA was extracted of the strains by boiling method, as described previously (Zahraei Salehi et al., 2007).

Screening PCRs for eae and stx

The presence of the eae gene was screened using SK1 and SK2 general primers (Table 2; Schmidt et al., 1994). The PCR protocol was conducted using 2.5 µL10X PCR buffer, 2mM MgCl2, 0.2mM dNTP, 1 unit Taq DNA polymerase enzyme (Cinnagen, Iran),0.4 µM of each primer working stock and 2 µL boiled lysate as template DNA. Molecular grade distilled water was added to make the final volume of 25µL.

Table 2   PCR primers and conditions for the amplification of stx and eae genes in this study. 

Name Primer Sequence(5'to 3') Target Gene Amplification condition Amplicon Size (bp) reference
SK1 SK2 CCCGAATTCGGCACAAGCATAAGC CCCGGATCCGTCTCGCCAGTATTCG eae 94°C 30s;52°C 60s; 72°C 60s (30 cycles) 863 Schmidt et al. (1994)
Lin-F Lin-R GAACGAAATAATTTATATGT TTTGATTGTTACAGTCAT stx 94°C 30s;45°C 60s; 72°C 60s (33 cycles) 900 Lin et al. (1993)
Stx1-F Stx1-R ATAAATCGCCATTCGTTGACTAC AGAACGCCCACTGAGATCATC stx1 95°C 60s;65°C 120s; 72°C 60s (first 10 cycles) decreasing to 60°C (cycles 10-15) 95°C 60s;60°C 120s; 72°C 90s (cycles15-25) 95 °C 60s;60°C 120s; 72°C 150s (cycles25-35) 180 Paton & Paton (1998)
Stx2-F Stx2-R GGCACTGTCTGAAACTGCTCC TCGCCAGTTATCTGACATTCTG stx2 255
Eae-F Eae-R GACCCGGCACAAGCATAAGC CCACCTGCAGCAACAAGAGG eae 384
Hly-F Hly-R GCATCATCAAGCGTACGTTCC AATGAGCCAAGCTGGTTAAGCT Ehly 534
Stx2f-F Stx2f-R AGATTGGGCGTCATTCACTGGTTG TACTTTAATGGCCGCCCTGTCTCC stx2f 94°C 30s;57°C 60s; 72°C 60s (30 cycles) 428 Schmidt et al. (2000)

In order to detect STEC strains, Lin-F and Lin-R primers (Table 2) that can detect all stx subtypes and variants, were used (Ziebell et al., 2002; Lin et al., 1993). Each PCR reaction included: 2.5 µL10X PCR buffer; 1.6 mM MgCl2; 0.2mM dNTP; 1 unit Taq DNA polymerase enzyme; 0.4 µM of each primer; 3 µL DNA; and ultrapure water up to 25 µL (Table 2).

Amplification cycles for both protocols are summarized in Table 2. Positive control (E. coli O157:H7 Isolate No. 295) and negative control (sterile water) were included in all PCR reactions. To observe results, the PCR products were visualized on 1.2% agarose gel after electrophoresis and staining with ethidium bromide.

Multiplex-PCR for stx1, stx2, eae, Ehly

All stx harboring E. coli isolates were further screened by a multiplex-PCR using four pairs of specific primers (Table 2) for stx1, stx2, eae and Ehly as described by Paton and Paton (1998). Amplification was carried out in a total volume of 25μL containing: 2μL DNA; 0.3μM of each oligonucleotide primer; 0.2mM dNTP mix; 2mM MgCl2; 2.5μL of 10X PCR buffer; 1 unit Taq DNA polymerase (Cinnagen, Iran); and PCR grade water up to 25μL. Samples were subjected to 35 cycles of touchdown PCR (Table 2) according to Paton and Paton (1998). The PCR products were submitted to electrophoresis on 2% agarose gels and visualized by staining with ethidium bromide. Positive PCR reactions were recorded by comparing the specific bands with 100bp-plus molecular size marker (Fermentas, Lithuania). Positive controls and negative controls (sterile water) were included in all PCR reactions.

stx2f gene detection

In order to detect stx2f gene in stx positive strains that yielded negative result in Multiplex-PCR, another PCR was conducted with stx2fF and stx2fR primers (Table 2) as described previously (Schmidt et al., 2000). Each PCR reaction included: 2.5 μL 10X PCR buffer; 1.5mM MgCl2; 0.2mM dNTP; 1 unit Taq DNA polymerase; 3 μL DNA; 0.1 µM of each primers; and molecular grade water. The applied thermal cycles are summarized in Table 2. T5b-Ir strain (Accession number KJ397538) was used as positive control.

RESULTS

Among the 657 E. coli isolates investigated for the presence of the eae gene, five isolates, which were originated from five different birds belonging to four different species, resulted positive (Figure 1; Table 1). In screening PCRs for stx, four birds belonging to three different species carried STEC strains. The evaluation of the STEC isolates using a multiplex PCR for stx1, stx2, eae, Ehly only yielded the eae amplicon, but not stx1 and/or stx2. All of these strains were shown to be positive for stx2f as demonstrated using the specific primers (Figure 1). In fact, except for one isolate, all eae-harboring isolates were STEC and carried stx2f gene. In total, five birds (2.28%) carried strains positive for one or more of the virulence factors tested. Four E. coli strains were isolated from four birds belonging to three different species including (goose, duck and lesser kestrel) harbored both stx2f and eae genes, while one isolate obtained from a Myna harbored only the eae (Figure 1; Table 1).

Figure1 Different PCR assays for the detection of eae, stx and stx2f genes. M) Marker 100bp. A) Negative control. B) Positive control for stx gene (900bp) (E. coli O157:H7, Isolate No. 295).C) One of stx positive strains isolated in this study. D) Positive control for eaegene (863bp) (E. coli O157:H7, Isolate No. 295). E) One of the eae positive strains isolated in this study. F) Positive control for stx2f gene (428bp) (T5b-Ir strain, accession number KJ397538).G) One of stx2f-positive strains isolated in this study. 

DISCUSSION

The result of the current study showed a low prevalence of STEC in wild and pet birds in Iran. The prevalence of STEC has been investigated in different bird species in other geographical regions. Farooq et al. (2009) found 5% and 1% of E. coli strains positive for stx1 and stx2 in pigeons, respectively. In broilers, the stx2 gene was detected in 4.5% of the isolates in Iran (Ghanbarpour et al., 2011). On the other hand, some studies found no Shiga toxin genes in E.coli strains from poultry (Wani et al., 2004; Farooq et al., 2009). Similarly, stx1 or stx2 genes were not detected in E. coli from wild birds (Kobayashi et al., 2009), which is in agreement with the findings of the present study. As reported previously (Zeibell et al., 2002), the multiplex-PCR was not able to identify stx2f subtype in the mentioned study.

In our study, the combination of stx2f and eae genes were detected in E. coli strains isolated from four birds (1.8%) belonging to three different species. In general, pigeons are known as natural reservoirs of stx2f-harboring STEC strains (Kobayashi et al., 2002; Schmidt et al., 2000; Kobayashi et al., 2009; Askari Badouei et al., 2014). The prevalence of stx2f+ strains reported in pigeons ranged from 4% to18.8% in different studies (Askari Badouei et al.,2014; Schmidt et al., 2000; Farooq et al.,2009). Additionally, Wen-Jie et al. (2008) study showed the presence of stx2f gene in avian pathogenic E. coli (APEC) strains in China. Similar to our observation, previous studies showed that stx2f-harboring strains lack other stx subtypes and mostly possess the eae gene (Askari Badouei et al., 2014; Schmidt et al., 2000; Morabito et al., 2001). The strains possessing the stx2f/eae genes in this study isolated from a duck, two geese and a lesser kestrel. Previously, eae+/stx2f+ E. coli strains were detected in barn swallows in Japan (Kobayashi et al., 2009).However, the low prevalence of stx2f-harboring STEC in the current and previous studies suggests that these strains are only part of the transient gut microflora. In this sense, wild and pet birds may have a minor epidemiologic role in comparison with Columbiformes as carriers of stx2f+/eae+ E. coli.

In the present study, only one EPEC strain was identified. Farooq et al. (2009) concluded that all of the ducks and chickens sampled in their study were reservoirs of EPEC strains, while in another study only 8.7% of the birds harbored EPEC strains (Kobayashi et al., 2009).

According to the results of the present study, wild and pet birds may carry STEC and EPEC strains. Although all STEC strains in this study only possessed the stx2f subtype, the public health significance of these strains should not be overlooked, because the stx2f+ E. coli strains have also been isolated from humans with diarrhea (Prager et al., 2009; Isobe et al., 2004). Recent evidences also show the particular importance of stx2f-STEC as an emerging unnoticed human pathogen (Friesema et al., 2014). Since the stx2f is not easily identified using most routine diagnostic procedures (except using appropriate general primers), all of the eae-harboring strains from birds should be checked for the presence of this particular Shiga toxin subtype. Additionally, the role of pet birds in epidemiology of STEC infection should not be underestimated.

REFERENCES

Adu-Bobie J, Frankel G, Bain C, Goncalves AG, Trabulsi LR, Douce G, Knutton S, Dougan G. Detection of intimins alpha, beta, gamma, and delta, four intimin derivatives expressed by attaching and effacing microbial pathogens. Journal of Clinical Microbiology 1998;36:662-668. [ Links ]

Askari Badouei M, Zahraei Salehi T, Koochakzadeh A, Kalantari A, Tabatabaei S. Molecular characterization, genetic diversity, and antibacterial susceptibility of Escherichia coli encoding Shiga toxin 2f in domestic pigeons. Letters in Applied Microbiology 2014;59(4):370-6. doi:10.1111/lam.12288. [ Links ]

Beutin L, Geier D, Zimmermann S, Karch H. Virulence markers of Shiga-like toxin-producing Escherichia coli strains originating from healthy domestic animals of different species. Journal of Clinical Microbiology 1995;33:631-635. [ Links ]

Farooq S, Hussain I, Mir MA, Bhat MA, Wani SA. Isolation of atypical enteropathogenic Escherichia coli and Shiga toxin 1 and 2f-producing Escherichia coli from avian species in India. Letters in Applied Microbiology2009;48:692-697. [ Links ]

Feng PCH, Jinneman K, Scheutz F, Monday S. Specificity of PCR and serological assays in the detection of Escherichia coli Shiga toxin subtypes. Applied and Environmental Microbiology 2011; 77:6699-6702. [ Links ]

Friesema I, van der Zwaluw K, Schuurman T, Kooistra-Smid M, Franz E, van Duynhoven Y, van Pelt W. Emergence of Escherichia coli encoding Shiga toxin 2f in human Shiga toxin-producing E. coli (STEC) infections in the Netherlands, January 2008 to December 2011. Eurosurveillance 2014;19: 20787. Available from: http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=20787. [ Links ]

Ghanbarpour R, Sami M, Salehi M, Ouromiei M. Phylogenetic background and virulence genes of Escherichia coli isolates from colisepticemic and healthy broiler chickens in Iran. Tropical Animal Health and Production 2011;43:153-157. [ Links ]

Grossmann K, Weniger B, Baljer G, Brening B, Wieler LH. Racing, ornamental and city pigeons carry Shiga toxin-producing Escherichia coli (STEC) with different Shiga toxin subtypes, urging further analysis of their epidemiological role in the spread of STEC. Berliner und Münchener Tierärztliche Wochenschrift 2005;118:456-463. [ Links ]

Gyles CL. Shiga toxin-producing Escherichia coli: an overview. Journal of Animal Science 2007;85: 45-62. [ Links ]

Isobe J, Kimata K, Shimojima M, Hosorogi S, Tanaka D, Gyobu Y. Isolation of Escherichia coli O128:HNM harboring stx2f gene from diarrhea patients. Kansenshogaku Zasshi 2004;78:1000-1005. [ Links ]

Kobayashi H, Kanazaki M, Hata E, Kubo M. Prevalence and characteristics of - and -positive strains of Escherichia coli from wild birds in the immediate environment of Tokyo Bay. Applied and Environmental Microbiology2009;75:292-295. [ Links ]

Kobayashi H, Pohojanvirta T, Pelkonen S. Prevalence and characteristics of intimin- and Shiga toxin-producing Escherichia coli from gulls, pigeons and broilers in Finland. Journal of Veterinary Medical Science 2002;64:1071-1073. [ Links ]

Law D. Virulence factors of enteropathogenic Escherichiacoli. Journal of Medical Microbiology1988; 26:1-10. [ Links ]

Lin Z, Kurazono H, Yamasaki S. Takeda Y. Detection of various variant verotoxin genes in Escherichia coli by polymerase chain reaction. Microbiology and Immunology 1993;37:543-548. [ Links ]

Morabito S, Dell'Omo G, Agrimi U, Schmidt H, Karch H, Cheasty T, Caprioli A. Detection and characterization of Shiga toxin-producing Escherichia coli in feral pigeons. Veterinary Microbiology 2001;82:275-283. [ Links ]

Norazah A, Rahizan I, Zainuldin T, Rohani MY, Kamel AG. Enteropathogenic Escherichia coli in raw and cooked food. Southeast Asian Journal of Tropical Medicine and Public Health 1998;29:91-93. [ Links ]

O'Brien AD, Tesh VL, Rolfe AD. Shiga toxin: biochemistry, genetics, mode of action, and role in pathogenesis. Current Topics in Microbiology and Immunology1992;180: 65-94. [ Links ]

Oh JY, Kang MS, Hwang HT, An BK, Kwon JH, Kwon YK. Epidemiological investigation of eaeA-Positive Escherichia coli and Escherichia albertii strains isolated from healthy wild birds. Journal of Microbiology 2011;49:747-752. [ Links ]

Paton AW, Paton JC. Detection and characterization of shiga toxigenic Escherichia coli by using Multiplex PCR assays for stx1, stx2, eaeA, EnterohemorrhagicE. coli hlyA, rfb O111 and rfbO157. Journal of Clinical Microbiology1998;36:598-602. [ Links ]

Prager R, Fruth A, Siewert U, Strutz U, Tschape H. Escherichia coli encoding Shiga toxin 2f as an emerging human pathogen. International Journal of Medical Microbiology2009;229:343-353. [ Links ]

Quinn PJ, Markey BK, Leonard FC, Fitzpatrick ES, Fanning S, Hartigan PJ. Veterinary microbiology and microbial disease. 2nd ed. London: Mosby-Year book Europe; 2011. [ Links ]

Schmidt H, Plaschke B, Franke S, Russmann H, Schwarzkopf A, Heesemann J, Karch H. Differentiation in virulence patterns of Escherichia coli possessing eae genes. Medical Microbiology and Immunology1994;183:23-31. [ Links ]

Schmidt H, Scheef J, Morabito S, Caprioli A, Wieler LH, Karch H. A new Shiga toxin 2 variant (Stx2f) from Escherichia coli isolated from pigeons. Applied and Environmental Microbiology2000;66:1205-1208. [ Links ]

Wani SA, Samanta I, Bhat MA, Nishikawa Y. Investigation of Shiga toxin-producing Escherichia coli in avian species in India. Letters in Applied Microbiology2004;39:389-394. [ Links ]

Wen-Jie J, Zhi-Ming Z, Yong-Zhi Z, Ai-Jian Q, Hong-Xia S, Yue-Long L, Jiao W, Qian-Qian W. Distribution of Virulence-Associated Genes of Avian Pathogenic Escherichiacoli Isolates in China. Agricultural Sciences in China 2008;7:1511-1515. [ Links ]

Zahraei Salehi T, Askari Badouei M, Mehdizadeh Gohari I. Molecular detection and antibacterial susceptibility of enteropathogenic Escherichia coli (EPEC) and shigatoxigenic Escherichia coli (STEC) strains isolated from healthy and diarrhoeic dogs. Comparative Clinical Pathology 2011;20:585-589. [ Links ]

Zahraei Salehi T, Safarchi A, Peighambari SM, Mahzounieh M, Rabbani Khorasgani M. Detection of stx1, stx2, eae, espB and hly genes in avian pathogenic Escherichia coli by multiplex polymerase chain reaction. Journal of Veterinary Research 2007;62:37-42. [ Links ]

Ziebell KA, Read SC, Johnson RP, Gyles CL. Evaluation of PCR and PCR-RFLP protocols for identifying Shiga toxins. Research in Microbiology 2002;153:289-300. [ Links ]

Received: August 2014; Accepted: March 2015

Mail Address Corresponding author e-mail address Mahdi Askari Badouei Department of Pathobiology , Faculty of Veterinary Medicine, Garmsar Branch, Islamic Azad University, Garmsar, Iran. Postal Code: 3581631167 Tel.: +98-2324252121 Fax: +98-2324252020 Email:mic.consult@gmail.com askari@iau-garmsar.ac.ir

Creative Commons License This is an open-access article distributed under the terms of the Creative Commons Attribution License