Effect of Ultra-fine Traditional Chinese Medicine Compounds on Regulation of Lipid Metabolism and Reduction in Egg Cholesterol of Laying Hens

ABSTRACT

This study has the objective of investigating the effects of traditional Chinese medicine prescriptions (TCM) on serum lipid, abdominal and hepatic fat percentage, cholesterol content in eggs, and mRNA expression of genes apoA I and apoB₁₀₀. One hundred and thirty five healthy (300-day-old) layers were randomly assigned to three treatments. The hens in control group were fed with the basal diet. The hens in the experimental groups (TCM 1 and TCM 2) were fed with the basal diet supplemented with 1% TCM 1 and 1% TCM 2 respectively over a period of 60 days. Laying performance and the serum parameters relevant to fat metabolism were measured. The results showed that no significant differences were found in average daily feed intake and egg weight among three treatments. Average daily laying rate in TCM treatments was increased, and the cholesterol content in eggs was decreased. The serum triglyceride (TG), total cholesterol (TC) and low-density lipoprotein cholesterol (LDL-C) levels in experimental treatments were decreased (p<0.05), while the serum high-density lipoprotein cholesterol (HDL-C) level was increased (p<0.05) compared to the control group. Additionally, abdominal fat percentage decreased in TCM 1 treatment (p<0.05), and hepatic fat percentage decreased in both TCM treatments (p<0.05). The expression of apolipoproteinA I (apoA I) and apolipoproteinB₁₀₀ (apoB₁₀₀) mRNA in the liver increased in both TCM treatments (p<0.05). These results suggest that the diet supplemented with TCM could increase the expression of apoA I and apoB₁₀₀ mRNA in the liver, and decrease lipid content in the serum, and reduce egg cholesterol in layers.

Keywords:
Laying hens; Cholesterol; Traditional Chinese medicine; Lipid metabolism; Apolipoprotein.

INTRODUCTION

Lipid is one of the necessary nutrients for both human beings and animals. It is not only an energy source, but also the provider of essential fatty acids. The excessive accumulation of fats in the liver is believed to be the cause of fatty liver hemorrhagic syndrome (FLHS) in laying hens, resulting in laying rate decreased sharply, even an increase in mortality, which brings economic loss and threaten the animal welfare (Gharaghani et al., 2015; Trott et al., 2014; Teck et al., 2011). Besides, cholesterol content in eggs is considered as a significant factor to limit their consumption although its nutritional value is very high (Patrícia et al., 2013; Spence et al., 2012). The evidences above suggested that the reduction of serum lipid level of layers and cholesterol content in eggs is critical for practical production cost and animal welfare. In addition, apolipoproteinA I (apoA I) and apolipoproteinB100 (apoB_100, the main form in poultry) were reported to be associated with lipid metabolism. ApoA I and apoB₁₀₀ are the major apolipoprotein synthesized in the liver (Kristina et al., 1990). ApoA I, one important protein of high density lipoproteins (HDL), participates in the lipid translocation from peripheral tissues to the liver for catabolism (Mooradian et al., 2014; Sontag et al., 012). ApoB₁₀₀ plays a major role in low density lipoproteins (LDL) formation, which is regarded as a ligand for the LDL receptor-mediated uptake by different tissues (Srivastava et al., 2000). Previous studies showed that apoA I and apoB₁₀₀ play important roles in physiological functions on lipid metabolism (Dixon et al., 1993; Srivastava et al., 2000).

In recent years, along with the development of green healthy breeding, Chinese herbal medicines have subsequently been receiving more and more attention as feed additive (Liang et al., 2013; Nie et al., 2015). However, the effects of conventional Chinese herbal medicine, especially coarse powder, were reduced by its low content of active ingredient and low bioavailability. The technology of ultrafine pulverization was applied to enhance the dissolution rate of effective components in trials (Cho et al., 2007). According to the prescription-composing principles that Chinese herbal medicine compounds have an almost infinite ability to synthesize compounds that have diverse bioactive properties (Song et al., 2014).

In this study, the experimental diets supplemented with two TCM compounds were applied on layers and the effects of TCM on the regulation of lipid metabolism and cholesterol content in eggs were evaluated, in addition, it is also an attempt to explore a useful feed additive to help cover the economic loss and improve animal welfare.

MATERIALS AND METHODS

Experimental Animals

All the procedures performed on the animals were approved by the Institutional Animal Care and Use Committee for medical science of Jiangxi Agricultural University, Jiangxi, China.

Experimental Design

One hundred and thirty five Hyline layers, aged 300 days, were caged in individual slant-back cages and allowed 7 days of accommodation on the basal diet. The basal diet was formulated to meet all nutrient requirements for laying hens (NRC, 1998) (Table 1). The layers were randomly assigned to three treatment groups. Each group consisted of 45 layers (3 or 4 layers in a cage). The control group was fed with a basal diet. Meanwhile, the layers in experimental group 1 and 2 were fed with a basal diet supplemented with 1% TCM 1 and 1% TCM 2 respectively. The experiment lasted 60 days. The diets and water were provided ad libitum throughout this experiment. Light cycle was kept 16 h per day.

Table 1
Ingredient and nutrient levels of basal diet (air dry basis).

Ingredients	Content(%)	Nutrient levels	Content
Corn Soybean meal	64.20 21.00	ME/(MJ/kg) 2) CP(%)	11.30 17.20
Limestone	8.10	Ca(%)	3.43
CaHPO4	1.20	TP(%)	0.63
Soybean oil	4.00	AP(%)	0.45
Salt	0.31	Lys (%)	0.92
Premix1)	1.00	Met (%)	0.38
Lys	0.12
DL-Met	0.07
Total	100

• ¹
  ⁾ The premix provides following per kg diet: VA 8 100 IU; VD₃ 1 620 IU; VE 0.30 IU; VK₃ 0.90 mg; VB₁ 0.45 mg; VB₂ 2.70 mg; VB₁₂ 0.06 g; Nicotinic acid 5.70 mg; Folic acid 0.15 mg; Biotin 0.045 mg; Fe 31.30 mg; Cu 4.59mg; Mn 41.21 mg; Zn 42.04 mg; I 0.61 mg; Se 0.15 mg; choline 448.65 mg; Rice polishings 3489.53 mg.
• ²
  ⁾ ME is calculated value, Other nutrient levels are measured values.

Preparation of TCM

All raw materials for TCM were purchased from the Chinese medicine market of Zhangshu (Jiangxi, China). TCM 1 was composed of 6 types of dried Chinese herbs and TCM 2 was composed of 4 types of herbs (Table 2). All dried Chinese herbs were smashed through a 10 µm screen sieve, and then TCM 1 and TCM 2 were incorporated into the basal diet at the same dose of 10 g/kg, respectively.

Table 2
Composition and content of TCM1 and TCM2 (air dry basis)

Latin name	Used part	Content (g)
TCM1
Astragalus membranaceus	Dried rhizome	17.14
Codonopsis pilosula	Dried root	11.43
Angelica sinensis	Dried root	14.29
Crataegus pinnatifida	Dried fuit	28.57
Rhizome Atractylodis macrocephalae	Dried rhizome	11.43
Atractylodes lancea	Dried rhizome	17.14
TCM2
Flos carthami	Dried flower	10.00
Crataegus pinnatifida	Dried fruit	50.00
Poria	Dried sclerotium	20.00
Lotus leaf	Dried leaf	20.00

• TCM, traditional Chinese medicine prescriptions; TCM 1, traditional Chinese medicine prescriptions 1;
• TCM 2, traditional Chinese medicine prescriptions 2. ¹Used part of TCM 1 and TCM 2 come from
• Chinese pharmacopoeia (2005).

Sample Collection

Egg production, feed intake, and egg weights in each group were recorded daily. Forty-five eggs were randomly collected from each group to determine cholesterol content in the eggs in the end of the experiment. On day 1, 30, and 60, 15 hens were chosen randomly. Blood samples were taken from the brachial veins, centrifuged at 2,000g at 4°C for 10 min and stored at -20°C for further measurement. The livers were carefully removed from the body and washed in deionized water. 200 mg of tissues were excised aseptically per layers and stored in liquid nitrogen. In addition, abdominal fats were stripped and its quality was tested, and the rest of the livers were saved separately in labeled sterile plastic sampling bags

Serum Lipid Indicators analysis

The levels of serum triglyceride (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C) and high-density lipoprotein cholesterol (HDL-C) were determined by using commercial available kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), and the procedure was followed with the protocol from the manufacturer.

Fat Deposition and Cholesterol Content in Eggs Analysis

Crude fat was measured using soxhlet extraction method (Guo et al., 2010). The cholesterol content in the eggs was determined via sulfur phosphorus iron reagent spectrophotometry (Chen et al., 2008).

Real-time Polymerase Chain Reaction (RT-PCR)

Hepatic total RNA was extracted using RNAiso Plus reagent, and total RNA concentrations were determined by Nano Drop ND 2000 spectrophotometry (Thermo Scientific, Wilmington, DE). The primers of the genes apoA I, apoB₁₀₀ and the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) of chicken were designed based on the sequences which were obtained from the Genbank (Table 3). The purified RNA was reverse transcribed into cDNA using a Takara RT-PCR Kit (Dalian, China) and the mRNA expression level of apoA I was quantified using the Premix Ex Taq^TM (Probe qPCR) master mix and apoB 100 mRNA expression was quantified using the SYBR Premix Ex Taq™ II (Tli RNaseH Plus) master mix. The RT-PCR was conducted using the ABI 7500 real-time PCR machine (Applied Biosystems, Beijing, China). The program used for the amplification of the genes consisted of a denaturation step at 95 °C for 30 s, followed by 40 cycles of 94 °C for 10 s, 60 °C for 30 s, and extension at 72 °C for 30 s. The internal reference (GAPDH) gene was used as an internal control for the normalization of all the values. △Ct(sample)=Ct(target gene)-Ct(reference gene); △Ct(calibrator)=Ct(target gene)-Ct(reference gene); △△Ct=△Ct(sample)-△Ct(calibrator), 2^-△△CT was used to calculate the expression levels of genes.

Table 3
Prime and Probe sequence.

Interest genes	Reference sequence NO.	Primer sequences (5’-3’)	Products Length/ bp	Annealing temperature
ApoA I	NC-006111.3	F: GGCCAGCGGCAAGGAT	94bp	60°C
		R: ACTCAGCGTGTCCAGGTTGTC
		Probe: CATCGCCCAGTTCGAGTCCTCTGC
ApoB100	NC-006090.3	F: CCT GCC ATG GGA AAC ATT AC	150bp	60°C
		R: TGC AGT GCA TCA ATG ACA GA
GAPDH	NC-006088.3	F: GGTGCTAAGCGTGTTATCATCTCA	70bp	60°C
		R: CATGGTTGACACCCATCACAA
		Probe: CTCCCTCAGCTGATGCCCCCATG

Statistical Analysis

Date was analyzed using SPSS 17.0 (Chicago, IL, USA), and presented as mean ± standard error, with p<0.05 as criteria for significance, and p<0.01 for highly significant. A significant value was obtained by one-way ANOVA, Duncan’s method for multiple comparisons, and least significant difference method (LSD).

RESULTS

Effects of TCM on Laying Performance

Compared to the control group, the average of daily laying rate in TCM 1 and TCM 2 treatments was increased by 6.51% (p<0.01) and 3.67% (p<0.05) respectively. Cholesterol content in the eggs in TCM 1 and TCM 2 treatments decreased by 22.19% (p<0.01) and 14.54% (p<0.05) respectively. There was no significant difference (p>0.05) in the average of daily feed intake and the average egg weight among the three groups (Table 4).

Table 4
Effects of TCM on laying performance of layers

Item	control group	TCM 1 group	TCM 2 group
Average daily laying rate, %	80.82±0.23aA	86.08±0.62bB	83.74±0.40cAB
Average daily feed intake, g d-1	112.57±1.66a	112.58±1.43a	112.69±2.16a
Average egg weight, g	61.82±1.15a	60.21±0.72a	60.88±1.28a
cholesterol content in eggs, mg 100g-1	749.21±48.67aA	582.94±22.00bB	640.29±65.08bAB

• TCM, traditional Chinese medicine prescriptions; TCM 1, traditional Chinese medicine prescriptions 1;
• TCM 2, traditional Chinese medicine prescriptions 2.
• Data are mean ± standard error. (n=45, 3 replicates per treatment, 15 layers per replicate).
• ^a
  ^-c within a row, means without a common lowercase superscripts are different at p<0.05.
• ^A
  ^-B within a row, means without a common uppercase superscripts are different at p<0.01.

Effects of TCM on Serum Lipid

Compared to the control group, serum TG levels (Figure 1) in TCM 1 group on the 30^th and 60^th days decreased by 21.69% (p<0.01) and 20.67% (p<0.05) respectively, while the dietary supplementation with TCM 2 on the 30^th and 60^th days declined by 14.71% (p<0.05) and 10.7% (p>0.05), respectively. Serum TC levels (Figure 2) of TCM 1 and TCM 2 group decreased by 13.3% (p<0.05) and 11.3% (p<0.05) respectively on the 60^th day, but no differences were recorded on the 30^th day. Compared to the control group, serum LDL-C levels (Figure 3) in TCM 1 group on the 30^th and 60^th days reduced by 23.53% (p<0.01) and 15.6% (p<0.05), respectively. And in the dietary supplementation with TCM 2 decreased by 12.75% (p>0.05) and 14.68% (p<0.05) respectively. The HDL-C levels (Figure 4) in TCM I group on days 30 and 60 increased by 18.68% (p<0.05) and 22.77% (p<0.05) respectively, while the TG levels in TCM II group on days 30 and 60 decreased by 8.79% (p>0.05) and 18.81% (p<0.05).

Figure 1
TG content in serum. ^a,b,c p<0.05. ^{A, B, C} p<0.01. TCM, traditional Chinese medicine prescriptions; Control, fed with a basal diet; TCM 1, fed with a basal diet supplemented with 1% traditional Chinese medicine prescriptions 1; TCM 2, fed with a basal diet supplemented with 1% traditional Chinese medicine prescriptions 2.

Figure 2
TC content in serum. ^a,b,c p<0.05. ^{A, B, C} p<0.01. TCM, traditional Chinese medicine prescriptions; Control, fed with a basal diet; TCM 1, fed with a basal diet supplemented with 1% traditional Chinese medicine prescriptions 1; TCM 2, fed with a basal diet supplemented with 1% traditional Chinese medicine prescriptions 2.

Figure 3
LDL-CHOL content in serum. ^a,b,c p<0.05. ^{A, B, C} p<0.01. TCM, traditional Chinese medicine prescriptions; Control, fed with a basal diet; TCM 1, fed with a basal diet supplemented with 1% traditional Chinese medicine prescriptions 1; TCM 2, fed with a basal diet supplemented with 1% traditional Chinese medicine prescriptions 2.

Figure 4
HDL-CHOL content in serum. ^a,b,c p<0.05. ^{A, B, C} p<0.01. TCM, traditional Chinese medicine prescriptions; Control, fed with a basal diet; TCM 1, fed with a basal diet supplemented with 1% traditional Chinese medicine prescriptions 1; TCM 2, fed with a basal diet supplemented with 1% traditional Chinese medicine prescriptions 2.

Effects of TCM on abdominal and hepatic fat percentage

Compared to the control group, the abdominal fat percentage (Figure 5) in TCM 1 and TCM 2 groups on the 60^th day decreased by 9.69% (p<0.05) and 3.31% (p>0.05) respectively, but no differences were noticed on the 30^th day. Hepatic fat percentage (Figure 6) in TCM 1 treatments on the 30^th and 60^th days decreased by 14.98% (p<0.05) and 28.68% (p<0.01), respectively, which in dietary supplementation TCM 2 on the 30^th and 60^th days decreased by 8.60% (p>0.05) and 26.09% (p<0.01), respectively.

Figure 5
Abdominal fat percentage (%). a,b,c p<0.05. A, B, C p<0.01. TCM, traditional Chinese medicine prescriptions; Control, fed with a basal diet; TCM 1, fed with a basal diet supplemented with 1% traditional Chinese medicine prescriptions 1; TCM 2, fed with a basal diet supplemented with 1% traditional Chinese medicine prescriptions 2.

Figure 6
Hepatic fat percentage. a,b,c p<0.05. A, B, C p<0.01. TCM, traditional Chinese medicine prescriptions; Control, fed with a basal diet; TCM 1, fed with a basal diet supplemented with 1% traditional Chinese medicine prescriptions 1; TCM 2, fed with a basal diet supplemented with 1% traditional Chinese medicine prescriptions 2.

Effects of TCM on expression levels of ApoA I and ApoB ₁₀₀ mRNA in the Liver

Compared to the control group, dietary supplementation with TCM 1 increased the expression level of apoA I mRNA (Figure 7) on the 30^th and 60^th days by 38.79% (p<0.01) and 41.75% (p<0.01) respectively, while dietary supplementation with TCM 2 increased by 19.83 % (p<0.05) and 14.56% (p<0.05) respectively. The expression level of apoB₁₀₀ mRNA (Figure 8) in TCM 2 group increased by 27.3% (p<0.01) and 14.86% (p<0.05) respectively on the 30^th and 60^th days, dietary supplementation with TCM 1 increased by 12.84% (p<0.05) on the 60^th day, but no differences were noticed on the 30^th day.

Figure 7
The expression level of apoA I mRNA in liver. a,b,c p<0.05. A, B, C p<0.01. TCM, traditional Chinese medicine prescriptions; Control, fed with a basal diet; TCM 1, fed with a basal diet supplemented with 1% traditional Chinese medicine prescriptions 1; TCM 2, fed with a basal diet supplemented with 1% traditional Chinese medicine prescriptions 2.

Figure 8
The expression level of apoB100 mRNA in liver. a,b,c p<0.05. A, B, C p<0.01. TCM, traditional Chinese medicine prescriptions; Control, fed with a basal diet; TCM 1, fed with a basal diet supplemented with 1% traditional Chinese medicine prescriptions 1; TCM 2, fed with a basal diet supplemented with 1% traditional Chinese medicine prescriptions 2.

DISCUSSION

In the present study, the changes of laying performance, serum lipid, hepatic and abdominal fat percentage, and mRNA expression level of apoA I, apoB genes were investigated. The improvement in egg production due to TCM supplementation was observed. Chinese herbal medicine which contained a certain amount of nutrients and some unknown growth-promoting active substances could enhance appetite, and promote body metabolism (Cai et al., 2004). But average daily laying rate in TCM 1 treatment increased significantly when compared to the dietary supplemented with TCM 2. A possible reason is that Codonopsis pilosula (Lin et al., 2014) is generally well-known for tonifying qi, and Angelica sinensis is an important drug to nourish blood (Yang et al., 2009). Besides, the Poria presented strong kidney protection, which stated that TCM 1 could significantly strengthen the ovarian function of layers (He et al., 2014; Zhao et al., 2013).

In this experiment, the results showed that both TCM 1 and TCM 2 declined the levels of serum lipid and blood lipid significantly, and it might be due to the TCMs which contained the ingredients that can regulate lipid metabolism. The earlier studies showed that the serum lipid level decreased significantly in high-fat rabbit diet by providing rabbit with Crataegus pinnatifida which is rich in total flavonoids from Crataegus pinnatifida, meanwhile, it has been confirmed that Astragalus membranaceus and Codonopsis pilosula could protect the liver and the heart, which also benefits for lipid metabolism (Jiang et al., 2013; Li et al., 2012; Wu et al., 2014). Moreover, some reports showed that Lotus leaf leads to a decrease in the levels of serum lipid (Cho et al., 2007; Kim et al., 2013). Furthermore, many studies uncovered that TCM could affect total lipid metabolism by reducing serum lipid level (Guo et al., 2015; Kwon et al., 2005; Tu et al., 2003). The present study showed a significant decrease in hepatic fat percentage and a decrease trending in abdominal fat percentage after the dietary supplemented with TCM. It indicated that TCM could promote the oxidation and decomposition of fatty acid to prevent the deposit of fat in visceral.

ApoA I is the major protein of HDL, and the level of serum HDL-C is a main indicator to assess the ability of HDL facilitating the transport of lipid from peripheral tissues to the liver for disposal (Barter, 2011). The present data showed that the expression level of apoA I mRNA increased significantly in two TCM treatment groups. Compared to the control group, the data was consistent with the change trend of HDL-C in this experiment, which was in accordance with the previous study (Chor et al., 2009). These results clearly stated that both of TCM 1 and TCM 2 played important roles in scavenging serum lipid. The serum TG and TC levels had a significant decrease. ApoB₁₀₀ is a constituent of LDL particles, and the increased secretion of apoB₁₀₀ contributes to the removal of lipid from the liver (Srivastava et al., 2000). The results presented that the dietary supplemented with TCM 1 and TCM 2 increased the expression level of apoB₁₀₀ mRNA, which reduced the probability of the fat deposit in the liver and hepatic steatosis. These changes may be associated with the effects of Astragalus membranaceus that were against liver injury (Sun et al., 2008). The decreasing of cholesterol content in eggs was observed in both TCM treatments, which follows with the change of serum TC levels. In layers, cholesterol was incorporated into VLDL particles after biosynthesis in the liver. As the hens were sexually mature, massive amounts of VLDL particles, including TC, were produced and secreted into serum by liver under the stimulation of estrogen. And then the VLDL particles escape through lipolysis, and the TC was transferred from the serum to the eggs (Zhou et al., 2014). It suggested that reduced serum TC level apparently alleviated the cholesterol deposition in eggs. This could, in turn, explain the decrease of serum TC level and cholesterol content.

CONCLUSION

In conclusion, dietary supplemented with TCM exerts positive influences on lipid metabolism. These effects could be helpful for the control of lipid metabolism diseases in laying hens and human beings also could benefit from the better productions.

ACKNOWLEDGMENTS

This project was supported by grants from the National Natural Science Foundation of China (No. 31160522), and the Science and Technology support Project of Jiangxi Province (No. 20111BBF60019, 20133BBF60008), and the National Important Research Plan (No.2016YFD0501205-2).

REFERENCE

• Barter P. HDL-C:role as a risk modifier. Atherosclerosis Supplements 2011;12:267-270.
• Bostriim K, Zarah G, Poksay KS, Johnsonn DF, Lusis AJ, Innerarityz TL. Apolipoprotein B mRNA Editing. The Journal of Biological Chemistry 1990;265:22446-22452.
• Chen CG, Niu SY, Lu JF, Xiong Y. Study on the degradation on cholesterol in eggs by three kinds of lactic acid fungus. Guangdong Agricultural Science 2008;08:096.
• Cho IJ, Lee C, Ha TY. Hypolipidemic effect of soluble fiber isolated from seeds of Cassia tora Linn in rats fed a high-cholesterol diet. Journal of Agricultural and Food Chemistry 2007;55:1592-1596.
• Choi KO, Lee I, Paik SY, Kim DE, Lim JD, Kang WS, et al. Ultrafine Angelica gigas powder normalizes ovarian hormone levels and has antiosteoporosis properties in ovariectomized rats. Journal of Medicinal Food 2012;15:863-872.
• Dixon JL, Ginsberg HN. Regulation of hepatic secretion of apolipoprotein B-containing lipoproteins:information obtained from cultured liver cells. The Journal of Lipid Research 1993;34:167-179.
• Gharaghani H, Shariatmadari F, Torshizi MA. Effect of cottonseed meal fermented with yeast on the lipid-related gene expression in broiler chickens. Brazilian Journal of Poultry Science 2015;17:1516-635X.
• Gu ZW, Xie YH, Yang M, Sparrow JT, Wang K, Li Y, et al. Primary structure of Beijing duck apolipoprotein A-1. Journal of Protein Chemistry 1993;12:585-591.
• Guo Q, Ye PZ, Qi XH, Tian X, Yang A, Wang P, et alç. Cardiovascular Pharmacology Research Progress of Hawthorn Leaves Extract. Key Engineering Materials 2015;636:167-169.
• Guo XQ, Cao HB, Zhang CY, Li HT, Hu GL. Effects of high-energy low-protein diet on apolipoprotein A I and lipid metabolism in laying hens. Chinese Journal of Animal Nutrition 2010;22:187-193.
• He X, Wang J, Li M, Hao D, Yang Y, Zhang C, et al. Eucommia ulmoides Oliv ethnopharmacology, phytochemistry and pharmacology of an important traditional Chinese medicine. Journal of Ethnopharmacology 2014;151:78-92.
• Jiang XL, Cao X, Huang Y, Chen JW, Yao XL, Zhao MM, et al. Effects of treatment with Astragalus Membranaceus on function of rat leydig cells. BMC Complement Altern Med 2015;15:261.
• Jo SP, Kim JK, Lim YH. Antihyperlipidemic effects of rhapontin and rhapontigenin from rheum undulatum in rats fed a high-cholesterol diet. Planta Medica 2014;80:1067-1071.
• Kim AR, Jeong SM, Kang MJ, Jang YH, Choi HN, Kim JI. Lotus leaf alleviates hyperglycemia and dyslipidemia in animal model of diabetes mellitus. Nutrition Research and Practice 2013;7:166-171.
• Kwon HJ, Hyun SH, Choung SY. Traditional Chinese Medicine improves dysfunction of peroxisome proliferator-activated receptor alpha and microsomal triglyceride transfer protein on abnormalities in lipid metabolism in ethanol-fed rats. Biofactors 2005;23:163-176.
• Li ZT, Zhu LB, Zhang H, Yang J, Zhao J, Du DW, et al. Protective effect of a polysaccharide from stem of Codonopsis pilosula against renal ischemia/reperfusion injury in rats. Carbohydrate Polymers 2012;90:1739-1743.
• Liang X, Yamazaki K, Kamruzzaman M, Bi X, Panthee A, Sano H. Effects of Chinese herbal medicine on plasma glucose, protein and energy metabolism in sheep. Journal of Animal Science and Biotechnology 2013;4:51.
• Lin LC, Tsai TH, Kuo CL. Chemical constituents comparison of Codonopsis tangshen, Codonopsis pilosula var. modesta and Codonopsis pilosula. Natural Product Research 2013;27:1812-1815.
• Mooradian AD, Haas MJ. The effect of nutritional supplements on serum high-density lipoprotein cholesterol and apolipoprotein A-I. American Journal of Cardiovascular Drugs 2014;14:253-274.
• Nie CX, Zhang WJ, Ge WX, Liu YF, Wang YQ, Liu JC. Effect of cottonseed meal fermented with yeast on the lipid-related gene expression in broiler chickens. Brazilian Journal of Poultry Science 2015;17:1806-9061.
• Patrícia C, Caramori P, Galdino TP, Barcellos S. Gomes CI, Schwanke CH. Egg consumption and coronary atherosclerotic burden. Atherosclerosis 2013;229:381-384.
• Song XZ, Luo JR, Fu DB, Zhao XG, Bunlue K, Xu ZS, et al. Traditional chinese medicine prescriptions enhance growth performance of heat stressed beef cattle by relieving heat stress responses and increasing apparent nutrient digestibility. Asian-Australasian Journal of Animal Science 2014;27:1513-1520.
• Sontag TJ, Carnemolla R, Vaisar T, Reardon CA, Getz GS. Naturally occurring variant of mouse apolipoprotein A-I alters the lipid and HDL association properties of the protein. Journal of Lipid Research 2012;53:951-963.
• Spence JD, Jenkins DJ, Davignon J. Egg yolk consumption and carotid plaque. Atherosclerosis 2012;224:469-473.
• Srivastava RA, Srivastava N. High density lipoprotein, apolipoprotein A-I, and coronary artery disease. Molecular and Cellular Biochemistry 2000;209:131-144.
• Sun WY, Wei W, Gui SY, Wu L, Wang H. Protective effect of extract from Paeonia lactiflora and Astragalus membranaceus against liver injury induced by bacillus Calmette-Guerin and lipopolysaccharide in mice. Basic & Clinical Pharmacology & Toxicology 2008;103:143-149.
• Teck CL, Tan BK, Foo HL, Norhani A, Zulkifli I. Relationships of plasma and very low density lipoprotein lipids and subfractions with abdominal fat in chickens. Asian-Australasian Journal Animal Science 2011;24:82-87.
• Trott KA, Giannitti F, Rimoldi G, Hill A, Woods L, Barr B, et al. Fatty liver hemorrhagic syndrome in the backyard chicken:a retrospective histopathologic case series. Veterinary Pathology 2014;51:787-795.
• Tu ZG, Han XD, Wang XY, Hou YY, Shao BY, Wang X, et cl. Protective effects of CVPM on vascular endothelium in rats fed cholesterol diet. Clinica Chimica Acta 2003;333:85-90.
• Wu J, Peng W, Qin R, Zhou H. Crataegus pinnatifida:chemical constituents, pharmacology, and potential applications. Molecules 2014;19:1685-1712.
• Yang M, Chan GC, Deng R, Ng MH, Cheng SW, Lau CP, et al. An herbal decoction of Radix astragali and Radix angelicae sinensis promotes hematopoiesis and thrombopoiesis. Journal of Ethnopharmacology 2009;124:87-97.
• Zhao YY, Li HT, Feng YL, Bai X, Lin RC. Urinary metabonomic study of the surface layer of Poria cocos as an effective treatment for chronic renal injury in rats. Journal of Ethnopharmacology 2013;148:403-410.
• Zhong CY, Luo Q, Sun M, Corke H. Antioxidant activity and phenolic compounds of 112 traditional Chinese medicinal plants associated with anticancer. Life Science 2004;74:2157-2184.
• Zhou L, Shi Y, Guo R, Liang M, Zhu X, Wang C. Digital gene-expression profiling analysis of the cholesterol-lowering effects of alfalfa saponin extract on laying hens. PLoS One 2014;9:e98578.

Publication Dates

• Publication in this collection
  Jan-Mar 2018

History

• Received
  29 Jan 2017
• Accepted
  30 Oct 2017