Knockdown of CPT1A Induce Chicken Adipocyte Differentiation to Form Lipid Droplets

ABSTRACT

Lipid metabolism dysfunction is closely related to obesity, inflammation, diabetes, lipodystrophy, cardiovascular disease. Along with having a positive effect on energy homeostasis during fasting or prolonged exercise through mitochondrial fatty acid oxidation (FAO), more than two dozen enzymes and transport proteins are involved in the activation and transport of fatty acids into the mitochondrial, providing insights into their critical roles in metabolism. CPT1A has been reported to be expressed ubiquitously in the body and associated with dire consequences affecting fat deposition as the key rate-limiting enzyme of FAO. However, there is a dearth of data on the specific role of CPT1A on adipogenic differentiation and adipocyte lipolysis on chicken. This study assessed CPT1A’s function in adipocyte differentiation andadipocyte lipolysis, and the mechanisms were investigated. We found that CPT1A knockdown (KD) promotes the differentiation of chicken preadipocytes into mature adipocytes. CPT1A KD increased PPARγ protein expression level. Expression levels of lipid synthesis-related genes were increased, and lipolysis genes were reduced.

Also, CPT1A KD can encourage the formation of lipid droplets. So our results confirmed that knockdown of CPT1A induced the lipid differentiation and inhibited the β-oxidation process to promote the formation of lipid droplets. These findings may deepen our understanding on CPT1A function, especially its regulatory role in adipocyte biology.

Keywords:
Adipocyte differentiation; CPT1A; lipid droplets

INTRODUCTION

As a high quality protein resource, chicken provides rich nutrients for human beings (Jayasena et al., 2013). In poultry production, on one hand disorders of lipid metabolism can affect poultry health and thus meat and egg quality (Ni et al., 2018; Nakamura et al., 2020; Mir et al., 2021; Ren et al., 2021). On the other hand, differences in the distribution and composition of lipids can also affect the flavor of chicken (Aaslyng et al., 2017). Therefore, studying the lipid metabolism and intermuscular fat is an entry point for poultry research. This study serves as a reference and theoretical basis for poultry production.

Lipid metabolism has been identified as an important biological process in living organisms, penetrating every aspect of physiological activity. When energy intake is scarce, this fat can be released as fatty acids into the bloodstream, where it is taken up by other tissues and used as an alternative energy source. When energy intake constantly exceeds the energy expenditure, the adipose tissue expands as a result of hypertrophy in particular but also due to hyperplasia of the adipocytes (Matsushita et al., 2021). In addition to having a positive effect on energy homeostasis during fasting or prolonged exercise through mitochondrial fatty acid oxidation (FAO), more than two dozen enzymes and transport proteins are involved in the activation and transport of fatty acids into the mitochondrial, providing further insights into their critical in metabolism (Kohjima et al., 2007).

Carnitine palmitoyl transferase 1A(CPT1A), an en-zyme present in the outer membrane of mitochondria, functions to transport fatty acid from the cytosol into mitochondria (Lin et al., 2020). It also plays a vital role in regulating the oxidation process of fatty acids in vivo to a higher degree and affecting the normal life activities of the body (Park et al., 1998; Gobin et al., 2002; Zammit et al., 2008). As the key rate-limiting enzyme of FAO, CPT1A has been reported to be expressed ubiquitously in the body and associated with dire consequences affecting fat deposition (Morash et al., 2011). However, there is a dearth of data on the specific role of CPT1A on adipogenic differentiation and adipocyte lipolysis on chicken.

In our previous studies, we found significant differences in the gene expression of CPT1A in intramuscular adipocytes at different development stages on chickens (Li et al., 2021). Changes in CPT1A activity occur in response to animal or cell’s nutritional and hormonal status (Shin et al., 2006). Intramuscular adipocyte deposition can greatly affect the quality and taste of chicken meat and the health of broilers, which is also of great significance in the production practice of broilers. Recent studies have shown that the production of flavor and aroma compounds is associated with intramuscular fat development, fatty acid deposition, and intramuscular lipid metabolism (Song et al., 2013; Sohaib et al., 2017). Hence, in this study, CPT1A’s function in adipocyte differentiation and adipocyte lipolysis was assessed, and the mechanisms were investigated.

MATERIALS AND METHODS

Ethics Statement

All the procedure was approved by the Institutional Animal Care and Use Committee of Sichuan Agricultural University (Certification No. YCS-2020202024). All experiments were performed under the SAU Laboratory Animal Welfare and Ethics guidelines.

Animals and Sample Collection

Daheng broiler chicken were used in the current research, provided by the Daheng Poultry Breeding Company (Sichuan, China). Five chickens were sacrificed at 150 days for tissue expression profile testing. The tissues were collected, including heart, liver, spleen, lung, kidney, breast muscle, leg muscle, subcutaneous fat, abdominal fat, gizzard, glandular stomach, ovary, and pituitary.

Broiler Intramuscular adipocyte Cell Isolation

Primary chicken intramuscular preadipocytes were isolated from pectoral major breast muscle tissue of 15-day-old chickens following the methods Zhang M at al. (2018) described previously. Breast muscles were aseptically isolated, and all visible connective tissue was removed. The isolated muscle tissues were washed three times in pH 7.4 phosphate-buffered saline (PBS) with 200 U/mL penicillin-streptomycin. Excess fascia and connective tissue were removed. Then the tissue was minced to 1 mm³ to be digested by collagenase I and II. Finally, adipocyte was isolated by differential attachment method.

Cell Culture and Treatment

Intramuscular adipocytes cells were seeded in 6-well plates, cultured in DMEM, and transfected si-CPT1A and Negative Control (NC). The sequences are listed in Table1. Small interfering RNAs (siRNAs) were synthesized by GenePharma Co. Ltd. (Shanghai, China). The Lipofectamine 3000 Reagent (Invitrogen, USA) was used as a transfection reagent, and cells were harvested after 48h, subsequent WB experiment, RNA extraction, and oil red O staining, and triglyceride extraction. The appropriate test methods are according to Li et al. (2020)’s described previously.

Table 1
The RNA oligonucleotides used for cell transfection.

Name	siRNAsequence (5’-3’)
siRNA-CPT1A-gallus-879	GCAAUGGACUUCCUUCAUUTT
	AAUGAAGGAAGUCCAUUGCTT
Negative siRNA	UUCUCCGAACGUGUCACGUTT
	ACGUGACACGUUCGGAGAATT

RNA Extraction and Quantitative Real-Time PCR

According to the manufacturer’s instructions, total RNA was extracted from the tissues and cells using TRIzol reagent (Takara, Tokyo, Japan). Quantitative real-time PCR (qRT-PCR) analysis was performed in reaction volumes of 10 µL containing 1 µL of cDNA, 0.5 µL of forward and reverse primers, 5 µL of TB GreenTM Premix (Takara), and 3 µL of DNase/RNase-Free Deionized Water (Tiangen, Beijing, China). The qPCR amplification procedure was as follows: preincubation at 95 for 5 min, followed by 40 cycles of 30 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C. Reaction conditions were based on the manufacturer’s instructions, and the 2^-ΔΔCt method was used to calculate fold changes in gene expression (Livak et al., 2001). The GAPDH genes and β-actin genes were used as internal controls, and primer sequences are shown in Table 2.

Table 2
- The specific primers used for qPCR.

Gene	AccessionNumber	Forward Primer Sequence 5’-3’	Reverse Primer Sequence 5’-3’
β-actin	NM_205518.1	AATGGCTCCGGTATGTGCAA	GGCCCATACCAACCATCACA
GAPDH	NM_204305.1	TCCTCCACCTTTGATGCG	GTGCCTGGCTCACTCCTT
CDK2	NM_001199857.1	CCAGAACCTCCTCATCAAC	CAGATGTCCACAGCAGTC
CCND1	NM_205381.1	CAGAAGTGCGAAGAGGAAGT	CTGATGGAGTTGTCGGTGTA
CCND2	NM_204213.1	CCCACTCGAAAGTGCCATCT	TGCTGCAAGGTTCCACTTCA
PCNA	NM_204170.2	GAGACCTCAGCCACATTGGT	AGTCAGCTGGACTGGCTCAT
MKI67	XM_004942359.4	TAGCACCAGCAGACACCTTG	GCCATCAGCCTACTCAGACC
Caspase-3	NM_204725.1	TGGCCCTCTTGAACTGAAAG	TCCACTGTCTGCTTCAATACC
Caspase-8	XM_040703262.1	AGCTGTAATGCAGGGGTTCT	GGCCTCACGATCCTTCTGAC
Caspase-9	XM_424580.5	TCCCGGGCTGTTTCAACTT	CCTCATCTTGCAGCTTGTGC
BCL2	NM_205339.1	ATCGTCGCCTTCTTCGAGTT	ATCCCATCCTCCGTTGTCCT
PPARG	XM_015292931.2	GTGCAATCAAAATGGAGCC	CTTACAACCTTCACATGCAT
FASN	NM_205155.3	AGCCCAAGTATTCAGGCACC	TTCAGGATGCCCACATCACC
ACSL1	NM_001012578.1	TCAATGCCTGGTGACTGGAC	CCTCACCTTCTCCTTTGGCA
ME1	NM_204303.1	AAGAGGGGCTACGAGGTGCT	CAGTTGTTGCCTTTCCTCCAAG
ACOX1	NM_001006205.1	AAGGAGATCGAGGCCTTAGTG	GCCGTCCACGATGAACAAAG
ACOX2	XM_004944646.4	ATGTAAGGCGTGGGTCACAG	GCTTCTTCTTCCCCAGGCTT
ACOX3	XM_420814.6	AAAGAAGACAGTGGCAACCG	TCACCATCGAGAAACACTGC

Western Blotting

Western Blotting was performed as Luo et al. (2016), as previously described. Intramuscular adipocytes were seeded in 6-well plates, cultured in DMEM, and transfected si-CPT1A and Negative Control. The concentration was determined using a bicinchoninic acid (BCA) protein assay kit (Beyotime, Shanghai, China); after 72 h, the proteins of transfected cells were extracted using lysis buffer. Total proteins (10µg) were separated by 12% SDS-PAGE and transferred to a 0.2mm polyvinylidene fluoride (PVDF) membrane that was soaked in formaldehyde. The membrane was blocked with blocking buffer (Beyotime) for approximately one h at room temperature before incubation overnight at 4 ºC with direct detection antibodies [anti-PPARγ, ABclonal Technology Co., Ltd; 1:1,000) and anti-β-tubulin (ZenBio, Chengdu, China; 1:2,000)]. The PVDF membrane was washed three times with western wash Buffer (Beyotime) and then incubated for one h at room temperature with goat anti-mouse immunoglobulin G (IgG) H & L (ZenBio; 1:5,000) and Rabbit Anti-Rabbit IgG H&L (ZenBio; 1:5,000). Finally, antibody reactive bands were noticed using enhanced chemiluminescence (ECL) (Beyotime). Image J software was used to measure the relative expression of the protein. Image Lab5.2 was used for densitometric analysis of the expressed protein bands.

Oil Red Staining and Cellular TG Content Measurement

Harvested Broiler Intramuscular adipocytes were washed three times with PBS and fixed with 4% formaldehyde for 30 min at 25 °C. After washing with PBS twice, cells were stained with diluted Oil Red O for 30 min at 25 °C in a dark environment. Then, Oil Red O was removed, adipocytes were washed five times with distilled water. In the end, adipocytes were studied with microscopy (Pang et al., 2013). The manufacturer’s instructions measured TG content in a triglyceride content detection kit (APPLYGEN, Beijing, China).

Statistical analysis

All experiments were conducted at least three times. GraphPad Prism 8.0 was used to graph the results. A two-sample t-test was used to perform the statistical significance test between groups, where all experimental data were presented as Mean ±SEM. Differences were considered statistically significant at p<0.05 or p<0.01.

RESULTS

Expression Profiles of CPT1A in Broiler Tissues and intramuscular adipocytes during adipogenesis

The total RNAs from thirteen tissues of 150-day-old Daheng broiler chickens were extracted, and real-time PCR (RT-PCR) was performed to determine the tissue expression profile of CPT1A. The results showed (Figure 1) that CPT1A was highly expressed in liver, subcutaneous fat, and abdominal fat.

Figure 1
The expression profile of CPT1A in thirteen tissues.

The broiler intramuscular adipocytes were isolated to study the role of CPT1A in broiler intramuscular adipogenesis. The intramuscular adipocytes were fully differentiated and fulfilled with large lipid droplets (Figure 2) after eight days of induction. Then RNA was removed from adipogenic cells at 0, 2, 4, 6, 8, and10 days of differentiation to spot the CPT1A expression pattern during intramuscular adipocyte differentiation (Figure 3). The expression level of CPT1A in all stages of induced differentiation was higher than that in the period without induced differentiation (0d).

Figure 2
Cell morphology change during broiler intramuscular adipocyte differentiation.

Figure 3
Expression of CPT1A during broiler intramuscular adipocyte differentiation.

CPT1A inhibits lipid droplet synthesis

Si-CPT1A or Negative Control was transfected to intramuscular adipocytes to research the potential function of CPT1A for intramuscular adipogenesis. The RT-qPCR assay displayed that the knockdown efficiency is obvious, reaching 67% (Figure 4a). The adipocytes cell morphology changed after induction staining with Oil Red O (Figure 4b); The results of oil red O determination displayed that in the random visual field area, the area of fat droplets formed in the si-CPT1A transfected group was way higher than that in the Negative Control group. The corresponding absorbance measured the content of triglycerides at 510nm (Figure 4c) to verify the further comparison of triglyceride formation. The absorbance of the si-CPT1A treatment group after adsorption of triglyceride with isopropanol and transfection at 510nm was also higher than that of the Negative Control group.

Knockdown of CPT1A promoted lipid differentiation and inhibited lipid oxidation

We measured the downstream gene expression related to the lipid metabolism of the si-CPT1A and Negative Control group to explore these genetic evidence in cell proliferation, cell differation, cell apoptosis, lipid transport and β oxidation strongly suggested that after being transfected by si-CPT1A, the triglyceride content was significantly elevated in the si-CPT1A group.

Figure 4
The mRNA expression level of CPT1A and NC after knock down.

There was no significant difference in the expression of genes related to proliferation and apoptosis between the two groups (Figure 5). The expression levels of markers associated with adipose differentiation syntheses, such as PPARγ, FASN, and ACSL1, were relatively improved, whereas part of the expression levels of genes related to β-oxidation in process in lipid decomposition were significantly reduced in the si-CPT1A group. (Figure 6a).

Figure 5
(a) Proliferation-related genes expression (b) Apoptosis-related genes expression.

Figure 6
CPT1A inhibits lipid differentiation through the PPAR pathway.

DISCUSSION

Lipid metabolism is an important physiological process in the human body, including lipid synthesis, decomposition, transport, and oxidation. A variety of factors regulates the balance of lipid metabolism, and the activities of living organisms cannot be separated from the various processes in which lipids participate. Lipid metabolism supplies not only the energetic needs of the cells but also provides the raw material for cellular growth and the signaling molecules for many oncogenic pathways (Alannan et al., 2020). Carnitine palmitoyltransferase-1 (CPT1) converts long-chain acyl-CoAs into long-chain acylcarnitines, which push their translocation across the mitochondrial membrane into the mitochondrial matrix, where fatty acid β-oxidation takes place (Lai et al., 2020). As one of the CPT1 subtypes, based on its role in determining the total rate of fatty acid oxidation and cytosolic concentration of long-chain acyl-CoA esters, CPT1A functions in energy metabolism is involved in many physiological processes (Zammit et al., 2008). The enzyme CPT1Aresides in the outer mitochondrial membrane, which catalyzes the transfer of acyl groups between coenzyme A (CoA) and L-carnitine, converting acyl-CoA esters into acyl-carnitine esters reversibly (Joshi et al., 2020). These acyl-carnitines can then enter the matrix where β-oxidation takes place (Schlaepfer et al., 2020). From the perspective of gene function, CPT1A is involved in regulating a variety of lipid metabolic diseases.

In this experiment, the gene expression level of CPT1A in the liver, sebaceous fat, abdominal fat, and other lipogenic parts, which are closely associated to lipid metabolism of Daheng broiler chickens, was higher than that in other regions, indicating that CPT1A is vigorously involved in the process of lipid generation or lipid metabolism in poultry. Previous studies on CPT1A have covered multiple populations, including lipopolysaccharides such as the liver, focusing on the relationship between its regulation and energy stress (Schlaepfer et al., 2020). We focused on meat production to explore the common function of CPT1A in intramuscular fat, other fats, and the specific regulatory role of CPT1A. Lipid metabolism and deposition are closely associated with the health of broilers and the quality of meat, attracting people’s attentionto the quality of chicken. Hence, the study of intramuscular fat is of great importance for human production activities.

In inducing differentiation after the separation of intramuscular adipocytes, the formation process of lipid droplets can also be seen. We can see the process of lipid droplets from sparse to dense, from single lipid droplets to aggregation into clusters, and finally into sheets to form larger lipid droplets. During the whole process of fat proliferation and induced differentiation, the expression level of CPT1A was significantly higher than that of 0D, which further showed that CPT1A was actively involved in the process of lipid generation or lipid metabolism. This was consistent with previous studies (Dai et al., 2018; Wei et al., 2021). We transfected adipocytes with an interference vector and knocked down the expression of CPT1A. The degree of lipid production in the CPT1A knockdown group was significantly higher than that in the negative control group. The same indicated that CPT1A had an inhibitory effect on lipid production, and knocking down CPT1A could directly increase lipid synthesis. However, the downstream gene expression levels revealed that the expression levels of genes related to proliferation and apoptosis did not drastically change after the knockdown of CPT1A, indicating that CPT1A did not regulate the process of lipogenesis by affecting the proliferation and apoptosis of adipocytes.

However, during lipid differentiation, the PPARγ pathway was significantly activated. The PPARγ is a major regulator of adipocyte gene expression and insulin signaling between adipocytes and is involved in adipocyte differentiation, transport, and storage. When activated, PPARγ can control lipid mobilization in adipocytes by promoting adipogenesis and regulating the expression of proteins and cytokines secreted by adipocytes, such as leptin and adiponectin (Zhong et al., 2020), suggesting that CPT1A may activate PPARγ pathway-related genes outside the mitochondrial membrane to promote lipid differentiation. The Western Blot experiment on PPARγ further confirmed this conclusion. FASN is also a marker gene for adipose differentiation and synthesis, as a basic metabolic enzyme, whose main function is to catalyze the synthesis of acetyl CoA (CoA) and malonic monoylcoA into A long-chain soft fatty acid (Chiralass et al., 2004). After the knockdown of CPT1A, the expression of this gene was also significantly increased, indicating an increased effect of lipid synthesis. Simultaneously, the expression of ASCL1 gene, which is closely associated with TG synthesis and storage, also increased significantly. ACSL1 can activate the membrane transporter to deliver FFA into cells (Liu et al., 2013) effectively.

Then again, within the cell mitochondrial membrane, the expression level of β-oxidation related gene expression was partly changed, including ME1 and ACOX2, indicating that the catabolism of lipids in the membrane involved in acetyl CoA’s β-oxidation process is also affected. Still, there are also related oxidation genes that are not affected, CPT1A prevents substances such as acylcarnitine from entering the mitochondrial lining. This is consistent with previous studies showing that CPT1A does not act as a rate-limiting enzyme for β-oxidation alone, possibly because it functions together with other genes such as CROT to transport substances such as acylcarnitine into mitochondria. As demonstrated in Previous studies, CROT is localized in the peroxisomes. It transfers remnants from peroxisomal β-oxidation to the mitochondria and fuels them with fatty acids independently of CPT1A (Van der Leij et al., 2000). Thus, the knockdown of CPT1A can promote lipid differentiation and inhibit the formation of lipid droplets by the oxidative pathway, but the promotion of lipid differentiation is the main pathway.

CPT1A plays a vital role in regulating lipid metabolism in lipids in different tissues. Lin’s research proved that the regulation of CPT1A by LRRK2 may be via the activation of AMP-activated protein kinase (AMPK) and peroxisome proliferator-activated receptor α (PPARα) in HepG2 Cells (Lin et al., 2020). Zhang et al. (2014) research presented muscle CPT1 mRNA was expressed at higher levels in the longissimus dorsi and subcutaneous fat. At the same time, the author indicates that CB1 can affect intramuscular fat deposition by regulating CPT1A and CPT1B mRNA expression. The PPARA signal pathway likely plays a major role in this process in ovarian adipocytes. CPT1A plays a different role in different species, and adipose tissue is taken together, but it also has certain functional commonalities. The specific mechanism of regulating intramuscular fat deposition by CPT1A can be better utilized in production practice in future poultry production.

CONCLUSION

This paper concluded that CPT1A is actively involved in the lipid production of intramuscular fat. Knockdown of CPT1A can activate the PPAR pathway and induce adipocyte differentiation to form lipid droplets. However, CPT1A does not participate in fat proliferation and apoptosis but affects the lipid metabolism process in mitochondria.

ACKNOWLEDGEMENTS

This research was funded by Sichuan Science and Technology Program (Grant NO. 2021YFYZ0031) and the Demonstration and Promotion of Ecological and Healthy Breeding Technology of High Quality Broilers in Tibetan Plateau (Grant NO. 2021ZHFP0163).

REFERENCES

• Alannan M, Fayyad-Kazan H, Trézéguet V, Merched A. Targeting lipid metabolism in liver cancer. Biochemistry 2020;59(41):3951-64.
• Aaslyng MD, Meinert L. Meat flavour in pork and beef-From animal to meal. Meat Science 2017;132:112-117.
• Chirala SS, Wakil SJ. Structure and function of animal fatty acid synthase. Lipids 2004;39(11):1045-53.
• Dai J, Liang K, Zhao S, Jia W, Liu Y, Wu H, et al. Chemoproteomics reveals baicalin activates hepatic CPT1 to ameliorate diet-induced obesity and hepatic steatosis. Proceedings of the National Academy Science USA 2018; 26;115(26):E5896-E5905.
• Gobin S, Bonnefont JP, Prip-Buus C, Mugnier C, Ferrec M, Demaugre F, et al. Organization of the human liver carnitine palmitoyltransferase 1 gene (CPT1A) and identification of novel mutations in hypoketotic hypoglycaemia. Human Genetcis 2002;111(2):179-89.
• Jayasena DD, Ahn DU, Nam KC, Jo C. Flavour chemistry of chicken meat: a review. Asian-Australasian Journal of Animal Sciences, 2013;26(5):732-42.
• Joshi M, Kim J, D'Alessandro A, Monk E, Bruce K, Elajaili H, et al. CPT1A over-expression increases reactive oxygen species in the mitochondria and promotes antioxidant defenses in prostate cancer. Cancers (Basel) 2020;12(11):3431.
• Kohjima M, Enjoji M, Higuchi N, Kato M, Kotoh K, Yoshimoto T, et al. Re-evaluation of fatty acid metabolism-related gene expression in nonalcoholic fatty liver disease. International Journal of Molecular Medicine 2007;20(3):351-8.
• Lai CQ, Parnell LD, Smith CE, Guo T, Sayols-Baixeras S, Aslibekyan S, et al. Carbohydrate and fat intake associated with risk of metabolic diseases through epigenetics of CPT1A. American Journal of Clinical Nutrition 2020;112(5):1200-11.
• Li JJ, Yang C, Ren P, Lin Z, Zhang D, Jiang X, et al. Transcriptomics analysis of Daheng broilers reveals that PLIN2 regulates chicken preadipocyte proliferation, differentiation and apoptosis. Molecular Biology Reproduction 2021;48(12):7985-97.
• Li L, Chu X, Yao Y, Cao J, Li Q, Ma H. (-)-Hydroxycitric acid alleviates oleic acid-induced steatosis, oxidative stress, and inflammation in primary chicken hepatocytes by regulating AMP-Activated Protein Kinase-mediated reactive oxygen species levels. Journal of Agricultural and Food Chemistry 2020;68(40):11229-41.
• Lin CW, Peng YJ, Lin YY, Mersmann HJ, Ding ST. LRRK2 regulates CPT1A to promote β-oxidation in hepG2 cells. Molecules 20209;25(18):4122.
• Liu Y, Shi W-R, Hong Z-F, Zheng H-Y, Li Y. Effect of free fatty acids on long-chain acyl-CoA synthetase 1 expression level and lipid metabolism in liver cells. Acta Nutrimenta Sinica 2013;35(3):232-40.
• Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25:402-408.
• Luo W, Li G, Yi Z, Nie Q, Zhang X. E2F1-miR-20a-5p/20b-5p auto-regulatory feedback loop involved in myoblast proliferation and differentiation. Scientific Reports 2016;6:27904.
• Matsushita Y, Nakagawa H, Koike K. Lipid metabolism in oncology: why it matters, how to research, and how to treat. Cancers 2021;13(3):474.
• Mir NA, Tyagi PK, Begum J, Dev K, Mandal AB. Growth performance, tissue lipid composition and metabolism, health indices, and serum lipid chemistry of broiler chicken in response to dietary flaxseed and chromium. Letters in Animal Biology 2021; 1(1).
• Morash AJ, Mccelland GB. Regulation of carnitine palmitoyl transferase (CPT) I during fasting in rainbow trout (Oncorhynchus mykiss) promotes increased mitochondrial fatty acid oxidation. Physiological and Biochemical Zoology 2011;84(6): 625-33.
• Nakamura M, Sadoshima J. Cardiomyopathy in obesity, insulin resistance and diabetes. Journal of Physiology 2020;598(14):2977-93.
• Ni B, Farrar JS, Chen S, Lownik JC, Celi FS. A novel role for PTK2B in cultured beige adipocyte differentiation. Biochemical and Biophysical Research Communications 2018;501(4):851-7.
• Pang W, Wang Y, Wei N, Xu R, Xiong Y, Wang P, et al. Sirt1 inhibits akt2-mediated porcine adipogenesis potentially by direct protein-protein interaction. PLoS One 2013;8(8):e71576.
• Park EA, Cook GA. Differential regulation in the heart of mitochondrial carnitine palmitoyltransferase-I muscle and liver isoforms. Molecular and Cellular Biochemistry 1998:180(1-2): 27-32.
• Ren J, Tian W, Jiang K, Wang Z, Liu X. Global investigation of estrogen-responsive genes regulating lipid metabolism in the liver of laying hens. BMC Genomics 2021; 22(1):428.
• Schlaepfer IR, Joshi M. CPT1A-mediated fat oxidation, mechanisms, and therapeutic potential. Endocrinology 2020;161(2):bqz046.
• Shin ES, Cho SY, Lee EH, Lee SJ, Chang IS, Lee TR. Positive regulation of hepatic carnitine palmitoyl transferase 1A (CPT1A) activities by soy isoflavones and L-carnitine. European Journal of Nutrition 2006;45(3):159-64.
• Song S, Yuan L, Zhang X, Hayat K, Chen H, Liu F, et al. Rapid measuring and modelling flavour quality changes of oxidised chicken fat by electronic nose profiles through the partial least squares regression analysis. Food Chemistry 2013;141(4):4278-88.
• Sohaib M, Anjum FM, Arshad MS, Imran M, Imran A, Hussain S. Oxidative stability and lipid oxidation flavoring volatiles in antioxidants treated chicken meat patties during storage. Lipids Health Diseases 2017;16(1):27.
• Van der Leij FR, Huijkman NC, Boomsma C, Kuipers JR, Bartelds B. Genomics of the human carnitine acyltransferase genes. Molecular Genetcis and Metabolism 2000;71(1-2):139-53.
• Sun W, Nie T, Li K, Wu W, Long Q, Feng T, et al. Hepatic CPT1A facilitates liver-adipose cross-talk via induction of FGF21 in mice. Diabetes 2021;db210363.
• Zammit VA. Carnitine palmitoyltransferase 1: central to cell function. IUBMB Life 2008;60(5):347-54.
• Zhang YF, Yuan ZQ, Song DG, Zhou XH, Wang YZ. Effects of cannabinoid receptor 1 (brain) on lipid accumulation by transcriptional control of CPT1A and CPT1B. Animal Genetics 2014;45(1):38-47.
• Zhang M, Li DH, Li F, Sun JW, Jiang RR, Li ZJ, et al. Integrated analysis of MiRNA and genes associated with meat quality reveals that Gga-MiR-140-5p affects intramuscular fat deposition in chickens. Cellular Physiology & Biochemistry 2018;46:2421-33.
• Zhong J, Lei R, Zhong Q. Irbesartan alleviates steatosis in LO2cells by promoting autophagy via PPAR-? mediated AMPK/mTOR pathway. Tianjin Medical Journal 2020;48(10):936-41.

Publication Dates

• Publication in this collection
  08 Aug 2022
• Date of issue
  2022

History

• Received
  11 Feb 2022
• Accepted
  09 May 2022