SciELO - Scientific Electronic Library Online

vol.43 issue1Epstein-Barr virus-associated gastric carcinoma in Brazil: comparison between in situ hybridization and polymerase chain reaction detectionProbiotic features of two oral Lactobacillus isolates author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand



Related links

  • On index processCited by Google
  • Have no similar articlesSimilars in SciELO
  • On index processSimilars in Google
  • uBio


Brazilian Journal of Microbiology

Print version ISSN 1517-8382

Braz. J. Microbiol. vol.43 no.1 São Paulo Jan./Mar. 2012 



Cloning of a novel xylanase gene from a newly isolated Fusarium sp. Q7-31 and its expression in Escherichia coli



Zhan-Ling XieI,II,*; Hai-Yan GaoII; Qian ZhangII; Huan WangII; Ying LiuI

IGansu Agricultural University, Lanzhou 730000, China
IIQinghai University, Xining 810016, China




A strain of Q7-31 was isolated from Qinghai-Tibet Plateau and was identified as Fusarium sp. based on its morphological characteristics and ITS rDNA gene sequence analysis. It has the highest capacity of degrading cell wall activity compared with other 11 strains. To do research on its xylanase activity of Fusarium sp. Q7-31 while the degrading the rice cell walls, the complete gene xyn8 that encodes endo-1, 4-β-xylanase secreted by Fusarium sp. Q7-31 was cloned and sequenced. The coding region of the gene is separated by two introns of 56bp and 55bp. It encodes 230 amino acid residues of a protein with a calculated molecular weight of 25.7 kDa. The animo acids sequence of xyn8 gene has higher similarity with those of family 11 of glycosyl hydrolases reported from other microorganisms. The nature peptide encodeing cDNA was subcloned into pGEX5x-1 expression vector. The recombinant plasmid was expressed in Escherichia coli BL21-CodonPlus (DE3)-RIL, and xylanase activity was measured. The expression fusion protein was identified by SDS-PAGE and Western blotting, a new specific band of about 52kDa was identified when induced by IPTG. Enzyme activity assay verified the recombinants proteins as a xylanase. A maxium activity of 2.34U/ mg, the xylanase had optimal activity at pH 6.0 and temperature 40ºC .

Key words: xylanase; Gene cloning; Fusariumsp.;




Fusarium sp., which is a cosmopolitan soil borne filamentous fungus, is an anamorphic species. Some of them can produce several enzymes that can act on pectin and cellulose components of cell wall (5). Recently, scientists pay more attention to them because some strains from Fusarium oxysporum can ferment cellulose into bioethanol by one step (22).

Endo-β-1,4-xylanases(EC are secreted by a number of plant pathogenic fungus. Walton (24) described that those xylanses may play a role during infection. Fusarium sp. also secrets a number of xylanases, at least five xylanases, Xyl1, Xyl2, Xyl3, Xyl4, Xyl5, xylanase of low molecular weight have been found from Fusarium sp. (1,2,3,4,5,6,8,9,10,14,15), from xyl1 to here, we reported a new xylanase gene from Fusarium sp. Q7-31.

Supported by National Natural Science Foundation of China to Xie Zhan-Ling (Grant No. 30960014), and supported by state Key Laboratory Breeding Base for innovation and utilization of plateau crop germplasm of China to Xie Zhan-Ling (Grant No. 2011-05)




PCR Purification Kit, DNA Gel Extraction Kit, RNA PCR Kit (AMV) Ver. 3.0, IPTG, X-gal, Taq polymerase, restriction enzymes were purchased from the TaKaRa Bio-technology (Dalian, China) Co. Ltd., M-MLV reverse transcriptase was the product of Promega (Madison, WI). The SMARTTM PCR cDNA Synthesis Kit was purchased from ClonTech (Palo Alto, CA). Trizol reagent and culture media were obtained from Invitrogen and Shanghai Sangon Co., Ltd., respectively. All other chemicals were of analytical grade. GST Monoclonal Antibody, Secondary Antibody and DAB Horseradish Peroxidase Color Development Kit were purchased from Sigma-Aldrich Co. Ltd.

Isolation of Fusarium sp. Q7-31

Fusarium sp. Q7-31 were isolated from fruiting bodies of Morchella sp. and screened to pure isolates through a series of subcultures on agar plates. The screening medium consisted of 0.6% peptone, 0.1% K2HPO4, 0.05% MgSO4•7H2O, and 1% glucose (pH 7.0). The plates were incubated at 28ºC for 3 to 5 d. Colonies that grew well were then subcultured to fresh agar plates. A loop-full of hyphae was removed from uniform colonies and inoculated into a basic liquid medium (BLM) with the same composition as the screening medium. These liquid cultures were maintained at 28ºC on a rotary shaker with 100×g. For storage, the fungus strains were inoculated on potato dextrose agar (PDA) plates and kept at 4ºC.

Screening Fusarium sp. Q7-31 as producing xylanase from 11 strains

Among the 11 strains screened, based on its crude enzyme stability as well as its high activity. Loop-full of hyphae from each strain was inoculated in 50 mL of BLM, with 1% glucose as a carbon source. After culturing to saturation, about 50 L was transferred to 5 mL of BLM containing 0.3% rice plant powder and cultured at 28ºC . On Days 3 and 6, the amounts of reducing sugars per milliliter of each culture medium were measured according to the dinitrosalicylic acid (DNS) method and compared among the 18 strains.

Strains and cultivations

The other 17 fungal strains (A, Morchella sp. M-1; B, Fusarium sp. Q7-31; C, Pestalotiopsis sp.; D, Fusarium sp. Q7-21; E, Trichoderma sp.; F, Penicillium sp.; G, Mucor sp. U-1; H, Fusarium sp. F-2; I, Geotrichum sp.; J, Morchella sp. M-2; K, Morchella sp. M-3) were stored in our Lab. The screening medium consisted of 0.6% peptone, 0.1% K2HPO4, 0.05% MgSO4•7H2O, and 1% glucose (pH 7.0). The induced medium, producing xylanases, was composed of xylan 1%, NaNO3 0.8%, K2HPO4 0.1%, MgSO4·7H2O 0.05%, KCl 0.05%, FeSO4·7H2O 0.001%; and the pH was 4.5. Erlenmeyer flasks (150 ml) containing 50ml medium were inoculated at 25ºC shaking for 4 days.

Fusarium sp. Q7-31 was used as a source of xylanase and as a RNA and DNA donor strain. E. coli DH5αand E. coli BL21-CodonPlus (DE3)-RIL (Novagen, USA) were used as the hosts for cloning DNA sequencing and expression, respectively. pMD18-T and pGEX5x-1 vectors for cloning of PCR products were purchased from TaKaRa Biotechnology Co.

DNS method to determine total reducing sugars

Contents of reducing sugars in the liquid cultures and assay solutions were determined per the DNS method, with minor modification from the procedures described (17,18,19). The DNS reagent consisted of 0.5% DNS, 0.025% sodium bisulfite, 0.5% NaOH, 0.1% phenols, and 2.5M KOH. Mixtures of either 0.5 mL of fungus culture or enzyme reaction solution plus 0.1 mL of reagent were incubated for 10 min in boiling water. The total volume was brought to 1 mL by adding 0.4 mL of distilled water prior to reading Spectrophotometric absorbance at 575 nm.

Identification of strain Fusarium sp. Q7-31

The identification of the strain was based on standard morphological characterization and nucleotide sequence analysis of enzymatic amplified ITS rDNA, and the internal transcribed spacer (ITS) region including 5.8 S rDNA. Mycelia grown for 5 d on PDA plates were used for morphological measurements, such as hyphal width, spore formation, and spore shape. Genomic DNA was extracted from these mycelia by the CTAB method (25). ITS DNA was amplified by PCR with ITS5 forward primer 5'-GGAAGTAAAAGTCGTAACA AGG-3' and ITS4 reverse primer 5'-TCCTCCGCTTATTGAT ATGC-3', according to the procedure described by Van Burik (23). Sequences of the PCR products (Accession Number FJ646593) were analyzed through the NCBI BLAST database.

Preparation of total RNA, Genomic DNA of Fusarium sp.Q7-31

Mycelia of Fusarium sp.Q7-31, grown as previously described in the induced medium were collected by centrifugation at 3500×g for 10 min. To 100 mg wet weight of pellet, 1ml Trizol was added in an adequate tube. The pellet was homogenized for 3-5min, and then let it strand at room temperature for 5 min. then 0.2 ml chloroform was added to the tube and the tube was subjected to vigorous vortex for 15s. The mixture was centrifuged at 12,000×g for 15min at 4ºC .The supernatant was collected and kept at room temperature for 10 min. RNA was recovered by centrifuged at 12,000×g for 10min at 4ºC and washed twice with 75% ethanol. The RNA was kept at -80ºC in 75% ethanol for long-term storage. For the reverse transcription, the RNA pellet was air dried and dissolved in RNase-free water extracted using. RNA concentration was checked using spectrophotometer. Then isolate mRNA using Promega Large-Scale PolyA Tract System. Concentrate the mRNA with 3M sodium acetate and isopropanol. cDNA synthesis was carried out with cDNA synthesis kit. Preparation of genomic DNA was carried out according to CTAB method (21, 25).

Primers for PCR amplification

Two pairs of degenerated primer, F1 [GGCAACTTCGTCGGTGGTAAG], R1 [CAGTAGCCACGATCTGGTAGT], F2 [AACTTCGTCGGTGGTAAGGGT], R2 [AGTAACCCTCAGTAGCCACG], were designed according to eight different species organism of xylanases genes (Table 2). Primer OT (Original name, oligo dT-M13 primer M4) was provided by TaKaRa RNA PCR Kit (AMV) Ver. 3.0. Primers RA [TACCTGGGTTCCATCCCTT] and RB [TCCCTTACCACCGACGAAGT] were used for Q7-31 5'RACE of xyn8 cDNA. Primer OF [ATGGTCTCCTTCAGGTTCCTTCTC] and OR [ATTAGATTGTAGATA CAAGTCGTT] were used for amplification of the genomic DNA encoding xyn8.



Reverse transcription of cDNA

For cloning of partial cDNA by using degenerated primers, the total RNA was reverse transcribed with AMV reverse transcriptase by using primer OT. For cloning the 5-end of the xyn8 cDNA, reverse transcription was performed with the SMART PCR cDNA Synthesis Kit with M-MLV reverse transcriptase. The RB primer was added to the reaction solution after the end of reverse transcription and incubated at 42ºC for another 10min so that the derived cDNA moleculers could have RB primer sequence at their 3-end. All the reverse transcription reactions were performed following instructions provided by the manufacturers.

DNA manipulation and E. coli transformation

Digestion of DNA with restriction endonucleases EcoRⅠ and SalⅠ, separation of fragments by agarose gel electrophoresis, ligation of DNA fragments, transformation of E.coli with plasmidic DNA and extraction of recombinant DNA were all performed according to the standard method (16). DNA fragments were recovered from agarose gels using the DNA Gel Extraction Kit of TaKaRa.

DNA sequence analysis

Products of the PCR reaction were cloned into pMD18-T Simple Vector (TaKaRa) and sequenced by Invitrogen (Shanghai, China) Co., Ltd 16. The sequence was analyzed using the software package DNAMAN 5.0 (Lynnon Bio-oft, USA) and the homology was analyzed in GenBank with the BLAST program. Properties of translated proteins based on the primary structure analysis were predicted using on-line programs.

Nucleotide sequence accession number

The cDNA sequence of xyn8 gene has been deposited in the GenBank database under accession numbers GQ249383 and ITS nucleotide sequence number is FJ646593.

xyn8 expression and purification

The cDNA fragment encoding the peptide of xylanase was amplied with OF and OR. The DNA fragment was ligated into pGEX5x-1 with restriction sites of Eco R I and Sa l I to generate construct pGEX5x-1-xyn8. The expression construct was used to transform E.coli BL21-CodonPlus(DE3)-RIL for expression with the plasmid pGEX5x-1 for control. The transformants were screened on Luria-Bertani (LB) broth supplemented with 100 μg/ml Ampicillin and cultured with shaking at 37ºC overnight. Two microliters of seed culture were transferred into fresh medium and cultured until OD600 reached 0.8, and IPTG (final concentration 0.4mM) was added for induction. The bacterial cells were cultured for another 2h before collection by centrifuge. SDS–PAGE was applied for confirmation of the expressed product.

After growth in liquid medium, cells were harvested by centrifugation, washed with cold 1xPBS buffer(137mM NaCL, 2.7mM KCL, 10mM Na2HPO4, 2mM KH2PO4; pH 6.0), and suspended in 20ml of cold PBS buffer. Cells were homogenized by ultrasonic treatment. Supernatant was obtained by centrifugation at 12,000 ×g for 10min at 4ºC. The supernatant was used as crude enzyme for xylanase assay.

SDS–PAGE and western blotting

SDS–PAGE was performed on a 12.5% running gel (12) and resolved proteins were visualized by stainng with Coomassie Brilliant Blue G 250.

Transfer the proteins from the gel to a PVDF membrane, and incubate with GST Monoclonal Antibody (1:1000) for a night at 4ºC . Decant and discard the antibody-buffer, rinse twice with 20-30 ml of wash buffer to remove the majority of unbound antibody. Dilute secondary antibody 1:1000 with incubation buffer. Incubate for 1 hour at ambient temperature with gentle shaking. Wash the membrane with 20-30 ml of wash buffer for 10 minutes at ambient temperature with gentle shaking. Detect the result by DAB Horseradish Peroxidase Color Development Kit.

Determination of protein concentration

Protein was determined by the Bradford assay (2) using bovine serum albumin as a standard.

Xylanase activity assays

Xylanase activity was measured using 1% (w/v) birchwood xylan (Sigma, USA) as a substrate in 50mM Na2HPO4–citric acid buffer, pH 6.0, at 40ºC for 10min. The liberation of reducing sugars was estimated by the dinitrosalicylic acid (DNS) method (13) using xylose as a standard. Reducing sugars were determined by measuring the absorption at 540 nm relative to a D-xylose standard. One unit of enzyme activity was defined as the quantity of enzyme required to liberate 1μmol of xylose equivalent per minute at 40ºC, and specific activity was defined as units per mg protein (20). The results were means of duplicate determination on triple independent measurements.

Temperature optimum and thermostability

The temperature optimum was measured by performing the xylanase activity assay for 20min at temperatures ranging from 15°C to 70°C under pH 6.0 (Na2HPO4–citric acid buffer). The thermostability of xylanase was investigated at temperatures 15ºC, 20ºC , 30ºC , 40ºC , 50ºC , 60ºC and 70ºC after incubation of the enzyme solutions in absence of substrate for 5min, 10min, 20min, 30min,40min, 50min, 60min, respectively. Residual activities were determined under xylanase activity assay conditions.

pH optimum and stability

The effect of pH on xylanase activity was evaluated (7) at the optimal temperature over a pH range of 3.0–10.0, using appropriate buffers (50mM): Na2HPO4-citric acid buffer (pH 3.0-6.0), NaH2PO4–Na2HPO4 buffer (pH 6.0-8.0) and Tris-Hcl buffer (pH 8.0-9.0), glycin-NaOH (pH9.0-10.0) under xylanase activity assay conditions. Further study on the pH stability of the recombinant xylanase was carried out at 4°C by pre-incubation of the enzyme solutions in the aforementioned buffer systems in the absence of substrate at 4°C for 1 h. The pH values of various reaction solutions were adjusted to pH 6.0. Then they were subjected to xylanase activity assay.



Isolation and identification of strain Fusarium sp. Q7-31

Classification of the strain Q7-31 to a species of the genus Fusarium was manifested by analyses of its morphological features such as width and growth habit of mycelia and ITS sequences. Mycelia of Q7-31 grew vigorously to reach about 6 cm in diameter in 7 days on agar plates containing 0.3% rice plant powder as the sole carbon source. Mycelia of the strain Q7-31 typically appeared as white dry feathery villiform throughout the colony (Fig. 1A). They consisted of filamentous hyphae with septa (Fig. 1B). To determine growth rate of the strain Q7-31, its hyphae was inoculated on the center of basal medium agar plates containing 0.3% of rice powder and cultured at 28ºC . The colony diameter reached about 6 cm within 7 days of culture.

A genomic DNA region corresponding to the partial sequence of 18S ribosomal RNA gene, the internal transcribed spacer 1, the 5.8S ribosomal RNA gene, the internal transcribed spacer 2, and the partial sequence of 28S ribosomal RNA gene was amplified by PCR using the genomic DNA isolated from the strain Q7-31 as a template. The sequence information of the PCR product was used for BLAST search in the NCBI databases. The BLAST result showed that the analyzed DNA region of Q7-31was 99% identical to those of a few strains of Fusarium, Gibberella, and Cordyceps (Fig. 2). Considering of the morphological features and molecular analysis together, we classified Q7-31 as a strain of Fusarium species and deposited it to the Chinese Governmental Microorganism Conservation Center that complies with the Budapest Contract (or Protocol) on October 14, 2008 (deposition No: CGMCC2710).

Selecting of strains Fusarium sp. Q7-31 producing xylanase

Liquid cultures of total 11 fungus strains including Fusarium sp. Q7-31 with rice plant powder exhibited different degree of turbidity, reflecting difference in degradation of the powder (Fig. 3), including Q7-31 strains in Fig. 3(A) through (E) actively degraded the powder to a colloidal state, whereas the powder remained as unchanged granules in the cultures of strains in Fig. 3(I), (J), and (K). Cultures of some strains, i.e., Fig. 3(F), (G), and (H), formed relatively large white aggregates of hyphae and partially digested plant powder. In addition to its culture appearance, the strain Q7-31 produced the highest levels of reducing sugars in both 3- and 6-day-old cultures among the strains, of which cultures became turbid within 3 days (Table 1). Comparison of reducing sugar contents, especially, in 6-day-old cultures distinguished the strain Q7-31 from other strains tested. Based on these results, we selected the strain Q7-31 for further characterization with respect to xylanase gene (Table 2).

Cloning of cDNA encoding the xyn8 of F. sp Q7-31

For the first step, we tried to obtain a partial cDNA sequence of the xyn8 starting from primer we had. Two degenerated primers were synthesized corresponding to the conserved parts of the several amino acid residues. Primer OT was used as the primer for reverse transcription of the first-strand cDNA from total RNA. The first-strand cDNA was used as the template for amplification with primers F1/R1 and F2/R2. A 450-bp DNA fragment band was amplified. This band was agarose gel-purified and cloned into pMD18-T Simple Vector. The nucleotide sequence was subsequently determined. The insert was 450bp in length and consisted of partial xyn8 cDNA and 31 bp of primer OT.

Next, we moved on to obtain the full-length cDNA of the xyn8 by a modified 5'RACE approach based on the characteristics of M-MLV reverse transcriptase (23). After reverse transcription, the cDNA was used as the template for PCR amplification with primers RB and RA. A fragment was obtained as the major PCR product. The PCR products were cloned into pMD18-T Simple Vector and the nucleotide sequence was subsequently determined. By aligning the nucleotide sequence of the two fragments, the full-length cDNA of the xylanase of 693bp was obtained (Fig. 4).

The coding sequence consisted of a 230 amino acids xyn8 with a calculated molecular mass of 25.7 kDa. These features are in good agreement with the molecular mass determined by SDS–PAGE.

Cloning of the xyn8 gene

To confirm the identity of the cDNA of the xyn8, effort was made to clone the genomic DNA of the xyn8 gene. The xyn8 gene was amplified from genomic DNA of F. sp Q7-31, with primers OF and OR. The sequence of the 804-bp DNA fragment contained the complete nucleotide sequence of the cDNA with two short intervenings by two introns of 56bp and 55bp as indicated in Fig.5 and Fig.6.

DNA sequence analysis of the xyn8 gene

The predicted peptide consisted of 230 amino acids with the theoretical M.W. of 25.7 kDa. Amino acid homology alignment of the predicted Xyn8 with other four xylanases from Fusarium oxysporum f. sp., Glomerella graminicola, Verticillium dahliae, Verticillium albo-atrum was carried out (Fig. 7). The identities between F. sp. Q7-31 with F. oxysporum f. sp (AAK 27975.1), Glomerella graminicola (EFQ30380.1), Verticillium dahliae (ABE02800.1), V. albo-atrum (XP_003006739.1) were 87%, 78%, 74%, 74%, respectively.

The phylogenetic analysis of the xylanases included 25 known different amino acid sequences of xylanase and was complied using the data base(Fig.8). The phylogenetic tree of the xylanases was then constructed by MEGA 3.1, as shown in Fig. 9. According to this phylogenetic tree, the Xyn8 is genetically closely related to the hypothesis protein of Gibberella zeae (89%), and xylanase F. oxysporum (87%). We found that the topology of the evolutionary tree of the Xyn8 is quite similar to that of the other GHF 11 xylanases, so that the Xyn8 should be classified into the family 11 glycosyl hydrolases.

Expression of Xyn8 in E. coli

To further test if the cloned sequence truly represents F. sp. Q7-31. Primers OF and OR were applied to amplify the peptide encoding cDNA with adequent restriction enzyme sites so that the cDNA could be inserted into expression vector pGXE5x-1 in the right reading frame. Because of the presence of the GST-tag fusion peptide in expression vector pGXE5x-1, the recombinant protein had a 26 kDa peptide. As shown in Fig. 9(A), an efficiency of Xyn8 protein expression was achieved with pGXE5x-1. The recombinant protein showed a M.W. of about 52 kDa which was close to the theoretical value.

Western blotting and SDS–PAGE showed that the cell extracts from E. coli BL21CodonPlus(DE3)-RIL harboring pGXE5x-1-xyn8 exhibited a clear band with a molecular weight about 52kDa (Fig. 9, A-Lane2- 5, B-Lane 2), which was a fusion hybrid protein and has the same size as estimated from the deduced amino acid sequence of the fusion region in pGXE5x-1-xyn8. The expression of the solubility fusion hybrid protein could be induced by IPTG. A maximum activity of 2.34U/ mg was obtained from cellular extract of E. coli BL21-CodonPlus (DE3)-RIL harboring pGXE5x-1-xyn8 (Table 3). These predictions are consistent with experimental data previously obtained from the GST-Xyn8 fusion protein (7).

Properties of Xyn8

From the pH profile, the pH for optimal activity of Xyn8 was determined to be pH 6.0, with 50% of maximum activity being retained between pH 5.8 and pH 9.0 (Table 3). The apparent optimal temperature for enzyme activity at pH 6.0 was 40ºC. Crude xylanase from Q7-31 was used to evaluate its biochemical properties.



The Qinghai–Tibet Plateau is located in east Asia and represents a unique permafrost environment, being a result of high elevation caused by land uplift. However, its microbiology remains largely unexplored to date. Zhang G reported that the total 33 analyzed isolates from Qinghai-Tibet Plateau, 9 isolates related to 8 genera might be new taxa, it suggested that the Qinghai-Tibet Plateau permafrost region is a specific ecologic niche that accommodates an original microbial assemblage (11, 27). Yu-Qin Zhang (26) reported there was abundant actinobacterial species diversity in the soil samples from the Qinghai–Tibet plateau, including xylanase-producing microorganisms (2010). No xylanase-producing fungi have been reported in the Qinghai–Tibet plateau. In this study, we isolated and identified a xylanse-producing strain of Fusaurium sp.Q7-31 from a morchella fruiting body in the Qinghai–Tibet plateau. The ITS rDNA sequence of Fusaurium sp.Q7-31 showed high identity with  Fusarium oxysporum, there are reports on xylanses produced by Fusarium oxysporum(), while the gene Xyn8 from Fusaurium sp.Q7-31 is deferent from other reports. The gene Xyn8 from Fusaurium sp.Q7-31 encodes a GHF11 xylanse. 

Xyn8 has relatively the highest sequence identity to Xyl5 (87%) from F. oxysporum (5), but the properties of these two enzyme are distinct. Xyl5 resulting from differential splicing of the third intron, while Xyn8 resulting from differential splicing of the second intron.

The cloning of a novel gene depends largely on the combination of DNA library construction and the screening of genes. Various methods have been developed to amplify the process, such as screening of an expression DNA library or genomic DNA library with antibodies or detecting specific enzyme activity of the target protein; however, all the present methods are still time-consuming and laborious.

In this work, cloning the cDNA and the gene of the Xyn8 from F. sp Q7-31 were achieved by using three steps of PCR. The first step was to use degenerated primers for amplification of cDNA. The second step was to obtain the full-length cDNA by a modified 5, RACE approach. The third step was to obtain the introns sequence in genomic DNA corresponding to the full-length cDNA. It has been reported that the xylanases can be divided into two major families based on their 3D structures, GHF 10 and GHF 11. From the prediction of tertiary structure, we found that the 3D structure of the Xyn8 of F. sp. Q7-31 was mostly similar to some xylanases of GHF 11. Therefore, we concluded that Xyn8 belonged to the family 11 glycosyl hydrolases.

The favorable properties of Xyn8, such as high activity over a wide temperature range and so on, make this xylanase promising for various applications in the biofuel industries.



Project was supported by the china National Science Foundation (30860048). This research was supported by Professor Ge Rili and Liu Yujiao who both come from Qinghai University. We also should thank the station master Shen Zhixin.



1. Alconada TM, Martínez MJ. (1994). Purification and characterization of an extracellular endo-1,4-beta-xylanase from Fusarium oxysporum f. sp. melonis. FEMS Microbiol Lett. 15;118(3):305-10.         [ Links ]

2. Bradford, M.M. (1976). A rapid sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248–254.         [ Links ]

3. Christakopoulos P, Nerinckx W, Kekos D, Macris B, Claeyssens M. (1997). The alkaline xylanase III from Fusarium oxysporum F3 belongs to family F/10 Aug 7;302(3-4):191-5. Carbohydr Res.         [ Links ]

4. Christakopoulos, P.; Nerinckx, W.; Kekos, D.; Macris, B.; Claeyssens, M. (1996). Purification and characterization of two low molecular mass alkaline xylanases from Fusarium oxysporum F3. Journal of Biotechnology. 51: 181-189.         [ Links ]

5. Esperanza Gómez-Gómez, M.C.; Isabel, G.; Roncero. (2001). Molecular characterization of a novel endo-β-1, 4-xylanase gene from the vascular wilt fungus Fusarium oxysporum. Current Genetics. 40: 268-275.         [ Links ]

6. Esperanza Gómez-Gómez, M.C.; Ruiz-Roldan, A.; Di Pietro, M.I.G.; Roncero.; Hera, C. (2002). Role in Pathogenesis of Two Endo-β-1, 4-xylanase Gene from the Vascular Wilt fungus Fusarium oxysporum. Fungal Genet Biol. 35, 213-222.         [ Links ]

7. Fu, D.D.; Li, A.J.; Xie, H.; Wu, M.C. (2006). Purification and properties of xylanase from Aspergillus usamii. Food. Sci. 27, 116–120.         [ Links ]

8. Gómez-Gómez E, Isabel M, Roncero G, Di Pietro A, Hera C. (2001) Molecular characterization of a novel endo-beta-1,4-xylanase gene from the vascular wilt fungus Fusarium oxysporum. Curr. Genet. 40 (4), 268-275.            [ Links ]

9. Gómez-Gómez E, Ruíz-Roldán MC, Di Pietro A, Roncero MI, Hera C. (2002) Role in pathogenesis of two endo-beta-1,4-xylanase genes from the vascular wilt fungus Fusarium oxysporum. Fungal Genet Biol. Apr;35(3):213-22.         [ Links ]

10. Jorge I, de la Rosa O, Navas-Cortés JA, Jiménez-Díaz RM, Tena M. (2005) Extracellular xylanases from two pathogenic races of Fusarium oxysporum f. sp. ciceris: enzyme production in culture and purification and characterization of a major isoform as an alkaline endo-beta-(1,4)-xylanase of low molecular weight. Antonie Van Leeuwenhoek. Jul;88(1):48-59.         [ Links ]

11. Gaosen Zh., Xiaojun M., Fujun N., Maoxing D., Huyuan F., Lizhe A. and Guodong Ch. (2007). Phylogenetic diversity of bacteria isolates from the Qinghai-Tibet Plateau permafrost region. Canadian J. Microb.         [ Links ]

12. Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the head of  bacteriophage T4. Nature. 227: 680–685.         [ Links ]

13. Miller, GL. (1959). Use of dinitrosalicylic acid reagent for determination of reducing sugars. Anal. Chem. 31: 426-428.         [ Links ]

14. Ruiz Roldan, M.C.; Di Pietro, A.; Roncero, M.I.G. (1997). Purification and characterization of an acidic endo-β-1,4-xyalnase from the tomato vascular pathogen Fusarium oxysporum f.sp. lycopersici. FEMS Microbiol Lett. 148: 75-82.         [ Links ]

15. Ruiz Roldan, M.C.; Di Pietro, A.; Huertas Gonzalez, M.D.; Roncero M.I.G. (1999). Two xylanase genes of the vascular wilt pathogen Fusarium oxysporum are  differentially expressed during infection of tomato plants. Mol. Genet. 261: 530-536.         [ Links ]

16. Sambrook, J.; Fritsch, E.F.; Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, seconded. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.         [ Links ]

17. Sambrook, J.; Fritsch, E.F.; Maniatis, T. (2001). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.         [ Links ]

18. Sapag, A.; Wouters, J.; Lambert, C. (2002). The endoxylanases from family11: computer analysis of protein sequences reveals important structural and phylogenetic relationship. J. Biotechnol. 95, 109–131.         [ Links ]

19. Sengupta, S.; Jana, M.L.; Sengupta, D.; Naskar, A.K. (2000). A note on the estimation of microbial glycosidase activities by dinitrosalicylic acid reagent. Appl. Microbiol. Biot. 53: 732- 735.         [ Links ]

20. Shao, W.; Wiegel, J. (1992). Purification and characterization of a thermostable xylosidase from Thermoanaerobacter ethanolicus. J. Bacteriol. 174, 5848–5853.         [ Links ]

21. Van Burik, J.A.; Schreckhise, R.W.; White, T.C.; Bowden, R.A.; Myerson. D. (1998). Comparison of six extraction techniques for isolation of DNA from filamentous fungi. Med. Mycol. 36: 299- 303.         [ Links ]

22. Vallander, L.; Eriksson, K. E. L. (1990). Production of ethanol from lignocellulosic materials: State of the art.  Adv. Biochem. Eng. Biotechnol. 42: 63-95.         [ Links ]

23. Verma, I.M. (1977). Reverse transcriptase-The Enzymes. Academic Press, New York.         [ Links ]

24. Walton, J.D. (1994). Deconstructing the plant cell wall. Plant Physiol. 104: 1113-1118.         [ Links ]

25. Yang, G.L.; An, Q.; Li, J.; Lin, W.; Liu, L.; Lin, X. (2007). Genotyping of Trichophyton rubrum by analysis of ribosomal-DNA intergenic spacer regions. Mycopathologia. 164: 19- 25.         [ Links ]

26. Yu-Qin, Zh.; Hong-Yu, L.; Jie, Ch.; Li-Jie, Y.; Wei, S. (2010). Diversity of culturable actinobacteria from Qinghai-Tibet plateau, China. Antonie van Leeuwenhoek, 98, : 2, s: 213-223        [ Links ]

27. Zhang, G.; Niu, F.; Ma, X.; Liu, W.; Dong, M.; Feng, H.; An, L.; Cheng, G. (2007). Phylogenetic diversity of bacteria isolates from the Qinghai-Tibet Plateau permafrost region. Can J Microbiol. Aug;53(8):1000-10.         [ Links ]



Submitted: March 31, 2011; Returned to authors for corrections: May 06, 2011; Approved: August 30, 2011.



*Corresponding Author. Mailing address: 1 Gansu Agricultural University, Lanzhou 730000, China, 2 Qinghai University, Xining 810016, China.; E-mail: