SciELO - Scientific Electronic Library Online

 
vol.46 número3Quinolone resistance and ornithine decarboxylation activity in lactose-negative Escherichia coliAntioxidant capacity of several Iranian, wild and cultivated strains of the button mushroom índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

Links relacionados

Compartilhar


Brazilian Journal of Microbiology

versão impressa ISSN 1517-8382versão On-line ISSN 1678-4405

Braz. J. Microbiol. vol.46 no.3 São Paulo jul./set. 2015  Epub 21-Jul-2015

http://dx.doi.org/10.1590/S1517-838246320140138 

Medical Microbiology

Molecular characterization of multidrug-resistant Klebsiella pneumoniae isolates

Xiang-hua Hou1 

Xiu-yu Song2 

Xiao-bo Ma2 

Shi-yang Zhang3  4 

Jia-qin Zhang2  3 

1Department of Nephrology, the First Affiliated Hospital of Xiamen University, Xiamen, China.

2Department of Clinical Laboratory, the First Affiliated Hospital of Xiamen University, Xiamen, China.

3Nosocomial Infection Control Center of Xiamen, Xiamen, China.

4Department of Nosocomial Infection Control, the First Affiliated Hospital of Xiamen University, Xiamen, China.

ABSTRACT

Klebsiella pneumoniae is an important cause of healthcare-associated infections worldwide. Selective pressure, the extensive use of antibiotics, and the conjugational transmission of antibiotic resistance genes across bacterial species and genera facilitate the emergence of multidrug-resistant (MDR) K. pneumoniae. Here, we examined the occurrence, phenotypes and genetic features of MDR K. pneumoniae isolated from patients in intensive care units (ICUs) at the First Affiliated Hospital of Xiamen University in Xiamen, China, from January to December 2011. Thirty-eight MDR K. pneumoniae strains were collected. These MDR K. pneumoniae isolates possessed at least seven antibiotic resistance determinants, which contribute to the high-level resistance of these bacteria to aminoglycosides, macrolides, quinolones and β-lactams. Among these isolates, 24 strains were extended-spectrum β-lactamase (ESBL) producers, 2 strains were AmpC producers, and 12 strains were both ESBL and AmpC producers. The 38 MDR isolates also contained class I (28/38) and class II integrons (10/38). All 28 class I-positive isolates contained aacC1, aacC4, orfX, orfX’ and aadA1 genes. β-lactam resistance was conferred through blaSHV (22/38), blaTEM (10/38), and blaCTX-M (7/38). The highly conserved blaKPC-2 (37/38) and blaOXA-23(1/38) alleles were responsible for carbapenem resistance, and a gyrAsite mutation (27/38) and the plasmid-mediated qnrB gene (13/38) were responsible for quinolone resistance. Repetitive-sequence-based PCR (REP-PCR) fingerprinting of these MDR strains revealed the presence of five groups and sixteen patterns. The MDR strains from unrelated groups showed different drug resistance patterns; however, some homologous strains also showed different drug resistance profiles. Therefore, REP-PCR-based analyses can provide information to evaluate the epidemic status of nosocomial infection caused by MDR K. pneumoniae; however, this test lacks the power to discriminate some isolates. Thus, we propose that both genotyping and REP-PCR typing should be used to distinguish genetic groups beyond the species level.

Key words: Klebsiella pneumoniae ; multidrug resistance; molecular characterization

Introduction

Klebsiella pneumoniae has been medically recognized as one of the most important opportunistic pathogens, causing hospital-acquired and healthcare-associated pulmonary system, urinary tract, circulating system and soft tissue infections worldwide (Podschun and Ullmann, 1998). However, K. pneumoniae has become a clinically important micro-organism, particularly in last two decades due to its tendency to develop antibiotic resistance and cause fatal outcomes (Nordmann et al., 2009; Ko et al., 2002).

In recent years, K. pneumoniae has been identified as a major cause of community-acquired pneumonia (CAP) and is responsible for approximately 10% of all hospital-acquired infections, ranking second among Gram-negative pathogens (Nordmann et al., 2009). Studies performed in Asia have demonstrated that the fatality rate of K. pneumoniae-induced pneumonia in elderly people was 15% to 40%, equal to or even greater than that of Haemophilus influenzae (Molton et al., 2013). The production of extended-spectrum β-lactamases (ESBL) in this organism contributes to the emergence and dissemination of K. pneumoniae infections. Effective anti-infective drugs, such as aminoglycosides, fluoroquinolones, and carbapenems, have been used to treat ESBL-producing K. pneumoniae infections (Sanchez et al., 2013). In particular, the use of carbapenems against ESBL-producing Gram-negative micro-organisms poses a serious problem in the management of healthcare-associated infections because the abuse of antibiotics might lead to the emergence of carbapenem-resistant organisms. Notably, the selective pressure posed by the extensive use of antibiotics has facilitated the emergence of multidrug-resistant (MDR) K. pneumoniae. Furthermore, conjugational transmission of antibiotic resistance genes across bacterial species and genera has aggravated the problem of K. pneumoniae antibiotic resistance.

MDR K. pneumoniae was first reported in the United States, followed by Europe, South America, and Asia (Ko et al., 2002; Pfaller et al., 2001; Winokur et al., 2001; Yigit et al., 2001). At present, infections caused by MDR K. pneumoniae have become a major problem, as few antibiotics are available, resulting in higher morbidity, longer hospitalization, increased mortality rates, and excessive health care costs compared with infections associated with antibiotic-susceptible micro-organisms (Correa et al., 2013; Ma and Wang, 2013). However, the prevalence of antibiotic-resistant bacteria significantly varies according to region, country, and susceptible population, as the seriousness of this problem is significantly associated with the measures applied to control the spread of drug-resistant bacteria (Ko et al., 2002). The aim of this study was to characterize the drug resistance phenotypes and molecular antibiotic resistance mechanisms of MDR K. pneumoniae strains isolated from patients in intensive care units (ICUs). The relatedness of the strains was also investigated using the repetitive-sequence-based PCR (REP-PCR)-based DiversiLab system.

Materials and Methods

Bacterial identification and antimicrobial susceptibility testing

A total of 38 MDR K. pneumoniae strains were isolated from sputum, bronchial-alveolar perfusate, blood, intraperitoneal drainage, pleural drainage of patients and surfaces of objects (respirators, bedrails and bedclothes) in ICUs from January to December 2011. Thirty nosocomial infection strains were identified according to the Diagnostic Criteria for Nosocomial Infection established by the Ministry of Health of China. Five strains (K33, K34, K35, K36 and K37) were isolated from ventilators, two strains (K19 and K20) were isolated from bedrails, and one (K31) strain was isolated from bedclothes. Bacterial identification and antimicrobial susceptibility testing were performed using the Vitek2 semi-automated system with GN13 and AST13 cards (bioMérieux Inc., Durham, NC), respectively. The minimum inhibitory concentrations (MICs) for 28 antimicrobial agents for MDR isolates were confirmed using the broth microdilution method. In addition, polymyxin B and tigecycline susceptibilities were determined through Etests (bioMérieux Inc., Durham, NC). Multidrug resistance was defined as non-susceptibility to at least one agent in three or more antimicrobial categories according to the breakpoints recommended by the Clinical and Laboratory Standards Institute (CLSI), excluding tigecycline and polymyxin B. For these studies, K. pneumoniae ATCC 700603 and Pseudomonas aeruginosa ATCC 27853 were used as controls. Disks of cefotaxime (30 μg), cefotaxime/clavulanic acid (30/10 μg), ceftazidime (30 μg), and ceftazidime/clavulanic acid (30/10 μg) were used to confirm ESBL production of these K. pneumoniae isolates using the Double Disc Synergy Test (DDST) according to the recommendations of the CLSI. For the phenotypic identification of AmpC-producing isolates, the DDST was applied using disks containing ceftazidime (30 μg) and ceftazidime/3-aminophenylboronic acid (30/300 μg). A ≥ 5-mm enhancement of the zone of inhibition around the ceftazidime disk was considered AmpC-positive. The three-dimensional test was also used to confirm AmpC-producing isolates.

DNA extraction

Genomic DNA from MDR strains was prepared for PCR and genetic analysis using the UltraClean® Microbial DNA Isolation Kit (MO BIO Labs Inc., Solana Beach, CA) according to the manufacturer’s instructions. Briefly, MDR strains were grown to the desired optical density and were collected after centrifugation at 10,000 × g for 60 s. The bacterial cells were resuspended in bead solution and transferred to a bead-beating tube containing microbeads and proteinase K. Subsequently, the cells were lysed through mechanical disruption using a specially designed MO BIO Vortex Adapter on a standard vortex. The supernatant was loaded onto a Spin Filter mini column and washed twice with Wash buffer, and the genomic DNA was eluted with DNA-free Tris buffer.

Resistance determinants detection

The genes involved in the antibiotic resistance of MDR strains were screened through PCR assays as previously described (Perez-Perez and Hanson, 2002; Wen, 2010; Mak, 2009), except that the PCR conditions used to detect blaKPC and blaNDM-1, included a pre-denaturing step at 94 °C for 5 min, followed by 30 cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 60 s, with polishing at 72 °C for 10 min. The PCR products were purified using the QIAGEN Gel Extraction Kit (Qiagen Inc., Hilden, Germany) and were subjected to sequencing using the same primers used for PCR amplification. The resistance genes and the primers used in the present study are listed in Table 1.

Table 1 Primer sequences used in this study 

Primer Sequence Target gene Source or reference
KPC-F ATGTCACTGTATCGCCGTC bla KPC This study
KPC-R TTACTGCCCGTTGACGCC bla KPC This study
NDM-1-F TGCATTGATGCTGAGCGGGTG bla NDM-1 This study
NDM-1-R ATCACGATCATGCTGGCCTTG bla NDM-1 This study
IMP-F GGAATAGAGTGGCTTAAYTCTC bla IMP (Wen and Mi, 2010)
IMP-R CCAAACYACTASGTTATCT bla IMP (Wen and Mi, 2010)
VIM-F GATGGTGTTTGGTCGCATA bla VIM (Wen and Mi, 2010)
VIM-R CGAATGCGCAGCACCAG bla VIM (Wen and Mi, 2010)
EBC-F TCTATAAGTAAAACCTTCACCG bla EBC (Perez-Perez and Hanson, 2002)
EBC-R CCAGGTATGGTCCAGCTTGAG bla EBC (Perez-Perez and Hanson, 2002)
ACC-F AACAGCCTCAGCAGCCGGTTA bla ACC (Perez-Perez and Hanson, 2002)
ACC-R TTCGCCGCAATCATCCCTAGC bla ACC (Perez-Perez and Hanson, 2002)
FOX-F TTCGAGATTGGCTCGGTCAGC bla FOX (Perez-Perez and Hanson, 2002)
FOX-R CAAAGCGCGTAACCGGATTGG bla FOX (Perez-Perez and Hanson, 2002)
DHA-F AACTTTCACAGGTGTGCTGGGT bla DHA (Perez-Perez and Hanson, 2002)
DHA-R CCGTACGCATACTGGCTTTGC bla DHA (Perez-Perez and Hanson, 2002)
CIT-F TGGCCAGAACTGACAGGCAAA bla CIT (Perez-Perez and Hanson, 2002)
CIT-R TTTCTCCTGAACGTGGCTGGC bla CIT (Perez-Perez and Hanson, 2002)
TEM-F ACAGCGGTAAGATCCTTGAGAG bla TEM (Wen and Mi, 2010)
TEM-R GAAGCTAGAGTAAGTAGTTCG bla TEM (Wen and Mi, 2010)
SHV-F ACCTTTAAAGTAGTGCTCTGC bla SHV (Wen and Mi, 2010)
SHV-R CACCATCCACTGCAGCAGCTG bla SHV (Wen and Mi, 2010)
CTX-M-F ATGGTTAAAAAATCACTGCGYCAGTTC bla CTX-M (Wen and Mi, 2010)
CTX-M-R TCACAAACCGTYGGTGACGATTTTAGCCGC bla CTX-M (Wen and Mi, 2010)
OXA-F CTGTTGTTTGGGTTTCGCAAG bla OXA (Wen and Mi, 2010)
OXA-R CTTGGCTTTTATGCTTGATG bla OXA (Wen and Mi, 2010)
PER-F GCCTGACGATCTGGAACC bla PER (Wen and Mi, 2010)
PER-R GATACTGCACCTGATCATC bla PER (Wen and Mi, 2010)
VEB-F GCGTTATGAAATTTCCGATTG bla VEB (Wen and Mi, 2010)
VEB-R CAACATCATTAGTGGCTGCTG bla VEB (Wen and Mi, 2010)
GES-F ATGCGCTTCATTCACGCAC bla GES (Wen and Mi, 2010)
GES-R CTATTTGTCCGTGCTCAGG bla GES (Wen and Mi, 2010)
1Int-F ATCATCGTCGTAGAGACGTCGG Class I Integron (Wen and Mi, 2010)
1Int-R GTCAAGGTTCTGGACCAGTTGC Class I Integron (Wen and Mi, 2010)
2Int-F GCAAATAAAGTGCAACGC Class II Integron (Wen and Mi, 2010)
2Int-R ACACGCTTGCTAACGATG Class II Integron (Wen and Mi, 2010)
3Int-F GCAGGGTGTGGACGAATACG Class III Integron (Wen and Mi, 2010)
3Int-R ACAGACCGAGAAGGCTTATG Class III Integron (Wen and Mi, 2010)
qnrA-F ATTTCTCACGCCAGGATTTG qnrA (Mak JK, 2009)
qnrA-R GATCGGCAAAGGTTAGGTCA qnrA (Mak JK, 2009)
qnrB-F GATCGTGAAAGCCAGAAAGG qnrB (Mak JK, 2009)
qnrB-R ACGATGCCTGGTAGTTGTCC qnrB (Mak JK, 2009)
qnrS-F ACGACATTCGTCAACTGCAA qnrS (Mak JK, 2009)
qnrS-R TAAATTGGCACCCTGTAGGC qnrS (Mak JK, 2009)
strA-F ATGATGTCTAACAGCAAACTG strA (Mak JK, 2009)
strA-R TCAACCCCAAGTAAGAGG strA (Mak JK, 2009)
strB-F ATGGGGTTGATGTTCATGCCGC strB (Mak JK, 2009)
strB-R CTAGTATGACGTCTGTCGCAC strB (Mak JK, 2009)
aphA1-F ATGAGCCATATTCAACGGG aphA1 (Mak JK, 2009)
aphA1-R TCAGAAAAACTCATCGAGCATC aphA1 (Mak JK, 2009)
gyrA-F GCGATGTCGGTCATTGTTGG gyrA This study
gyrA-R CCGAACTGGTCACGGATCAG gyrA This study
gyrB-F CTCCGTCTCCGTACAGGATGAC gyrB This study
gyrB-R TGTGATAGCGCAGTTTATCC gyrB This study

Genetic relatedness determination

The genetic similarities of the MDR K. pneumoniae strains were further analyzed using REP-PCR, a semi-automated PCR technique for the amplification of the regions between the non-coding repetitive sequences in bacterial genomes. REP-PCR was performed using the DiversiLab Klebsiella Kit (bioMérieux Inc., Durham, NC) according to the manufacturer’s instructions. The PCR products were separated on an Agilent B2100 Bioanalyzer using DNA LabChip reagents (Agilent Technologies Inc., Palo Alto, CA). The data were uploaded to the web-based DiversiLab system for further analysis. All results, including dendrograms, scatterplots, electropherograms, and virtual gel images, were illustrated using DiversiLab software (v.r.3.3.40). Pearson’s correlation coefficient and the unweighted-pair group method were used to determine the genetic similarity of the tested isolates. Strains with similarities > 98% are indistinguishable and designated as one pattern, and strains with similarities between 95% and 98% are homologous and designated as one group (Tenover, 2009; Marchaim, 2011).

Results

In vitro antimicrobial susceptibility

All 38 MDR K. pneumoniae strains showed resistance to aminoglycosides, macrolides, quinolones and β-lactams in the semi-automated systems. All isolates yielded MIC values ≥ 128 mg/L for cefotaxime and ceftazidime; ≥ 8 mg/L for imipenem, ertapenem and meropenem; ≥ 128 mg/L for kanamycin and amikacin; and ≥ 16 mg/L for ciprofloxacin. All MDR isolates were susceptible to colistin (≤ 1 mg/L), tigecycline (≤ 1 mg/L) and fosfomycin (≤ 64 mg/L). Among the 38 MDR K. pneumoniae isolates, 89.5% (34/38) were confirmed as ESBL producers, while 36.8% (14/38) were AmpC producers, and 31.5% (12/38) produced both ESBL and AmpC β-lactamases. The susceptibility characteristics of the MDR K. pneumoniae are shown in Tables 2 and 3.

Table 2 MICs for the 38 K. pneumoniae isolates, determined through agar dilution 

Strain No. MIC (mg/L)a

AMC SAM TZP CAZ CRO CTT FEP ATM ETP IPM MEM AMK TOB CIP LVX
K25, K32 > 128 > 256 128 128 > 256 > 256 32 > 128 8 16 16 128 128 16 32
K7, K9, K22, K24, K1, K17, K19, K16, K15, K13, K31 > 128 > 256 > 256 > 128 128 > 256 32 > 128 16 32 16 128 > 128 32 64
K20, K21, K14 128 128 256 > 128 > 256 128 128 > 128 16 32 32 256 > 128 16 64
K33, K18, K8 > 128 > 256 > 256 > 128 > 256 > 256 128 > 128 > 32 > 32 > 32 > 256 64 32 32
K4, K36, K12, K6 > 128 > 256 > 256 > 128 > 256 > 256 64 > 128 8 16 16 128 64 32 32
K5, K4, K34, K11 > 128 > 256 > 256 > 128 > 256 > 256 128 > 128 16 32 32 > 256 128 32 > 64
K35, K23 > 128 > 256 > 256 > 128 > 256 > 256 256 > 128 8 16 16 256 128 16 64
K10, K37 > 128 > 256 > 256 > 128 > 256 > 256 64 > 128 32 > 32 > 32 > 256 > 128 > 32 > 64
K38, K2 > 128 > 256 > 256 > 128 > 256 > 256 128 > 128 16 32 32 256 128 32 16
K28, K29 > 128 > 256 > 256 > 128 > 256 > 256 32 > 128 16 > 32 32 > 256 > 128 16 > 64
K26, K27, K30 > 128 > 256 > 256 > 128 > 256 > 256 128 > 128 8 16 16 > 256 > 128 32 32

AMC, amoxicillin/clavulanate; SAM, ampicillin/sulbactam; TZP, piperacillin/tazobactam; CAZ, ceftazidime; CRO, ceftriaxone; CTT, cefotetan; FEP, cefepime; AET, aztreonam; ETP, Ertapenem; MEM, meropenem; IPM, imipenem; AMK, amikacin; TOB, tobramycin; KAN, kanamycin; CIP, ciprofloxacin; LVX, levofloxacin.

aThe MICs of the following antibiotics were identical for all 38 isolates: cefotaxime ≥ 128 mg/L; cefazolin ≥ 128 mg/L; ampicillin ≥ 512 mg/L; piperacillin ≥ 128 mg/L; cefazolin ≥ 128 mg/L; cefuroxime ≥ 128 mg/L; gentamycin ≥ 128 mg/L; kanamycin ≥ 64 mg/L; chloramphenicol ≥ 32 mg/L; sulfafurazole ≥ 128 mg/L; norfloxacin ≥ 128 mg/L; nitrofurantoin ≥ 128 mg/L.

Table 3 Resistance determinants detected through the PCR screening of 38 K. pneumoniae isolates 

Strain No. Resistance determinants in K. pneumoniae

ESBL AmpC Integron bla SHV bla CTX-M bla TEM bla OXA bla DHA bla CIT bla VIM bla KPC gyrA mutation qnrB aacC1 aacC4 aadA1 strB
K25, K32 + Class 2 + + + + +
K7, K9, K22, K24, K1, K17, K19, K16, K15, K13, K31, K34 + Class 1 + + + + + +
K20, K21, K14, K33, K18, K8, K4, K36, K12, K6 + Class 1 + + + + + +
K35, K23, K10, K5, K4, K11 + + Class 2 + + + + +
K38, K2 + + Class 2 + + + + +
K29 + + Class 1 + + + + + +
K26, K27, K38, K28, K37 + + Class 1 + + + + + + +

+ and − indicate the presence and absence, respectively, of a particular resistance determinant.

Detection and characterization of integrons

PCR was used to assess the presence of integrons in the MDR K. pneumoniae strains as previously described (Mak, 2009). Class I and II integrons were detected in 73.7% (28/38) and 26.3% (10/38) of the strains, respectively. No class III integrons were detected. Subsequent PCR amplification and sequencing revealed that all 28 class I integron-positive K. pneumoniae isolates contained aacC1, which confers a high level of gentamicin resistance, aacC4, which encodes amikacin and tobramycin resistance, aadA1, which confers spectinomycin and streptomycin resistance, and two unknown open reading frames, orfX and orfX’.

Aminoglycoside resistance

All 38 MDR isolates were resistant to streptomycin, while only 28 class I integron-positive isolates contained aadA1, aacC1 and aacC4. Therefore, the other two streptomycin resistance genes, strA and strB, were screened through PCR. Eight class II integron-positive K. pneumoniae isolates containing the strB gene were detected, whereas no isolates containing the strA gene were observed. The control strain K. pneumoniae ATCC 700603 was completely sensitive to both spectinomycin and streptomycin; this strain also lacked aadA1, strA and strB genes.

Genetic basis of β-lactam resistance

The PCR analyses demonstrated that ESBL-producing MDR K. pneumoniaestrains were rich in β-lactamase genes, such as blaSHV(22/38), blaTEM (10/38) and blaCTX-M (7/38) (Table 3). Non-ESBL producers also harbored at least one β-lactamase gene. blaSHV-12 and blaCTX-M-9 genes were highly prevalent, accounting for 42% and 13%, respectively, of class A β-lactamase genes, while blaCTX-M-1 was not detected. The blaDHA gene was detected in 11 ESBL-positive strains and 2 ESBL-negative strains, representing the most prevalent AmpC gene. Notably, the blaDHA gene was detected in all qnr-positive strains and 5 qnr-negative strains (Table 2 and 3). PCR analysis revealed that 37 carbapenem-resistant isolates harbored KPC carbapenemase. Sequencing and alignment analyses revealed the presence of a highly conserved blaKPC-2 allele in KPC-positive isolates, and blaOXA-23 and blaVIM were only detected in KPC-negative isolates. blaCMY, blaACC, blaFOX, blaPER, blaVEB, blaGES, blaIMP and blaSPM were not detected in any of the clinical isolates examined.

Quinolone resistance is conferred through a gyrA site mutation or the qnrB gene

All 38 MDR isolates showed resistance to norfloxacin (MIC ≥ 256 mg/L) and ciprofloxacin (MIC ≥ 16 mg/L). To identify the quinolone resistance determinants, three subtypes of qnr genes (qnrA, qnrB, and qnrS) and two subtypes of gyr genes (gyrA and gyrB) were screened through PCR and sequencing analyses. Among the 38 MDR K. pneumoniae isolates, 13 isolates contained the plasmid-mediated quinolone resistance determinant qnrB, and 27 isolates contained the DNA gyrase gene gyrA, containing a nucleotide mutation in the quinolone-resistance determining region (QRDR). This mutation results in an amino acid change of S83L, which confers quinolone resistance in many bacteria. The gene qnrB was present in isolates that did not contain the gyrA mutation, and high rates of the qnrB4 subtype were detected among qnrB-positive isolates (10/12). The plasmid-mediated qnrB gene was also detected among 27 gyrA mutation strains of the two isolates K38 and K2. The qnrS gene was not detected in any of the MDR K. pneumoniae strains. The control strain K. pneumoniae ATCC 700603, which did not carry the gyrA mutation or any qnr gene, was susceptible to quinolones. These findings suggest that the S83L gyrA site mutation conferred quinolone resistance to 27 of 38 isolates, and qnrB conferred quinolone resistance to the other 11 isolates. qnrA, qnrS and mutations in gyrB were not detected in any of the 38 MDR K. pneumoniae isolates.

REP-PCR and genetic diversity

To characterize the genetic diversity of the 38 MDR K. pneumoniaeisolates with similar multidrug resistance profiles, strain typing based on REP-PCR was performed using genomic DNA. Five REP-PCR groups and sixteen patterns were observed (Figure 1). K7, K9, K22, K24, K1, K11, K17, K19, K16, K15, K13, and K31 showed high similarity (> 95%) in group II, designating the type 3 REP-PCR pattern. Moreover, the strains in group II pattern III, except for K19 (isolated from a bedrail) and K33 (isolated from bedclothes), were isolated from ICU patients. All group II strains, except K11 and K2, possessed class I integrons and aphA. Therefore, REP-PCR lacked the power to discriminate MDR K. pneumoniae strains, suggesting that a combination of genotypic data and REP-PCR types should be used to group the 38 isolates.

Figure 1 Dendrograms and virtual gel images of the MDR K. pneumoniaeisolates identified using web-based DiversiLab software 

Discussion

The incidence of MDR K. pneumoniae infections has increased during the last decade, reflecting the extensive use of antimicrobial agents (Wu et al., 2012). MDR K. pneumoniae is considered as a significant health problem because of limited options for antibiotic treatment. In this study, we conducted the phenotypic characterization and investigated the molecular mechanisms of antibiotic resistance for MDR K. pneumoniae strains isolated from ICUs. REP-PCR-based homology analyses provide information concerning the epidemic status of nosocomial infections caused by MDR K. pneumoniae.

In this study, 89.5% of the MDR K. pneumoniae strains isolated from ICU patients during a 12-month period were ESBL producers. This percentage was much higher than those reported in previous studies concerning other types of bacteria in China (Huang et al., 2007; Wang et al., 2012; Yong-Hong, 2012; Chen et al., 2012). The ESBL-positive MDR K. pneumoniae strains possessed at least seven resistance determinants conferring resistance phenotypes to nine classes of antimicrobials. This finding was troubling, as most clinical therapeutic regimens are restricted to a maximum of 4 classes. No significant associations among ESBL-producing strains, antibiotic susceptibilities and integron carriage profiles were observed. However, isolates with similar resistance determinant profiles showed similar antibiotic resistance phenotypes. Notably, class I integrons were predominantly detected among ESBL-positive K. pneumoniaeisolates (82.4%), consistent with the results of previous Asian studies. However, this percentage is slightly higher than those reported in Australian and American studies and much higher than those reported in European studies (Wu et al., 2012; Rao et al., 2006; Yao et al., 2007; Machado et al., 2007; Jiang et al., 2012). According to the results obtained in the present study, 26.3% of the MDR K. pneumoniaeisolates and 15.7% of the ESBL-producing isolates harbored class II integrons. Several studies have also reported the distribution of class II integrons among the Enterobacteriaceae family, including Escherichia coli, Salmonella and Enterobacter cloacae, and Acinetobacter baumannii in China (Zhou et al., 2013; Gu et al., 2006; Li et al., 2008). The co-existence of class I and II integrons was not observed in any of the MDR K. pneumoniae strains. To our knowledge, there has only one report describing the co-existence of class I and II integrons among Enterobacteriaceae in China (Li et al., 2008).

The prevalence and wide distribution of plasmid-mediated quinolone resistance determinants has been demonstrated among clinical isolates in China. In the present study, plasmid-mediated quinolone resistance determinants (qnr genes) conferred quinolone resistance in 13 K. pneumoniae strains. Furthermore, at least one ESBL subtype (CTX-M, TEM and SHV) or AmpC β-lactamase (DHA) was present in qnr-positive K. pneumoniae isolates (Table 3). Previous studies have also shown that most ESBL genes are located in transposons and self-transferable plasmids, which typically co-exist with plasmid-mediated quinolone resistance determinants (Jiang et al., 2012; Hassan et al., 2012; Park et al., 2012; Han et al., 2010). This phenotype might reflect the excessive use of cephalosporins and quinolones and the absence of strict antimicrobial policies in medical care facilities. The most frequent ESBL genotype among the qnr-positive K. pneumoniae strains was SHV-12, a result that was not consistent with results showing that SHV-7 was more common in qnr-positive isolates (Jiang et al., 2012).

Carbapenems have been considered as last resort treatments against infections caused by MDR Gram-negative organisms. However, Klebsiella has developed an efficient carbapenem resistance mechanism, known as KPC (Klebsiella pneumoniaecarbapenemase) (Naas et al., 2008). In China, KPC-producing K. pneumoniae was first identified in 2007 (Leavitt et al., 2007; Cuzon et al., 2008). Since then, the prevalence of KPC-producing K. pneumoniae has increased to epidemic proportions, particularly in large and public city hospitals. An increase in carbapenem-resistant strains has recently been reported in China (Cai et al., 2008), likely reflecting the horizontal and vertical transmission of KPC-encoding genes, overcrowded environments and insufficient infection control measures in these hospitals. In the present study, sequencing and alignment revealed the presence of the blaKPC-2 allele in 37 MDR K. pneumoniaeisolates. The blaKPC-2 genes amplified from these isolates were highly conserved, and no nucleotide differences were observed. However, the KPC-negative isolate was also OXA-23-positive. To our knowledge, few studies have revealed the contribution of blaOXA-23 to carbapenem resistance in other bacteria, with the exception of Acinetobacter baumannii. Because the blaOXA-23 gene identified in the KPC-negative K. pneumoniae isolate showed 100% identity to Acinetobacter baumannii blaOXA-23 (data not shown), we speculated that blaOXA-23 was transferred from A. baumanniithrough mobile genetic elements, which have been implicated in the dissemination of antimicrobial resistance through horizontal transmission. Previous studies have shown that integrons contribute to the prevalence of transferable extended-spectrum cephalosporin resistance through Enterobacteriaceae (Pisney et al., 2013; Magiorakos et al., 2013). Therefore, an in-depth investigation is required to study the mechanism of reduced susceptibility and to predict the clinical efficiency of carbapenem drugs.

The results of the present study demonstrated that the streptomycin resistance of class I integron-positive K. pneumoniae isolates was conferred through the aadA1 gene cassette. However, the widespread streptomycin resistance gene strB was only detected in class II integron-positive isolates. So far, the genes strA and strB are considered as a gene pair, comprising a mobile genetic element of the conjugative antibiotic resistance plasmid, which confers high-level streptomycin resistance in bacteria (Chiou et al., 1995; Tauch et al., 2003). We did not detect the strA gene in any of the isolates examined; thus, it is likely that the strB gene is an element of class II integrons. Currently, we are examining the genetic elements of class II integrons and the mechanism of streptomycin resistance in two other class II integron-positive strains, which have been demonstrated as strB-negative.

To provide evidence for the prevention and control of nosocomial infections, the genotypic similarities of MDR K. pneumoniae strains were investigated using the REP-PCR-based DiversiLab system. Five different groups and sixteen patterns of MDR K. pneumoniae were isolated from ICU patients. The MDR K. pneumoniae isolated from the ventilators and bed rails shared genetic similarities with the strains isolated from patients. The homology between some strains isolated from ventilators and bedrails suggested that the equipment or object surfaces in the ICU had persistent MDR K. pneumoniae colonization. Although REP-PCR is a powerful tool for strain typing, with resolution beyond the species level, this technique lacked the power to discriminate group II strains, as all of the MDR strains in group II, except K11 and K2, possessed class I integrons and aphA. Furthermore, the K. pneumoniae strains in the same clone group could possess different resistance phenotypes and different drug resistance determinants. Therefore, REP-PCR fingerprinting should be combined with other detection methods to distinguish genetic groups beyond the species level.

In conclusion, MDR K. pneumoniae is becoming a serious problem in ICUs, with many strains developing resistance to most available antibiotics. The results of this study provide evidence for appropriate surveillance and outbreak investigations. We propose that infection control measures and strict antimicrobial stewardship policies should be applied to reduce the selective pressure that inevitably favors the emergence and epidemic of MDR strains and to increase the therapeutic usefulness of these antibiotics.

Acknowledgments

The authors would like to thank S. Hou for technical assistance and I. Biswas and J. Huang for critically reading the manuscript. This work was supported through funding from the National Natural Science Foundation of China (No.81000762), the Natural Science Foundation (No.2010D018) and the Youth Foundation of the Health Department (No.2010-2-90) of Fujian Province, China.

References

Cai JC, Zhou HW, Chen GX et al. (2008) Detection of plasmid-mediated carbapenem-hydrolyzing beta-lactamase KPC-2 in a strain of carbapenem-resistant Enterobacter cloacae. Zhonghua Yi Xue Za Zhi 88:135–138. [ Links ]

Chen H, Yuehua X, Shen W et al. (2012) Epidemiology and resistance mechanisms to imipenem in Klebsiella pneumoniae: A multicenter study. Mol Med Report 7:21–25. [ Links ]

Correa L, Martino MD, Siqueira I et al. (2013) A hospital-based matched case-control study to identify clinical outcome and risk factors associated with carbapenem-resistant Klebsiella pneumoniae infection. BMC Infect Dis 13:80. [ Links ]

Cuzon G, Naas T, Demachy MC et al. (2008) Plasmid-mediated carbapenem-hydrolyzing beta-lactamase KPC-2 in Klebsiella pneumoniaeisolate from Greece. Antimicrob Agents Chemother 52:796–797. [ Links ]

Gu B, Tong M, Liu GY et al. (2006) Study on the mechanism of integron mediated multi-resistance in E. coli and Klebsiella. Chinese Journal of Laboratory Medicine 29:725–729. [ Links ]

Han C, Yang Y, Wang M et al. (2010) The prevalence of plasmid-mediated quinolone resistance determinants among clinical isolates of ESBL or AmpC-producing Escherichia coli from Chinese pediatric patients. Microbiol Immunol 54:123–128. [ Links ]

Hassan WM, Hashim A, Domany R (2012) Plasmid mediated quinolone resistance determinants qnr, aac(6′)-Ib-cr, and qep in ESBL-producing Escherichia coli clinical isolates from Egypt. Indian J Med Microbiol 30:442–447. [ Links ]

Huang Y, Zhuang S, Du M (2007) Risk factors of nosocomial infection with extended-spectrum beta-lactamase-producing bacteria in a neonatal intensive care unit in China. Infection 35:339–345. [ Links ]

Jiang HX, Tang D, Liu YH et al. (2012) Prevalence and characteristics of beta-lactamase and plasmid-mediated quinolone resistance genes in Escherichia coli isolated from farmed fish in China. J Antimicrob Chemother 67:2350–2353. [ Links ]

Ko WC, Paterson DL, Sagnimeni AJ et al. (2002) Community-acquired Klebsiella pneumoniae bacteremia: global differences in clinical patterns. Emerg Infect Dis 8:160–166. [ Links ]

Leavitt A, Navon-Venezia S, Chmelnitsky I et al. (2007) Emergence of KPC-2 and KPC-3 in carbapenem-resistant Klebsiella pneumoniae strains in an Israeli hospital. Antimicrob Agents Chemother 51:3026–3029. [ Links ]

Li J, Qian J, Xiang L et al. (2008) Drug-resistance and Transferable Mechanism of Integron Mediated in Gram-negative Isolates Causing Nosocomial Infection. Chinese Journal of Nosocomiolog 18:1651–1655. [ Links ]

Ma KL, Wang CX (2013) Analysis of the spectrum and antibiotic resistance of uropathogens in vitro: Results based on a retrospective study from a tertiary hospital. Am J Infect Control 41:601–606 [ Links ]

Machado E, Ferreira J, Novais A et al. (2007) Preservation of integron types among Enterobacteriaceae producing extended-spectrum beta-lactamases in a Spanish hospital over a 15-year period (1988 to 2003). Antimicrob Agents Chemother 51:2201–2204. [ Links ]

Magiorakos AP, Suetens C, Monnet DL et al. (2013) The rise of carbapenem resistance in Europe: just the tip of the iceberg? Antimicrob Resist Infect Control 2:6. [ Links ]

Mak JK, Pham J, Tapsall J et al. (2009) Antibiotic resistance determinants in nosocomial strains of multidrug-resistant Acinetobacter baumannii. J Antimicrob Chemother 63:47–54. [ Links ]

Marchaim D, Pogue JM, Perez F et al. (2011) Outbreak of colistin-resistant, carbapenem-resistant Klebsiella pneumoniae in metropolitan Detroit, Michigan. Antimicrob Agents Chemother. 55:593–599. [ Links ]

Molton JS, Tambyah PA, Ang BS et al. (2013) The Global Spread of Healthcare-Associated Multidrug-Resistant Bacteria: A Perspective From Asia. Clin Infect Dis 56:1310–1318. [ Links ]

Naas T, Cuzon G, Villegas MV et al. (2008) Genetic structures at the origin of acquisition of the beta-lactamase bla KPC gene. Antimicrob Agents Chemother 52:1257–1263. [ Links ]

Nordmann P, Cuzon G, Naas T (2009) The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect Dis 9:228–236. [ Links ]

Park KS, Kim MH, Park TS et al. (2012) Prevalence of the plasmid-mediated quinolone resistance genes, aac(6′)-Ib-cr, qepA, and oqxAB in clinical isolates of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli and Klebsiella pneumoniae in Korea. Ann Clin Lab Sci 42:191–197. [ Links ]

Perez-Perez FJ, Hanson ND (2002) Detection of plasmid-mediated AmpC beta-lactamase genes in clinical isolates by using multiplex PCR. J Clin Microbiol 40:2153–2162. [ Links ]

Pfaller MA, Acar J, Jones RN et al. (2001) Integration of molecular characterization of microorganisms in a global antimicrobial resistance surveillance program. Clin Infect Dis 32:S156–167. [ Links ]

Pisney L, Barron M, Janelle SJ et al. (2013) Notes from the Field: Hospital Outbreak of carbapenem-resistant Klebsiella pneumoniaeproducing New Delhi metallo-beta-lactamase - Denver, Colorado, 2012. MMWR Morb Mortal Wkly Rep 62:108. [ Links ]

Podschun R, Ullmann U (1998) Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin Microbiol Rev 11:589–603. [ Links ]

Rao AN, Barlow M, Clark LA et al. (2006) Class 1 integrons in resistant Escherichia coli and Klebsiella spp., US hospitals. Emerg Infect Dis 12:1011–1014. [ Links ]

Sanchez GV, Master RN, Clark RB et al. (2013) Klebsiella pneumoniae antimicrobial drug resistance, United States, 1998–2010. Emerg Infect Dis 19:133–136. [ Links ]

Tenover FC, Frye S, Eells SJ et al. (2009) Comparison of typing results obtained for methicillin-resistant Staphylococcus aureusisolates with the DiversiLab system and pulsed-field gel electrophoresis. J Clin Microbiol 47:2452–2457. [ Links ]

Wang XR, Chen JC, Kang Y et al. (2012) Prevalence and characterization of plasmid-mediated blaESBL with their genetic environment in Escherichia coli and Klebsiella pneumoniae in patients with pneumonia. Chin Med J (Engl) 125:894–900. [ Links ]

Wen X, Mi Z (2010) Investigation of Acquired Resistance Genes and Mutation of ompK36 gene in Multi-drug resistant Klebsiel la pneumoniae. Chinese Journal of Nosocomiology 20:2545–2548. [ Links ]

Winokur PL, Canton R, Casellas JM et al. (2001) Variations in the prevalence of strains expressing an extended-spectrum beta-lactamase phenotype and characterization of isolates from Europe, the Americas, and the Western Pacific region. Clin Infect Dis 32:S94–103. [ Links ]

Wu K, Wang F, Sun J et al. (2012) Class 1 integron gene cassettes in multidrug-resistant Gram-negative bacteria in southern China. Int J Antimicrob Agents 40:264–267. [ Links ]

Yao F, Qian Y, Chen S et al. (2007) Incidence of extended-spectrum beta-lactamases and characterization of integrons in extended-spectrum beta-lactamase-producing Klebsiella pneumoniae isolated in Shantou, China. Acta Biochim Biophys Sin (Shanghai) 39:527–532. [ Links ]

Yigit H, Queenan AM, Anderson GJ et al. (2001) Novel carbapenem-hydrolyzing beta-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob Agents Chemother 45:1151–1161. [ Links ]

Xiau YH, Wei ZQ, Chen YB et al. (2012) Mohnarin report of 2011:monitoring of bacterial resistance in China. Chinese Journal of Nosocomiology 22:4946–4953. [ Links ]

Zhou R, Zhu W, Feng T (2013) Study on homology and integron of Klebsiella pneumoniae producing metallo-β-lactamases. Chinese Journal of Antibiotics 38:776–782. [ Links ]

Received: February 12, 2014; Accepted: December 19, 2014

Send correspondence to J.Q. Zhang. No. 55 Zhenhai Road, Xiamen, 361003 Fujian Province, China. E-mail: jqzhangtina@yahoo.com.

Associate Editor: Roxane Maria Fontes Piazza

Creative Commons License All the content of the journal, except where otherwise noted, is licensed under a Creative Commons License CC BY-NC.