SciELO - Scientific Electronic Library Online

 
vol.46 número3Characterization of Francisella species isolated from the cooling water of an air conditioning systemMorphological changes and growth of filamentous fungi in the presence of high concentrations of PAHs índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

Links relacionados

Compartilhar


Brazilian Journal of Microbiology

versão impressa ISSN 1517-8382versão On-line ISSN 1678-4405

Braz. J. Microbiol. vol.46 no.3 São Paulo jul./set. 2015

http://dx.doi.org/10.1590/S1517-838246320140655 

Genetics and Molecular Microbiology

Characterization of the hrpZ gene from Pseudomonas syringae pv. maculicolaM2

César Álvarez-Mejía1 

Dalia Rodríguez-Ríos2 

Gustavo Hernández-Guzmán3 

Varinia López-Ramírez4 

Humberto Valenzuela-Soto5 

Rodolfo Marsch6 

1Instituto Tecnológico Superior de Irapuato Plantel Abasolo, Guanajuato, México.

2Departamento de Ingeniería Genética de Plantas, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional, Guanajuato, México.

3División de Ciencias de la Vida, Universidad de Guanajuato, Guanajuato, México.

4Instituto Tecnológico Superior de Irapuato, Guanajuato, México.

5Departamento de Plásticos en Agricultura, Centro de Investigación en Química Aplicada, Coahuila, México

6Departamento de Biotecnología y Bioingeniería, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional, D.F. México, México.

ABSTRACT

Pseudomonas syringae pv. maculicola is a natural pathogen of members of the Brassicaceae plant family. Using a transposon-based mutagenesis strategy in Pseudomonas syringaepv. maculicola M2 (PsmM2), we conducted a genetic screen to identify mutants that were capable of growing in M9 medium supplemented with a crude extract from the leaves of Arabidopsis thaliana. A mutant containing a transposon insertion in the hrpZ gene (PsmMut8) was unable to infect adult plants from Arabidopsis thaliana or Brassica oleracea, suggesting a loss of pathogenicity. The promotorless cat reporter present in the gene trap was expressed if PsmMut8 was grown in minimal medium (M9) supplemented with the leaf extract but not if grown in normal rich medium (KB). We conducted phylogenetic analysis using hrpAZB genes, showing the classical 5-clade distribution, and nucleotide diversity analysis, showing the putative position for selective pressure in this operon. Our results indicate that the hrpAZB operon from Pseudomonas syringaepv. maculicola M2 is necessary for its pathogenicity and that its diversity would be under host-mediated diversifying selection.

Key words: hrpZ ; mutant non-pathogenic; transmid; Tn5; phylogenetic

Introduction

The majority of Gram-negative pathogenic bacteria are endowed with the type III secretion system, which is a highly conserved apparatus that exports proteins that are essential to induce disease (Deane et al., 2006; Tang et al., 2006; Mansfield, 2009). Exported proteins play an important role in disease development at the cellular level. In phytopathogenic bacteria, the apparatus is called the Hrp system and is encoded by the hrp gene cluster (hypersensitivity response and pathogenicity) (Alfano and Collmer, 2004; Block and Alfano, 2011), which is usually included in a pathogenicity island (Gropp and Guttman, 2004). The product of these genes is a structure resembling a straight flagellum (Jin et al., 2001; Arnold et al., 2011), of which the Hrp pilus contacts the plant cell surface during infection (Büttner, 2012). Two types of proteins are exported through the Hrp pili: the avr(avirulence) gene products and the “harpins,” which are products of the hrpZ and hrpW genes (Reboutier and Bouteau, 2008; Schumacher et al., 2014). Avr proteins appear to be injected into plant cells (Jin et al., 2001; Fu et al., 2006), where they modulate the cell metabolism to export nutrients to the apoplast (van Dijk et al., 1999). In an incompatible interaction, the Avr protein is recognized by the product of a gene for resistance, R, which triggers the hypersensitive response and results in disease abortion (Mansfield, 2009). The harpins are encoded by hrp genes but are not included in the hrp pilus structure; instead, they are secreted into the medium or the apoplast, where they perform their activity. The function of harpins is not fully known (Choi et al., 2013). There are contradictory reports regarding HrpZ being essential (He et al., 1993) or not (Preston, 2000) for pathogenesis.

In this work, the function of the hrpZ gene from P. syringae pv. maculicola strain M2 (PsmM2) was interrupted using a transposable element promoter probe. The mutant strain was unable to infect adult plants from Arabidopsis thaliana or Brassica oleracea, indicating a complete loss of bacterial pathogenicity. The PsmM2 hrpZ gene is almost identical to its homolog in Pseudomonas syringae pv. tomato DC3000, suggesting that pathovars are conserved among distinct susceptible plant species. Our results suggest that hrpZ is an essential gene that is necessary for bacterial infection in plants.

Materials and Methods

Bacterial strains, plants and plasmids

Pseudomonas syringae pv. maculicola strain M2 (RifR) was a kind gift from Dr. Jeffrey L. Dangl (Ritter and Dangl, 1995), and PsmMut8 was obtained in this work. E. coli S17-1 λpir (thi pro hsdR hsdM ΔrecA RP4-2traTc::Mu Km::Tn7) (de Lorenzo et al., 1990) was obtained from Dr. Kate J. Wilson. E. coli DH5α competent cells (supE44ΔlacU169 (f80 lacZ DM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1) (Sambrook and Russell, 2001) were used for cloning experiments. A SwaI restriction site was added into the SmaI site on pUIRM504 (Marsch-Moreno et al., 1998) to form the plasmid pMDC505 (unpublished results); with this change, the transposable element pTn5cat (Marsch-Moreno et al., 1998) was modified into pTn5cat1. King’s B medium (King et al., 1954), minimal medium M9 (Sambrook and Russell, 2001) or M9CA (Difco) was used to culture P. s. maculicola strains and in the assay to determine the conditions for cat expression, with or without the additions described below. LB medium was used to culture the E. colistrains. Chloramphenicol, rifampicin and kanamycin were purchased from Serva or Sigma-Aldrich Chemicals.

Mutagenesis and mutant selection

Mutants of PsmM2 were generated using the transmid element pTn5cat1 according a published protocol (Marsch-Moreno et al., 1998). E. coli S17-1 (pMDC505) was used to mobilize pTn5cat1 to PsmM2 by conjugation, and the bacteria were then spread onto M9 Rif50 Km50 plates. Mutants were screened for their ability to growth on M9 Cm50 with plant extract. To obtain crude plant extract, mature rosette leaves from 3-week-old Arabidopsis thaliana plants were frozen in liquid nitrogen and ground into a powder, which was then centrifuged at 13,000 rpm for 10 to 20 min. The liquid phase was recovered and added to the growth medium as an effector of pathogenesis.

Assay for promoter strength

The promoter strength was evaluated as the cell density after the bacteria were grown in a medium containing chloramphenicol (Alvarez-Mejia et al., 2013). The assays were performed in sterile 96-well polystyrene plates. First, 50 μL of a 0.04-OD620 culture of mutant PsmMut8 in KB Km50 was added to wells containing 200 μL of M9, M9Ca or KB medium supplemented or not with plant extract (2 μL/mL) or sucrose (5%); all media contained kanamycin (50 μg/mL) and chloramphenicol (150 μg/mL). The plates were incubated at 28 °C, and the cell density was measured at 0, 24 and 48 h using a Titertek Multiskan Plus (EFLAB, Joint Venture Company of Lab System and Flow Laboratories) with a 492-nm filter.

Pathogenesis assays

To test the ability of the mutants to induce disease in A. thaliana, 3-week-old plants were inoculated by infiltration with mutant or wild type PsmM2 cell suspensions (~20 μL per leaf). The cell suspensions were prepared by growing PsmMut8 or PsmM2 in 5 mL KB, incubated at 28 °C overnight with strong shaking to reach an 0.4 of OD600. Then, 3 mL were centrifuged at 14,000 rpm for 2 min at 4 °C (rotor: Sorvall SS34). The pellet was washed two times with sterile water, and the cells were resuspended in 3 mL of sterile distilled water. Leaves were inoculated with the undiluted cell suspension or with a 1:10 dilution.

Cloning and sequencing

Total PsmMut8 DNA was purified using a previously described method (Chen and Kuo, 1993). First, ten μg of DNA were completely digested using the restriction endonuclease EcoRI in a reaction volume of 50 μL. The enzyme was then inactivated at 65 °C for 20 min. Next, 1 μg of cut DNA was religated with T4 DNA ligase in a reaction volume of 50 μL at 28 °C for 4 h. The ligated DNA was then used to transform competent E. coli DH5α cells to become kanamycin resistant. To sequence the cloned chromosomal fragments, oligonucleotides 1212 (5′-GTGCCTGACTGCGTTA-3′; from the mob end), 1213 (5′-CCTTAGCTCCTGAAA-3′: from the cat end), 1658 (5′-GTTGACCTACGTCAACGCTGGC-3′), 2176 (5-GTGTCGAACACCGAAAG-3 to sequence hrpB), and 2149 (5-TCTGAAGAGTGGCGTTGGAAGC-3 to sequence hrpA) were used. Restriction endonucleases and T4 DNA ligase were purchased from New England BioLabs, Inc. or Invitrogen. Enzymes were used following the suppliers’ recommendations.

Bioinformatics analysis and alignment

hrpAZB operons from diverse Pseudomonas strains were retrieved from the GenBank database and used in our analysis (Table 1). Most of them had been used in a previous work (Inoue and Takikawa, 2006). Nucleotide polymorphism analysis was conducted using DnaSP (Rozas et al., 2003), and the sliding window analysis for hrpAZB operon was conducted using 25 nt in a window of 50 nt only for unique P. syringae strains. Bioinformatics analysis was performed using the BLASTn program (Altschul et al., 1990; Worley et al., 1998), and alignments were performed using Clustal W and edited with BioEdit (Hall, 1999); Pseudomonas viridiflava and Pseudomonas cichorii were included as outgroups.

Table 1 Strains used in the phylogenetic analysis. All of the data were retrieved from GenBank 

Bacteria Strain Accession
Pseudomonas syringae
sesami PSES-1 AB112563
lachrymans cucum-1 AB112561
? “kiwi” KW741 AB112559
eriobotryae PERB8031 AB112557
oryzae 1-1.1 AB112580
coronafaciens AVPCO8101 AB112578
aceris kaede1-1 AB112576
japonica BPST802 AB112574
striafaciens avena2 AB112579
magnoliae PMG8101 AB112570
theae tea632 AB112568
mori mori1 AB112562
morsprunorum U7805 AB112560
myricae yamamomo801 AB112558
dendropanacis kakuremino-1 AB112556
pisi Pisum-1 AB112577
phaseolicola NPS3121 AB112552
tomato DC3000 AF232004
ICMP2844 AB112567
tagetis LMG5090 DQ246442
aptata SB8601 AB112575
tabaci ATCC11528 FJ946987
lapsa NCPPB2096 AB112573
actinidiae KW11 AB112571
delphinii PDDCC529 AB112569
maculicola R1 AB112565
M2 AY325899
PMC8301 AB112566
glycinea r0 AB112554
race4 L41862
syringae 61 EF514224
LOB2-1 AB112572
ICMP3414 AB112581
Pseudomonas savastanoi
savastanoi 5 FR717896
Pseudomonas
viridiflava RMX23.1a AY597282
cichorii SPC9018 AB433910
ficuserectae L-7 AB112564

Results

Selection of PsmMut8

A collection of PsmM2 mutants harboring the pTn5cat1 transposon-based construct was screened for the induction of cat expression in M9 medium containing a plant extract (see the Materials and Methods section for details). A total of 14 candidates were identified by their ability to grow in M9 Km50 Cm150because the reporter gene cat was induced by the plant extract. All of these mutants were tested in pathogenesis assays by inoculating Arabidopsis plants. Mutant number 8 (PsmMut8) was selected because it was unable to infect and cause disease symptoms or hypersensitivity reaction (HR) in either A. thaliana or Brassica oleracea (Figure 1).

Figure 1 Pathogenesis and HR assays for PsmM2 and PsmMut8. A. Arabidopsis leaves were infected by PsmM2 but not by PsmMut8. B. HR assay in collard leaves; PsmM2 but not PsmMut8 was able to produce HR, similarly to hrpZ from Pseudomonas syringae pv. glycinea (Psg) and Pseudomonas syringae pv. tomatoDC3000 (PstDC3000). Phosphate buffer was used as a control 

Promoter expression detected in PsmMut8

The cat reporter gene in pTn5cat1 allows for the estimation of promoter expression under conditions that resemble those in the apoplast. The cell density in liquid media in the presence of chloramphenicol is associated with the resistance level to the antibiotic, suggesting that the measurement of cell density in the presence of chloramphenicol in different media (M9, M9Ca or KB) with or without the addition of plant extract or sucrose reflects the expression level of the detected promoter under these conditions (Alvarez-Mejia et al., 2013). The cell density values of PsmMut8 growing in different media at 28 °C after 48 h are shown in Figure 2. The cell density was higher in M9 than in KB medium, suggesting that chloramphenicol resistance in response to the plant extract was increased in M9 but that casamino acids preclude the stimulatory effect of the plant extract. No different effects were observed in the assay with sucrose.

Figure 2 PsmMut8 was cultured at 28 °C for 48 h in M9, M9Ca or KB medium. All of the media contained chloramphenicol (Cm, 150 μg/mL), and some of the media were supplemented with plant extract (Ext) or sucrose (Suc) 

pTn5cat1 is inserted into a gene homologous to the hrpZ gene of Pseudomonas syringae

A 14-kb chromosomal fragment corresponding to the pTn5cat1 borders and their flanking genomic sequences were cloned, sequenced, and compared to the genomic information contained in GenBank. Both flanking sequences are homologous to the hrpZ gene from Pseudomonas syringae pv. tomato DC3000 (PstDC3000) (99% identity, six nucleotide substitutions over 1,110 bp, Figure 3A). Alignment with other sequences reported in GenBank for HrpZ proteins revealed two shared regions between PsmM2 and PstDC3000, including genomic locations 102–125, IGAGGGGGGIGGAGSGSGVGGGLS, and 229–244, SGVTSGGGLGSPVSDS.

Figure 3 A. The insertion of pTn5cat1 into the hrpZ gene. IR, inverted repeated; cat, chloramphenicol acetyltransferase; neo, neomycin phosphotransferase; oriColE1, replication origin type ColE1; mob, mobilization region from RP4. The PacI, PmeI and SwaI restriction sites are shown. The angled arrows indicate the position of the oligonucleotides for the following sequences: A. 1213, 5′-TTTCAGGAGCTAAGG-3′; B. 1212, 5′-GTGCCTGACTGCGTTA-3′; and C. 1638, 5′-CGTGGTTTGCAGTCGGTTT-3′. B. The genes detected around pTn5cat1 are similar to hrpS, hrpA, hrpB and hrpC (GenBank accession number AY325899) 

Additional sequences flanking pTn5cat1 are similar to the hrp genes of Pseudomonas syringaeDC3000

To further investigate the location of the interrupted gene in PsMut8, we sequenced the regions upstream and downstream of hrpZ. All of the generated sequences corresponded to previously identified genes encoding Hrp proteins: hrpS, hrpA, hrpZ, hrpB and hrpC(Figure 3B). The first and the last open reading frames (ORFs) were only partially sequenced. A putative hrp box (GGAACCGATTCGCAGGCTGCTGCCACCTA) was identified in the 5′ region of hrpA (Zwiesler-Vollick et al., 2002), and a putative ribosome binding site (RBS) was identified within the hrpA gene. The 3′-UTRs of hrpA and hrpZ are predicted to fold into hairpin structures reminiscent of bacterial transcription terminators (TGAGTACCAAGCAATCACGCTGGTAAATCTTA and GCCCCCTCATCAGAGGGGGC, respectively). The presence of a putative RBS within the terminator suggests that the transcription of hrpZ proceeds independently of hrpA. To explore a possible conservation of the hrpAZB operon in different pathovars, including PsmM2 and PstDC3000, we conducted a phylogenetic analysis with 35 Pseudomonas syringae sequences; 2 different Pseudomonas species were included as outgroups. Our analysis was based on maximum likelihood estimations and the Kimura two-parameter substitution model with 1000 bootstraps. Our results showed that PsmM2 belongs to phylogroup II, as described by Inoue (Inoue and Takikawa 2006), or group 5, as described by Guttman (Guttman et al., 2006), and is closely related to the tomatopathovar, as well as to other maculicola strains (Figure 4). They also showed that nucleotide polymorphisms within the operon are particularly abundant in the hrpA gene and the 5 region of hrpZ, whereas polymorphisms are less abundant in the intergenic regions (Figure 5).

Figure 4 Phylogenetic distribution of the hrpABZ operon by the maximum likelihood method. PsmM2 is located in clade V, and P. s. tagetis is basal to clades IV and V 

Figure 5 Nucleotide polymorphism analysis (pi) for the hrpAZBoperon. Only sequences from Pseudomonas syringaepathovars were used. bp, base pair 

Discussion

The use of a Tn5 derivative carrying suitable reporter genes has allowed for the isolation of bacterial genes that are responsive to a variety of environmental conditions (Haapalainen et al., 2012). As a means to simulate conditions prevalent in the apoplast (low osmotic pressure, low pH, and the absence of amino acids, polysaccharides and phenolic compounds), we used a transposon-based element to isolate mutants showing high expression levels of the cat gene in the presence of plant extract or minimal medium (Marsch-Moreno et al., 1998). In selected mutants, rich medium partially blocked cat expression. Analogous to this observation, rich medium containing a nitrogen source has been shown to negatively regulate hrpL, a transcriptional regulator of hrpRS, indicating a possible regulatory role mediated by operons with an hrp box in their promoter sequence (Jovanovic et al., 2011). This regulation is antagonistic to those mutants prevailing in minimal medium enriched with plant extracts, which was shown to induce the expression of gacS, a positive regulator of hrpL (Chatterjee et al., 2003). Our conditions are similar to those that induce the activity of other pathogenicity genes such as avr, hrp, and argK, as well as the expression of genes involved in the synthesis of coronatine, syringomycin and phaseolotoxin (Rahme et al., 1992; Palmer and Bender, 1993; Budde et al., 1998; Zwiesler-Vollick et al., 2002; Ortiz-Martin et al., 2010). The incubation of P. syringae at a low temperature and low pH can also induce the activity of hrp genes, suggesting that the global activity of genes involved in pathogenesis is correlated with the activity of genes involved in the stress response (Hauser, 2009). The natural conditions that are necessary for the expression of the promoter detected in PsmMut8 resemble those described above. The expression of a detected regulatory sequence was also stimulated in M9 medium. Casamino acids have two effects: on one hand, they facilitate growth and partially circumvent the necessity of synthesizing amino acids; on the other, they inhibit the stimulation of transcription by plant metabolites (Schumacher et al., 2014). On the basis of our results, the regulation of the hrpZ promoter can be predicted to respond to environmental conditions and to diverse metabolites that depend on the presence of amino acids (Schumacher et al., 2014). Our results also show that our assay could serve as a probe to searching for specific plant metabolites capable of inducing the expression of genes related to pathogenesis in P. syringae.

The transposon insertion in PsmMut8 interrupts the function of a gene homologous to hrpZ from P. s. tomato DC3000. Its sequence is distinct from other reported HrpZ proteins by 28 glycine-rich peptide residues that are absent in most family members; however, the percentage of similarity among family members is high (99.5%), and the divergence is small (0.5%). Figure 4 shows the phylogenetic structure of the hrpAZB operon between Pseudomonas species. The distribution from 35 pathovars is similar to that reported by Guttman and Inoue in five phylogroups (Inoue and Takikawa, 2006; Guttman et al., 2006). The operon hrpAZB belongs to phylogroup II, sharing features with the tomato and maculicola pathovars. The nucleotide polymorphism analysis shows that hrpA is the most diverse gene (Figure 5), as was reported by Guttman (Guttman et al., 2006). This gene appears to be under positive selection compared with hrpZ and hrpB, suggesting a possible role of this gene during the fast co-evolution of host-pathogen interactions (Gropp and Guttman 2004; Mansfield 2009). Additionally, a possible interaction of the HrpZ hairpin and the N-terminal region of HrpA could be related to the nucleotide sequence of the 5 hrpZ region. Regions with low numbers of nucleotide polymorphisms include the hrp box, the RBS region, and the putative translational signal regions of each gene detected in this work. It is not surprising that PstDC3000 has been included as a member of the maculicola pathovar, and, similarly to PsmM2, PstDC3000 is capable of infecting A. thaliana (Bao et al., 2014). It has been previously described that hrpZ is not essential for pathogenesis in P. s. tomato or syringae. Although our results indicate that PsmMut8 is non-pathogenic, based on the location of transcription termination sequences around the replication origin and the pas sites, it is possible that the insertion of the transposable element resulted in a polar mutation (Balbas et al., 1986). Additional experiments will be necessary to explore the function of hrpB or the importance of hrpZ in the control of pathogenesis (Accession number AY325899).

Acknowledgments

We would like to acknowledge Dr. Jeff Dangl for providing the PsmM2 strain, as well as Dr. Carol Bender at Oklahoma State University for her support with the pathogenesis assays and plants. This work was supported by grants from Consejo Nacional de Ciencia y Tecnología (Conacyt No. 28539-N) and Consejo de Ciencia y Tecnología del Estado de Guanajuato (Concyteg).

References

Alvarez-Mejia C, Hernandez-Guzman G, Curiel-Quesada E et al. (2013) The use of cell density to estimate the bacterial promoter strength. J Pure Appl Microbiol 7:1743–1748. [ Links ]

Alfano JR, Collmer A (2004) Type III secretion system effector proteins: double agents in bacterial disease and plant defense. Annu Rev Phytopathol 42:385–414. [ Links ]

Altschul SF, Gish W, Miller W et al. (1990) Basic local alignment search tool. J Mol Biol 215:403–410. [ Links ]

Arnold DL, Lovell HC, Jackson RW et al. (2011) Pseudomonas syringae pv. phaseolicola: from ‘has bean’ to supermodel. Mol Plant Pathol 12:617–627. [ Links ]

Balbas P, Soberon X, Merino E et al. (1986) Plasmid vector pBR322 and its special-purpose derivatives—a review. Gene 50:3–40. [ Links ]

Bao Z, Stodghill PV, Myers CR et al. (2014) Genomic Plasticity Enables Phenotypic Variation of Pseudomonas syringaepv. tomato DC3000. PLos One 9:e86628. [ Links ]

Block A, Alfano JR (2011) Plant targets for Pseudomonas syringae type III effectors: virulence targets or guarded decoys? Curr Opin Microbiol 14:39–46. [ Links ]

Büttner D (2012) Protein export according to schedule: architecture, assembly, and regulation of type III secretion systems from plant- and animal-pathogenic bacteria. Microbiol Mol Biol Rev 76:262–310. [ Links ]

Chatterjee A, Cui Y, Yang H et al. (2003) GacA, the response regulator of a two-component system, acts as a master regulator in Pseudomonas syringae pv. tomato DC3000 by controlling regulatory RNA, transcriptional activators, and alternate sigma factors. Mol Plant Microbe Interact 16:1106–1117. [ Links ]

Chen WP, Kuo TT (1993) A simple and rapid method for the preparation of Gram-negative bacterial genomic DNA. Nucl Acids Res 21:2260. [ Links ]

Choi MS, Kim W, Lee C et al. (2013) Harpins, multifunctional proteins secreted by Gram-negative plant-pathogenic bacteria. Mol Plant Microbe Interact 26:1115–1122. [ Links ]

Deane JE, Roversi P, Cordes FS et al. (2006) Molecular model of a type III secretion system needle: Implications for host-cell sensing. Proc Natl Acad Sci USA 103:12529–12533. [ Links ]

de Lorenzo V, Herrero M, Jakubzik U et al. (1990) Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in Gram-negative eubacteria. J Bacteriol 172:6568–6572. [ Links ]

Gropp SJ, Guttman DS (2004) The PCR amplification and characterization of entire Pseudomonas syringae hrp/hrc clusters. Mol Plant Pathol 5:137–140. [ Links ]

Guttman DS, Gropp SJ, Morgan RL et al. (2006) Diversifying selection drives the evolution of the type III secretion system pilus of Pseudomonas syringae. Mol Biol Evol 23:2342–2354. [ Links ]

Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98. [ Links ]

Haapalainen M, Dauphin A, Li CM et al. (2012) HrpZ harpins from different Pseudomonas syringae pathovars differ in molecular interactions and in induction of anion channel responses in Arabidopsis thaliana suspension cells. Plant Physiol Biochem 51:168–174. [ Links ]

Hauser AR (2009) The type III secretion system of Pseudomonas aeruginosa: infection by injection. Nat Rev Microbiol 7:654–665. [ Links ]

Inoue Y, Takikawa Y (2006) The hrpZ and hrpA genes are variable, and useful for grouping Pseudomonas syringae bacteria. J Gen Plant Pathol 72:26–33. [ Links ]

Jin Q, Hu W, Brown I et al. (2001) Visualization of secreted Hrp and Avr proteins along the Hrp pilus during type III secretion in Erwinia amylovora and Pseudomonas syringae. Mol Microbiol 40:1129–1139. [ Links ]

Jovanovic M, James EH, Burrows PC et al. (2011) Regulation of the co-evolved HrpR and HrpS AAA+ proteins required for Pseudomonas syringae pathogenicity. Nat Commun 2:177. [ Links ]

Mansfield JW (2009) From bacterial avirulence genes to effector functions via the hrp delivery system: an overview of 25 years of progress in our understanding of plant innate immunity. Mol Plant Pathol 10:721–734. [ Links ]

Marsch-Moreno R, Hernández-Guzmán G, Alvarez-Morales A (1998) pTn5cat: a Tn5-derived genetic element to facilitate insertion mutagenesis, promoter probing, physical mapping, cloning, and marker exchange in phytopathogenic and other Gram-negative bacteria. Plasmid 39:205–214. [ Links ]

Ortiz-Martín I, Thwaites R, Macho AP et al. (2010) Positive regulation of the Hrp type III secretion system in Pseudomonas syringae pv. phaseolicola. Mol Plant Microbe Interact 23:665–681. [ Links ]

Palmer DA, Bender CL (1993) Effects of environmental and nutritional factors on production of the polyketide phytotoxin coronatine by Pseudomonas syringae pv. glycinea. Appl Environ Microbiol 59: 1619–1626. [ Links ]

Preston GM (2000) Pseudomonas syringae pv. tomato: the right pathogen, of the right plant, at the right time. Mol Plant Pathol 1:263–275. [ Links ]

Rahme LG, Mindrinos MN, Panopoulos NJ (1992) Plant and environmental sensory signals control the expression of hrp genes in Pseudomonas syringae pv. phaseolicola. J Bacteriol 174:3499–3507. [ Links ]

Reboutier D, Bouteau F (2008) Harpins and ion channels modulations: Many ways to die. Plant Signal Behav 3:314–316. [ Links ]

Ritter C, Dangl JL (1995) The avrRpm1 gene of Pseudomonas syringae pv. maculicola is required for virulence on Arabidopsis. Mol Plant Microbe Interact 8:444–453. [ Links ]

Rozas J, Sanchez-Del Barrio JC, Messeguer X et al.(2003) DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19: 2496–2497. [ Links ]

Sambrook J, Russell DW (2001) Molecular Cloning: A laboratory manual. (3rd ed) Cold Spring Harbor Laboratory Press. USA. [ Links ]

Schumacher J, Waite CJ, Bennett MH et al. (2014) Differential secretome analysis of Pseudomonas syringae pv tomato using gel-free MS proteomics. Front Plant Sci 5:242. [ Links ]

Tang X, Xiao Y, Zhou JM (2006) Regulation of the type III secretion system in phytopathogenic bacteria. Mol Plant Microbe Interact 19:1159–1166. [ Links ]

van Dijk K, Fouts DE, Rehm AH et al. (1999) The Avr (effector) proteins HrmA (HopPsyA) and AvrPto are secreted in culture from Pseudomonas syringae pathovars via the Hrp (type III) protein secretion system in a temperature- and pH-sensitive manner. J Bacteriol 181:4790–4797. [ Links ]

Worley KC, Culpepper P, Wiese BA et al. (1998) BEAUTY-X: enhanced BLAST searches for DNA queries. Bioinformatics 14:890–891. [ Links ]

Zwiesler-Vollick J, Plovanich-Jones AE, Nomura K et al. (2002) Identification of novel hrp-regulated genes through functional genomic analysis of the Pseudomonas syringae pv. tomato DC3000 genome. Mol Microbiol 45:1207–1218. [ Links ]

Received: August 02, 2014; Accepted: November 16, 2014

Send correspondence to R. Marsch. Departamento de Biotecnología y Bioingeniería, Cinvestav. Avenida I.P.N 2508, Colonia San Pedro Zacatenco, 07360. México, D.F. México. E-mail: rmarsch@cinvestav.mx.

Associate Editor: Fernando Dini Andreote

Creative Commons License All the content of the journal, except where otherwise noted, is licensed under a Creative Commons License CC BY-NC.