Abstract
Dikarya is a subkingdom of fungi that includes Ascomycota and Basidiomycota. The gene expression patterns of dikaryon are poorly understood. In this study, we bred a dikaryon DK13 × 3 by mating monokaryons MK13 and MK3, which were from the basidiospores of Pleurotus ostreatus TD300. Using RNA-Seq, we obtained the transcriptomes of the three strains. We found that the total transcript numbers in the transcriptomes of the three strains were all more than ten thousand, and the expression profile in DK13 × 3 was more similar to MK13 than MK3. However, the genes involved in macromolecule utilization, cellular material synthesis, stress-resistance and signal transduction were much more up-regulated in the dikaryon than its constituent monokaryons. All possible modes of differential gene expression, when compared to constituent monokaryons, including the presence/absence variation, and additivity/nonadditivity gene expression in the dikaryon may contribute to heterosis. By sequencing the urease gene poure sequences and mRNA sequences, we identified the monoallelic expression of the poure gene in the dikaryon, and its transcript was from the parental monokaryon MK13. Furthermore, we discovered RNA editing in the poure gene mRNA of the three strains. These results suggest that the gene expression patterns in dikaryons should be similar to that of diploids during vegetative growth.
Keywords:
Differential gene expression; Monoallelic expression; Monokaryon; RNA editing; RNA-Seq
Introduction
Dikaryon is a unique organism in which each compartment of a hypha contains two haploid nuclei, each derived from a different parent. It consists of a subkingdom of fungi Dikarya, including Ascomycota and Basidiomycota. A dikaryon strain is formed by mating two compatible monokaryon strains, resulting in plasmogamy but not karyogamy in the fused compartment. When new hyphae grow, the two nuclei synchronously divide, and each new compartment keeps two nuclei11 Stajich JE, Berbee ML, Blackwell M, et al. The fungi. Curr Biol. 2009;19(18):R840-R845.; karyogamy only occurs before the initiation of sexual reproduction. This sexual reproduction mode was distinctly different from that in diploids. The interaction between the genetic materials of the two nuclei in dikaryons has not been well characterized. Are the modes of gene action in dikaryons the same as that in diploids during vegetative growth?
The major types of gene expression patterns found in diploids during vegetative growth are mitotic crossover or mitotic recombination,22 Stern C. Somatic crossing over and segregation in Drosophila melanogaster. Genetics. 1936;21(6):625-730.,33 LaFave MC, Andersen SL, Stoffregen EP, et al. Sources and structures of mitotic crossovers that arise when BLM helicase is absent in Drosophila. Genetics. 2014;196(1):107-118. DNA methylation and gene silencing by RNAi,44 Fellmann C, Lowe SW. Stable RNA interference rules for silencing. Nat Cell Biol. 2014;16(1):10-18. monoallelic expression (sex chromosome inactivation, imprinted gene expression, or autosomal random monoallelic expression),55 Chess A. Mechanisms and consequences of widespread random monoallelic expression. Nat Rev Genet. 2012;13(6):421-428. RNA-editing,66 Stepanova VV, Gelfand MS. RNA editing: classical cases and outlook of new technologies. Mol Biol. 2014;48(1):11-15. and differential allele expression in hybrids and parents that contributes to heterosis,77 Chen ZJ. Genomic and epigenetic insights into the molecular bases of heterosis. Nat Rev Genet. 2013;14(7):471-482. etc. Mitotic recombination (also named parasexuality in fungi), DNA methylation and gene silencing by RNAi were also found in dikaryons,88 Qiu LY, Yu C, Qi YC, et al. Recent advances on fungal epigenetics. Chin J Cell Biol. 2009;31(2):212-216.–1010 Goodenough U, Heitman J. Origins of eukaryotic sexual reproduction. Cold Spring Harb Perspect Biol. 2014;6(3):a016154. while monoallelic expression and RNA-editing have not been identified in the dikaryon. Although not strictly true for all reported species, in terms of the growth rate, enzyme activity and pathogenicity, diploids have a significant advantage over their parental haploids, which is similar to what is exhibited when dikaryons are compared to their parental monokaryons. It was proposed that the heterosis in diploids resulted from the allele gene differential expression in hybrids and their parents, such as presence/absence variation and additive/non-additive (high- and low-parent dominance, underdominance, and overdominance) gene expression.1111 Gibson G, Riley-Berger R, Harshman L, et al. Extensive sex-specific nonadditivity of gene expression in Drosophila melanogaster. Genetics. 2004;167(4):1791-1799.–1414 Paschold A, Jia Y, Marcon C, et al. Complementation contributes to transcriptome complexity in maize (Zea mays L.) hybrids relative to their inbred parents. Genome Res. 2012;22(12):2445-2454. The mechanism of heterosis in dikaryons remains obscure.
An effective approach for exploring the allele gene differential expression in dikaryons is the comparison of soluble protein profiles or isoenzyme patterns between a dikaryon and its constituent monokaryons. The soluble protein profile of Schizophyllum commune dikaryon was dramatically different from that of its parental monokaryons, and there are many new bands in the dikaryon1515 Wang C-S, Raper JR. Protein specificity and sexual morphogenesis in Schizophyllum commune. J Bact. 1969;99(1):291-297.; further studies showed that 14 out of 15 isoenzyme patterns changed between the dikaryon and two monokaryons.1616 Wang C-S, Raper JR. Isozyme patterns and sexual morphogenesis in Schizophyllum. Proc Natl Acad Sci U S A. 1970;66(3):882-889. Similar results were also reported in other basidiomycetes, such as Coprinus congregatus1717 Ross IK, Martin EM, Thoman M. Changes in isozyme patterns between monokaryons and dikaryons of a bipolar Coprinus. J Bact. 1973;114(3):1083-1089. and Coprinopsis cinerea.1818 Moore D, Jirjis RI. Electrophoretic studies of carpophore development in the basidiomycete Coprinus cinereus. New Phytol. 1981;87(1):101-113. Those studies indicated that alleles had different expression patterns in dikaryons and monokaryons. However, subsequent studies found no such difference in higher basidiomycetes and suggested that those reported differences were probably caused by growth conditions and the electrophoresis procedure.1919 Ullrich RC. Isozyme patterns and cellular differentiation in Schizophyllum. Mol Gen Genet. 1977;156(2):157-161.,2020 Evers DC, Ross IK. Isozyme patterns and morphogenesis in higher basidiomycetes. Exp Mycol. 1983;7(1):9-16. Since then, many other observations have confirmed such findings. For example, comparing S. commune monokaryons and the dikaryon, protein two-dimensional gel electrophoresis showed only 6.6% and 7.7% differences,2121 de Vries OM, Hoge JH, Wessels JG. Regulation of the pattern of protein synthesis in Schizophyllum commune by the incompatibility genes. Dev Biol. 1980;74(1):22-36. and the sequence complexities and coding properties of polysomal RNA and total RNA had no detectable difference.2222 Zantinge B, Dons H, Wessels JG. Comparison of poly(A)-containing RNAs in different cell types of the lower eukaryote Schizophyllum commune. Eur J Biochem. 1979;101(1):251-260.,2323 Zantinge B, Hoge JH, Wessels JG. Frequency and diversity of RNA sequences in different cell types of the fungus Schizophyllum commune. Eur J Biochem. 1981;113(2):381-389. Nevertheless, using gene expression profiling, the relative differences in the transcription quantity of the 12 laccase genes in the Pleurotus ostreatus dikaryon and its two parental monokaryons showed that the dikaryotic superiority in laccase activity was due to non-additive transcriptional increases in two genes.2424 Castanera R, Omarini A, Santoyo F, et al. Non-additive transcriptional profiles underlie dikaryotic superiority in Pleurotus ostreatus laccase activity. PLOS ONE. 2013;8(9):e73282. Genome-wide gene expression pattern analysis of dikaryons and their parental monokaryons has not been reported.
Oyster mushroom P. ostreatus (Jacq. Fr) Kumm. is a white rot basidiomycete that is an important edible and medical mushroom,2525 Wang L, Li Y, Liu D, et al. Immobilization of mycelial pellets from liquid spawn of oyster mushroom based on carrier adsorption. Horttechnology. 2011;21(1):82-86.–2727 Chai R, Qiu C, Liu D, et al. β-Glucan synthase gene overexpression and β-glucans overproduction in Pleurotus ostreatus using promoter swapping. PLOS ONE. 2013;8(4):e61693. and it has been studied as a model organism for basidiomycete genetics and genomic studies.2424 Castanera R, Omarini A, Santoyo F, et al. Non-additive transcriptional profiles underlie dikaryotic superiority in Pleurotus ostreatus laccase activity. PLOS ONE. 2013;8(9):e73282. In this study, we compared the genome-wide transcriptional profiles among the dikaryon and its two constituent monokaryons of P. ostreatus by Solexa-based RNA-Seq with a focus on the transcriptomic profiling difference analysis between the dikaryon and monokaryons, investigation of the mechanisms of the advantages of sexual reproduction, monoallelic expression, and RNA-editing in dikarya.
Materials and methods
Strains and culture conditions
Monokaryons MK13 and MK3 were from the basidiospores of P. ostreatus TD300, which is a commercial cultivation strain in China and was obtained from Zhengzhou Composite Experiment station, China Edible Fungi Research System (Zhengzhou, China). The mycelial growth rate of MK3 was faster than MK13 on potato dextrose agar (PDA) plates (Fig. 1). Dikaryon DK13 × 3 was from MK13 and MK3 through A1B1 and A2B2 mating, as identified using mating tests.2828 Kotasthane AS. A simple technique for isolation of Xanthomonas oryzae pv oryzae. J Mycol Plant Pathol. 2003;33(2):277-278. DK13 × 3 grew faster than its constituent monokaryons in PDA and formed normal fruiting bodies with a biological efficiency that was similar to TD300 in cottonseed hull medium (Fig. 2). The three strains were cultured in potato dextrose broth (150 mL in a 500-mL flask) at 25 °C under 150 rpm shaking; mycelia were harvested in the late exponential phase (10 and 25 days of culturing for dikaryon and monokaryons, respectively) for DNA or total RNA extraction.
Mycelial growth of the monokaryons and reconstituted dikaryon of Pleurotus ostreatus on PDA plates. MK13, monokaryon; MK3, monokaryon; DK13 × 3, dikaryon; TD300, dikaryon and the two monokaryons' parent; MGR, mycelial growth rate. Data are given as the means and SE of four replicates. Data with the same lower case letter do not significantly differ from other data at p < 0.05.
Fruiting body morphology and biological efficiency of TD300 and DK13 × 3 in cottonseed hull medium. Biological efficiency indicates the percentage of the fresh weight of harvested 1st and 2nd flush mushrooms over the dry weight of inoculated substrates.
RNA extraction, cDNA library construction and RNA-Seq
Mycelia were isolated from culture broth by centrifugation at 5000 × g for 10 min; 100 g of fresh mycelia was homogenized in liquid nitrogen; and total RNA was extracted using an RNA pure total RNA fast isolation kit (Bioteke, Beijing, China). The total RNA was used for RT-PCR or enrichment of mRNA (poly(A) + RNA) with a Dynabeads mRNA Purification Kit (Invitrogen, Grand Island, NY), and mRNA was then broken into short fragments. Using these short fragments as templates, first-and second-strand cDNA were synthesized. Sequencing adapters, which also served as sample markers, were ligated to short fragments after purification with a QiaQuick PCR Extraction Kit (Qiagen, Hilden, Germany). Fragments that were 200–700 bp were then separated by agarose gel electrophoresis and selected for PCR amplification as sequencing templates. The three strain libraries were sequenced using Illumina HiSeqTM 2000 by the Beijing Genome Institute (BGI) (Shenzhen, China).
Sequencing reads filtering
Raw reads contained low-quality, adaptor-polluted and high contents of unknown base (N) reads, and these noise reads should be removed before downstream analyses. We used internal software to filter reads. After filtering, the remaining reads were called "Clean Reads" and stored in the FASTQ format.
De novo assembly and sequencing assessment
Contigs were assembled from clean reads using a de novo assembler Trinity2929 Grabherr MG, Haas BJ, Yassour M, et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol. 2011;29(7):644-652.; then, non-redundant unigene sets for all three strains were constructed using the EST assembly program TGICL.3030 Pertea G, Huang X, Liang F, et al. TIGR Gene Indices clustering tools (TGICL): a software system for fast clustering of large EST datasets. Bioinformatics. 2003;19(5):651-652. An all-unigene set was produced from the three contig datasets by further sequence overlap splicing and non-redundancies.
Genome mapping and gene expression analysis
Clean reads were mapped to the reference genome sequence of Pleurotus ostreatus PC15 (http://genome.jgi-psf.org/PleosPC15_2/PleosPC15_2.home.html) using Bowtie23131 Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9(4):357-359.; then, the gene expression level was calculated using RSEM.3232 Li B, Dewey CN. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011;12(1):323.
Differential unigene expression analysis
The unigene expression levels were calculated using the Reads per kb per Million reads (RPKM) method.3333 Mortazavi A, Williams BA, McCue K, et al. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat Methods. 2008;5(7):621-628. Under the null hypothesis of equal expression between two samples, the following test gives the p-values for identifying differentially expressed genes (DEGs) between two samples.3434 Audic S, Claverie JM. The significance of digital gene expression profiles. Genome Res. 1997;7(10):986-995.
N1 is the total number of clean tags in MK3 or MK13; N2 is the number in DK13 × 3; x is the number of the clean tags of the target gene in MK3 or MK13, and y is the number in DK13 × 3. p ≤ 0.001 and |log2Ratio| ≥ 1 were used as the threshold to filter DEGs.
The DEGs expressed in all three strains were used to estimate the mid-parent expression value (MPV). The MPV was calculated by averaging the expression level of the parental monokaryons, assuming an (MK3:MK13) ratio of RNA abundance in the nucleus of Dikaryon DK13 × 3 of 1:1, as described elsewhere.3535 Pumphrey M, Bai J, Laudencia-Chingcuanco D, et al. Nonadditive expression of homoeologous genes is established upon polyploidization in hexaploid wheat. Genetics. 2009;181(3):1147-1157.
Cloning and sequencing of the urease gene
To validate the gene expression profiles obtained by RNA-seq, urease gene poure of the monokaryons and dikaryon was cloned, amplified, and sequenced. Cloning was performed by colony direct PCR3636 Izumitsu K, Hatoh K, Sumita T, et al. Rapid and simple preparation of mushroom DNA directly from colonies and fruiting bodies for PCR. Mycoscience. 2012;53(5):396-401. using primers POU1 (GCATTTTGATTGGCAGGGT) and POU2 (AGTGATTACGGCAGGGCG) at PCR conditions of 94 °C for 30 s, 51 °C for 40 s, and 72 °C for 3 min, which were repeated 31 times. mRNAs were amplified using RT-PCR with primers POU3 (TTACCGAGGGAAGAAGCGAA) and POU4 (GGTGGTGACAGAAACGGGAGTA), and PCR conditions were set at 94 °C for 30 s, 52 °C for 40 s, and 72 °C for 2 min, which was repeated 31 times. The PCR products of DNA and mRNA were purified and were then cloned into the pGEM-T Vector (Promega, Madison, WI, USA). The vectors were transformed into E. coli DH5α, and five transformants were randomly selected and sequenced by the Beijing Genome Institute (BGI) (Shenzhen, China).
Results
Quality assessment of RNA-seq datasets and mapping of the reference genome
Table 1 lists the statistics of the reads. The RNA-seq reads were of high quality; almost all mRNA fragments were sequenced, and 97% of the reads had a Phred quality score greater than 20. We mapped clean reads to the reference genome sequence of Pleurotus ostreatus PC15 (http://genome.jgi-psf.org/PleosPC15_2/PleosPC15_2.home.html) using HISAT.3737 Kim D, Langmead B, Salzberg SL. HISAT: a fast spliced aligner with low memory requirements. Nat Methods. 2015;12(4):357-360. On average, 60.44% of reads are mapped, and the uniformity of the mapping result for each sample suggests that the samples are comparable. The GenBank accession number for the RNA-seq datasets of the three strains is BioProject Accession: PRJNA326297.
Throughput and quality of RNA-Seq of the dikaryon and its constituent monokaryons of Pleurotus ostreatus.
Gene expression analysis
After genome mapping, we used StringTie3838 de Hoon MJ, Imoto S, Nolan J, Miyano S. Open source clustering software. Bioinformatics. 2004;20(9):1453-1454. to reconstruct transcripts, and with genome annotation information, we can identify novel transcripts in our samples using cuffcompare, a tool of cufflinks.3939 Saldanha AJ. Java Treeview-extensible visualization of microarray data. Bioinformatics. 2004;20(17):3246-3248. In total, we identified 4261 novel transcripts. Then, we merged novel coding transcripts with the reference transcript to obtain a complete reference, mapped clean reads using Bowtie2,4040 Pertea M, Pertea GM, Antonescu CM, et al. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol. 2015;33(3):290-295. and calculated the gene expression level for each sample with RSEM.4141 Trapnell C, Roberts A, Goff L, et al. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc. 2012;7(3):562-578. Thereupon, the total mapping ratios of the clean reads in the transcriptomes of the three strains were increased. Total transcript numbers were all more than ten thousand (Table 2).
Summary of gene expression in the dikaryon and its constituent monokaryons of Pleurotus ostreatus.
We then calculated the read coverage and read distribution on each detected transcript. The Pearson correlation between the transcriptomes of the three strains was obtained. The Pearson correlations of the dikaryon DK13 × 3 to its constituent monokaryons, MK13 and MK3, were 0.8523 and 0.8100, respectively, while the Pearson correlation between the two monokaryons was 0.8124, indicating that the expression profile in DK13 × 3 was more similar to MK13 than MK3 (Fig. 3).
Heatmap of Pearson correlations between the dikaryon and its constituent monokaryons of Pleurotus ostreatus.
Gene expression difference between the three strains
The total RPKMs of the unigenes in MK13, MK3 and DK13 × 3 were 559494, 550716, and 586583. The total RPKMs of the unigenes in DK13 × 3 were 4.8% and 6.5% higher than those in MK13 and MK3 (p < 0.05) (Fig. 4). Among the unigenes between DK13 × 3 and MK13 or MK3, the common unigenes of the three strains were 27.6%, the common unigenes for DK13 × 3 and MK13 were 10.8%, and the common unigenes for DK13 × 3 and MK3 were 11.3%. The special unigenes in DK13 × 3, MK13 and MK3 were 13.5%, 17.6%, and 15.5%, respectively. Up to 38% of unigenes in DK13 × 3 were derived from its parental monokaryons (Fig. 5), indicating that the gene expression pattern of present/absent variation occurred among the three strains, and more than one-third of the DEGs in the dikaryon were monoallelic expression genes.
Comparison of the unigene expression levels between MK3 or MK13 and DK13 × 3. Up-regulated genes, down-regulated genes, and NOT DEGs were determined using a threshold of p ≤ 0.001 and |log2Ratio| ≥ 1. A, MK3 vs DK13 × 3; B, MK13 vs DK13 × 3; NOT DEGs, Unigenes were not obviously changed upon MK3 or MK13 to DK13 × 3.
Distribution diagram of DEGs between MK3 or MK13 and DK13 × 3. DEGs were screened by a threshold of p ≤ 0.001 and |log2Ratio| ≥ 1.
Using p ≤ 0.001 and |log2Ratio| ≥ 1 as the standard to screen the differentially expressed genes (DEGs) between DK13 × 3 and MK13 or MK3, compared to MK13, the number of genes whose expression levels were up-regulated in DK13 × 3 was 11323; 7953 were up-regulated more than 3-fold, and 114 were up-regulated more than 15-fold. Additionally, 8421 genes were down-regulated; 2573 were down-regulated more than 3-fold, while none were down-regulated more than 15-fold (Fig. 6A). Compared to MK3, the number of genes whose expression was up-regulated in DK13 × 3 was 11578; 7787 were up-regulated more than 3-fold, and 116 were up-regulated more than 15-fold. Furthermore, 7425 genes were down-regulated; 2176 were down-regulated more than 3-fold, and 1 was down-regulated more than 15-fold (Fig. 6B). The results suggest that the number of up-regulated genes in the dikaryon was much higher than that of down-regulated genes, especially compared to the constituent monokaryons.
Differentially expressed genes in dikaryon DK13 × 3 compared to parental monokaryons MK13 (A) or MK3 (B). RPKM, reads per kb per million reads.
The genes in the dikaryon that were 15-fold up- or down-regulated compared with the monokaryons were examined with an NCBI online BLASTP homology analyzer. Additionally, 28 and 21 up-regulated genes were found to have related functions to annotated genes; no such genes were found for down-regulated genes. The up-regulated genes were primarily involved in macromolecule utilization, cellular material synthesis, stress resistance and signal transduction, etc. (Tables 3 and 4). These findings have provided evidence for the growth advantage that the dikaryon has over the constituent monokaryons.
Among the common DEGs of the three strains, when the DK13 × 3 levels were compared to MPV additive model values, approximately 63.0% (878/2027) of transcripts were identified to be engaged in non-additive gene expression (threshold of greater than two-fold higher/lower). A small plurality of genes, 36.8%, had lower expression levels in DK13 × 3 than expected, while 26.2% were higher and potentially upregulated (Fig. 7).
Function annotation of differentially expressed genes in dikaryon DK13 × 3 compared to its parental monokaryon MK13.
Functional annotation of differentially expressed genes in dikaryon DK13 × 3 compared to its parental MK3 monokaryon.
Scatter plots showing the expression levels of the differentially expressed genes in dikaryon DK13 × 3 vs. mid-parent expression value model estimates. RPKM, reads per kb per million reads and MPV, mid-parent expression values.
For example, we obtained the transcription profiling from the RNA-seq of the 17 laccase genes in the three strains. The gene action modes of the 17 laccase genes could be divided into the following three patterns: genes expressed in both parental monokaryons but not in the dikaryon; genes expressed in one parental monokaryon and dikaryon but not in another parental monokaryon; and genes expressed in parental monokaryons and the dikaryon. However, the total RPKMs of these laccase genes in DK13 × 3 did not present significant differences compared to the parental monokaryons (Table 5).
Laccase gene expression profile in Pleurotus ostreatus dikaryon DK13 × 3 and its parental monokaryons MK13 and MK3.
poure monoallelic expression in the dikaryon
The poure gene of the two monokaryons and mRNA of the two monokaryons and karyon were cloned and sequenced by PCR and RT-PCR. The poure gene sequences of MK13 (GenBank access number: KF312589.1) were 97% and 97% identical to those of P. ostreatus PC15 v2.0, PC9 v1.0, (http://genome.jgi-psf.org/PleosPC15_2/PleosPC15_2.home.html; http://genome.jgi-psf.org/PleosPC9_1/PleosPC9_1.home.html); those for MK3 (GenBank access number: KF312590.1) were 96% and 95% identical. The different bases between the poure gene CDS of MK13 and MK3 were 93 (Table 6). The poure mRNA sequences of MK13, MK3 and DK13 × 3 were all 100% identical to the RNA-seq results. However, the mRNA sequences and gene CDS of poure differed by 4 bases in MK13 and 12 in MK3. In MK13, the differences were two Ts to Cs and two Gs to As. In MK3, the differences were one C changing to G, four Cs to Ts, four As to Gs, and three Gs to As (Table 7). This revealed that P. ostreatus simultaneously occurred in numerous RNA editing types. Furthermore, the poure mRNA sequences of DK13 × 3 were more identical to that of MK13 than MK3, with only two different bases and one predicted amino acid to MK13, while there were 89 different bases compared to MK3. As with MK13, the mRNA sequence and gene CDS of Poure in DK13 × 3 involved 4 bases, one T to C, one C to T, and two Gs to As (Tables 6 and 7). Urease catalyzed the hydrolysis of urea into carbon dioxide and ammonia. Urease was the first enzyme to be crystallized from jack beans, and it was the first protein whose enzymatic properties were demonstrated by Sumner in 1926.4242 Karplus PA, Pearson MA, Hausinger RP. 70 years of crystalline urease: what have we learned?. Acc Chem Res. 1997;30(8):330-337. Ureases have been found in numerous bacteria, fungi, algae, plants and some invertebrates, and they have been found to help microorganisms and plants use endogenous and exogenous urea as a nitrogen source. The ammonia produced is subsequently utilized to synthesize proteins.4343 Mobley HL, Hausinger RP. Microbial ureases: significance, regulation, and molecular characterization. Microbiol Rev. 1989;53(1):85-108. Ureases of bacteria, fungi and higher plants are highly conserved.4444 Mobley HLT, Island MD, Hausinger RP. Molecular biology of microbial ureases. Microbiol Rev. 1995;59(3):451-480. In higher plants and fungi, the enzyme is encoded by a single gene.4545 Takashima K, Suga T, Mamiya G. The structure of jack bean urease. The complete amino acid sequence, limited proteolysis and reactive cysteine residues. Eur J Biochem. 1988;175(1):151-165.,4646 Wagemaker MJ, Eastwood DC, van der Drift C, et al. Expression of the urease gene of Agaricus bisporus: a tool for studying fruit body formation and post-harvest development. Appl Microbiol Biotechnol. 2006;71(4):486-492. Thus, our results showed that the poure transcript of DK13 × 3 was from the MK13 poure gene and that RNA editing also occurred (Table 6).
Sequence alignment of the poure gene CDS between the two monokaryons of Pleurotus ostreatus.
Sequence alignment of the poure gene CDS, mRNA and predicted AAs between the three strains of P. ostreatus.
Discussion
Our results showed that the global gene expression profile of dikaryon was distinct from its constituent monokaryons, and there was an expression difference in nearly two-thirds of the genes. This change was also confirmed by RT-PCR cloning and sequencing of the poure mRNA of the three strains. These results are not in agreement with previous reports,2222 Zantinge B, Dons H, Wessels JG. Comparison of poly(A)-containing RNAs in different cell types of the lower eukaryote Schizophyllum commune. Eur J Biochem. 1979;101(1):251-260.,2323 Zantinge B, Hoge JH, Wessels JG. Frequency and diversity of RNA sequences in different cell types of the fungus Schizophyllum commune. Eur J Biochem. 1981;113(2):381-389. which is probably due to the different gene expression profiling approaches. The high throughput RNA-seq was certainly more thorough and comprehensive than traditional DNA hybridization.4747 Higuchi R, Dollinger G, Walsh PS, Griffith R. Simultaneous amplification and detection of specific DNA sequences. Biotechnology (N Y). 1992;10(4):413-417.
Based on the gene transcriptional quantity, heterosis in diploids was considered to result from differential gene expression, including the following five gene expression patterns: (i) genes expressed in both parents but not in hybrids, (ii) genes expressed in one parent and hybrid but not in another parent, (iii) genes expressed in one parent but not in another parent or hybrid, (iv) genes expressed only in a hybrid but not in both parents, and (v) genes expressed in both parents and the hybrid. The first four patterns are the presence/absence variations (PAV)4848 Springer NM, Ying K, Fu Y, et al. Maize inbreds exhibit high levels of copy number variation (CNV) and presence/absence variation (PAV) in genome content. PLoS Genet. 2009;5(11):e1000734.; the fifth could be divided into additive and non-additive gene expression patterns for which hybrids showed a transcript level equal to or deviating from the mid-parent value (average of the two parents).4949 Guo M, Rupe MA, Yang XF, et al. Genome-wide transcript analysis of maize hybrids: allelic additive gene expression and yield heterosis. Theor Appl Genet. 2006;113(5):831-845.–5151 Hochholdinger F, Hoecker N. Towards the molecular basis of heterosis. Trends Plant Sci. 2007;12(9):427-432. In this study, the mycelial growth rate of P. ostreatus dikaryon DK13 × 3 was significantly higher than that of the two parental monokaryons, indicating the advantage of sexual reproduction or heterosis in the dikaryon. The total gene expression quantity in the dikaryon was 4.8% and 6.5% higher than its constituent monokaryons, and all possible modes of differential gene expression that were present in the dikaryon when compared to its constituent monokaryons, including presence/absence variation and additive/non-additive gene expression, may be contributing to heterosis. This was confirmed in previous studies.2424 Castanera R, Omarini A, Santoyo F, et al. Non-additive transcriptional profiles underlie dikaryotic superiority in Pleurotus ostreatus laccase activity. PLOS ONE. 2013;8(9):e73282.
Monoallelic expression genes have been found in a number of organisms, including humans, rodents, corn, and yeast.5252 Brem RB, Yvert G, Clinton R, et al. Genetic dissection of transcriptional regulation in budding yeast. Science. 2002;296(5568):752-755. They are on the X chromosome in female placental mammals or on autosomes,55 Chess A. Mechanisms and consequences of widespread random monoallelic expression. Nat Rev Genet. 2012;13(6):421-428. and the selection of the expressed allele may depend on the parental origin or be random.5353 Chess A. Random and non-random monoallelic expression. Neuropsychopharmacology. 2013;38(1):55-61. However, this phenomenon has not been reported in the dikaryon. Those DEGs in the dikaryon can be divided into four groups. The main group was simultaneously expressed in both of the monokaryons. The other two smaller groups were expressed in only one of two monokaryons. The fourth group was expressed in the dikaryon alone. DEGs in the dikaryon only expressing MK3 or MK13 might be regarded as monoallelic expression genes, as evidenced by RT-PCR cloning and sequencing results. For example, the poure transcript in the dikaryon was from the MK13 nucleus gene but not MK3. More than 10% of the monoallelic expression genes in the dikaryon were from each parental monokaryon. However, we could not determine whether they demonstrated autosomal random monoallelic expression, sex chromosome inactivation, or imprinted gene expression. In fungi, the chromosome containing mating genes may be deemed as the sex chromosome. In mice and humans, more than 10% of the genes have autosomal random monoallelic expression.5454 Gimelbrant A, Hutchinson JN, Thompson BR, Chess A. Widespread monoallelic expression on human autosomes. Science. 2007;318(5853):1136-1140.,5555 Zwemer LM, Zak A, Thompson BR, et al. Autosomal monoallelic expression in the mouse. Genome Biol. 2012;13(2):R10. The isozyme bands that are only present in the S. commune dikaryon were demonstrated to depend on the expression of mating genes A and B.1616 Wang C-S, Raper JR. Isozyme patterns and sexual morphogenesis in Schizophyllum. Proc Natl Acad Sci U S A. 1970;66(3):882-889. Accordingly, the relationship between the fourth group and the mating genes merits further study.
RNA-editing by base deamination has been reported in plant mitochondria and plastids (C-to-U editing)5656 Gray MW, Covello PS. RNA editing in plant mitochondria and chloroplasts. FASEB J. 1993;7(1–2):64-71. and mammals (A-to-I editing)5757 Danecek P, Nellåker C, McIntyre RE, et al. High levels of RNA-editing site conservation amongst 15 laboratory mouse strains. Genome Biol. 2012;13(4):26.; U-to-C and guanosine (G)-to-A changes, which are probably by trans-amination, are also reported in mammals.5858 Villegas J, Muller I, Arredondo J, et al. A putative RNA editing from U to C in a mouse mitochondrial transcript. Nucleic Acids Res. 2002;30(9):1895-1901.,5959 Klimek-Tomczak K, Mikula M, Dzwonek A, et al. Editing of hnRNP K protein mRNA in colorectal adenocarcinoma and surrounding mucosa. Br J Cancer. 2006;94(4):586-592. No similar cases have been found in higher fungi. In this study, our results showed that numerous types of RNA editing existed in the poure mRNA in P. ostreatus, including C-T, A-G, and C-G base substitution.
Taken together, our results suggest that the gene expression patterns in dikaryons should be similar to diploid. Finally, we strongly propose that the fungal dikaryon is a perfect experimental model for studying sex evolution and monoallelic expression due to its unique biology. The two parental monokaryons can independently live with asexual reproduction. It was proposed that the monokaryons were the temporary stage of dikaryons and had less combative ability than dikaryons,6060 Gardes M, Wong KK, Fortin JA. Interactions between monokaryotic and dikaryotic isolates of Laccaria bicolor on roots of Pinus banksiana. Symbiosis. 1990;8(3):233-250. but several species models have demonstrated that monokaryons have a similar or more combative phenotype compared to dikaryons.6161 Crockatt ME, Pierce GI, Camden RA, et al. Homokaryons are more combative than heterokaryons of Hericium coralloides. Fungal Ecol. 2008;1(1):40-48.,6262 Hiscox J, Hibbert C, Rogers HJ, Boddy L. Monokaryons and dikaryons of Trametes versicolor have similar combative, enzyme and decay ability. Fungal Ecol. 2010;3(4):347-356. Therefore, it was suggested that monokaryons with greater adaptive genetic potential may improve the combative ability to dikaryons.6363 Clark TA, Anderson JB. Dikaryons of the basidiomycetes fungus Schizophyllum commune: evolution in long-term culture. Genetics. 2004;167(4):1663-1675. In dikaryons, the two monokaryon nuclei do not fuse to karyogamy, and the two chromosomal sets only occasionally recombine during vegetative growth6363 Clark TA, Anderson JB. Dikaryons of the basidiomycetes fungus Schizophyllum commune: evolution in long-term culture. Genetics. 2004;167(4):1663-1675.; therefore, it is easy to determine the origins of alleles in a dikaryon. Although there is no paternal and maternal distinction in the mating of two compatible monokaryons, as with other sexual reproduction, the mitochondrion in almost all dikaryons is from only one monokaryon.6464 Matsumoto T, Fukumasa-Nakai Y. Mitochondrial DNA inheritance in sexual crosses of Pleurotus ostreatus. Curr Genet. 1996;30(6):549-552. The example donor can be regarded as the female parent.
Acknowledgments
This work was funded by a grant from the Natural Science Foundation of Henan Province (112300410115) and the program for Innovative Research Team (in Science and Technology) in University of Henan Province (15IRTSTHN014).
References
-
1Stajich JE, Berbee ML, Blackwell M, et al. The fungi. Curr Biol. 2009;19(18):R840-R845.
-
2Stern C. Somatic crossing over and segregation in Drosophila melanogaster. Genetics 1936;21(6):625-730.
-
3LaFave MC, Andersen SL, Stoffregen EP, et al. Sources and structures of mitotic crossovers that arise when BLM helicase is absent in Drosophila. Genetics 2014;196(1):107-118.
-
4Fellmann C, Lowe SW. Stable RNA interference rules for silencing. Nat Cell Biol 2014;16(1):10-18.
-
5Chess A. Mechanisms and consequences of widespread random monoallelic expression. Nat Rev Genet 2012;13(6):421-428.
-
6Stepanova VV, Gelfand MS. RNA editing: classical cases and outlook of new technologies. Mol Biol 2014;48(1):11-15.
-
7Chen ZJ. Genomic and epigenetic insights into the molecular bases of heterosis. Nat Rev Genet 2013;14(7):471-482.
-
8Qiu LY, Yu C, Qi YC, et al. Recent advances on fungal epigenetics. Chin J Cell Biol 2009;31(2):212-216.
-
9Nicolás FE, Torres-Martínez S, Ruiz-Vázquez RM. Loss and retention of RNA interference in fungi and parasites. PLoS Pathog 2013;9(1):e1003089.
-
10Goodenough U, Heitman J. Origins of eukaryotic sexual reproduction. Cold Spring Harb Perspect Biol 2014;6(3):a016154.
-
11Gibson G, Riley-Berger R, Harshman L, et al. Extensive sex-specific nonadditivity of gene expression in Drosophila melanogaster. Genetics 2004;167(4):1791-1799.
-
12He GM, Zhu XP, Elling AA, et al. Global epigenetic and transcriptional trends among two rice subspecies and their reciprocal hybrids. Plant Cell. 2010;22(1):17-33.
-
13Meyer RC, Witucka-Wall H, Becher M, et al. Heterosis manifestation during early Arabidopsis seedling development is characterized by intermediate gene expression and enhanced metabolic activity in the hybrids. Plant J. 2012;71(4):669-683.
-
14Paschold A, Jia Y, Marcon C, et al. Complementation contributes to transcriptome complexity in maize (Zea mays L.) hybrids relative to their inbred parents. Genome Res. 2012;22(12):2445-2454.
-
15Wang C-S, Raper JR. Protein specificity and sexual morphogenesis in Schizophyllum commune. J Bact 1969;99(1):291-297.
-
16Wang C-S, Raper JR. Isozyme patterns and sexual morphogenesis in Schizophyllum. Proc Natl Acad Sci U S A. 1970;66(3):882-889.
-
17Ross IK, Martin EM, Thoman M. Changes in isozyme patterns between monokaryons and dikaryons of a bipolar Coprinus. J Bact. 1973;114(3):1083-1089.
-
18Moore D, Jirjis RI. Electrophoretic studies of carpophore development in the basidiomycete Coprinus cinereus. New Phytol. 1981;87(1):101-113.
-
19Ullrich RC. Isozyme patterns and cellular differentiation in Schizophyllum. Mol Gen Genet 1977;156(2):157-161.
-
20Evers DC, Ross IK. Isozyme patterns and morphogenesis in higher basidiomycetes. Exp Mycol 1983;7(1):9-16.
-
21de Vries OM, Hoge JH, Wessels JG. Regulation of the pattern of protein synthesis in Schizophyllum commune by the incompatibility genes. Dev Biol 1980;74(1):22-36.
-
22Zantinge B, Dons H, Wessels JG. Comparison of poly(A)-containing RNAs in different cell types of the lower eukaryote Schizophyllum commune. Eur J Biochem 1979;101(1):251-260.
-
23Zantinge B, Hoge JH, Wessels JG. Frequency and diversity of RNA sequences in different cell types of the fungus Schizophyllum commune. Eur J Biochem 1981;113(2):381-389.
-
24Castanera R, Omarini A, Santoyo F, et al. Non-additive transcriptional profiles underlie dikaryotic superiority in Pleurotus ostreatus laccase activity. PLOS ONE 2013;8(9):e73282.
-
25Wang L, Li Y, Liu D, et al. Immobilization of mycelial pellets from liquid spawn of oyster mushroom based on carrier adsorption. Horttechnology 2011;21(1):82-86.
-
26Dong X, Zhang K, Gao Y, et al. Expression of hygromycin B resistance in oyster culinary-medicinal mushroom, Pleurotus ostreatus (Jacq.:Fr.)P. Kumm. (higher Basidiomycetes) using three gene expression systems. Int J Med Mushrooms. 2012;14(1):21-26.
-
27Chai R, Qiu C, Liu D, et al. β-Glucan synthase gene overexpression and β-glucans overproduction in Pleurotus ostreatus using promoter swapping. PLOS ONE. 2013;8(4):e61693.
-
28Kotasthane AS. A simple technique for isolation of Xanthomonas oryzae pv oryzae. J Mycol Plant Pathol. 2003;33(2):277-278.
-
29Grabherr MG, Haas BJ, Yassour M, et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol. 2011;29(7):644-652.
-
30Pertea G, Huang X, Liang F, et al. TIGR Gene Indices clustering tools (TGICL): a software system for fast clustering of large EST datasets. Bioinformatics 2003;19(5):651-652.
-
31Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9(4):357-359.
-
32Li B, Dewey CN. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform 2011;12(1):323.
-
33Mortazavi A, Williams BA, McCue K, et al. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat Methods 2008;5(7):621-628.
-
34Audic S, Claverie JM. The significance of digital gene expression profiles. Genome Res. 1997;7(10):986-995.
-
35Pumphrey M, Bai J, Laudencia-Chingcuanco D, et al. Nonadditive expression of homoeologous genes is established upon polyploidization in hexaploid wheat. Genetics 2009;181(3):1147-1157.
-
36Izumitsu K, Hatoh K, Sumita T, et al. Rapid and simple preparation of mushroom DNA directly from colonies and fruiting bodies for PCR. Mycoscience 2012;53(5):396-401.
-
37Kim D, Langmead B, Salzberg SL. HISAT: a fast spliced aligner with low memory requirements. Nat Methods 2015;12(4):357-360.
-
38de Hoon MJ, Imoto S, Nolan J, Miyano S. Open source clustering software. Bioinformatics 2004;20(9):1453-1454.
-
39Saldanha AJ. Java Treeview-extensible visualization of microarray data. Bioinformatics 2004;20(17):3246-3248.
-
40Pertea M, Pertea GM, Antonescu CM, et al. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol. 2015;33(3):290-295.
-
41Trapnell C, Roberts A, Goff L, et al. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc. 2012;7(3):562-578.
-
42Karplus PA, Pearson MA, Hausinger RP. 70 years of crystalline urease: what have we learned?. Acc Chem Res 1997;30(8):330-337.
-
43Mobley HL, Hausinger RP. Microbial ureases: significance, regulation, and molecular characterization. Microbiol Rev 1989;53(1):85-108.
-
44Mobley HLT, Island MD, Hausinger RP. Molecular biology of microbial ureases. Microbiol Rev. 1995;59(3):451-480.
-
45Takashima K, Suga T, Mamiya G. The structure of jack bean urease. The complete amino acid sequence, limited proteolysis and reactive cysteine residues. Eur J Biochem 1988;175(1):151-165.
-
46Wagemaker MJ, Eastwood DC, van der Drift C, et al. Expression of the urease gene of Agaricus bisporus: a tool for studying fruit body formation and post-harvest development. Appl Microbiol Biotechnol 2006;71(4):486-492.
-
47Higuchi R, Dollinger G, Walsh PS, Griffith R. Simultaneous amplification and detection of specific DNA sequences. Biotechnology (N Y). 1992;10(4):413-417.
-
48Springer NM, Ying K, Fu Y, et al. Maize inbreds exhibit high levels of copy number variation (CNV) and presence/absence variation (PAV) in genome content. PLoS Genet 2009;5(11):e1000734.
-
49Guo M, Rupe MA, Yang XF, et al. Genome-wide transcript analysis of maize hybrids: allelic additive gene expression and yield heterosis. Theor Appl Genet. 2006;113(5):831-845.
-
50Swanson-Wagner RA, Jia Y, DeCook R, et al. All possible modes of gene action are observed in a global comparison of gene expression in a maize F1 hybrid and its inbred parents. Proc Natl Acad Sci U S A 2006;103(18):6805-6810.
-
51Hochholdinger F, Hoecker N. Towards the molecular basis of heterosis. Trends Plant Sci. 2007;12(9):427-432.
-
52Brem RB, Yvert G, Clinton R, et al. Genetic dissection of transcriptional regulation in budding yeast. Science 2002;296(5568):752-755.
-
53Chess A. Random and non-random monoallelic expression. Neuropsychopharmacology 2013;38(1):55-61.
-
54Gimelbrant A, Hutchinson JN, Thompson BR, Chess A. Widespread monoallelic expression on human autosomes. Science 2007;318(5853):1136-1140.
-
55Zwemer LM, Zak A, Thompson BR, et al. Autosomal monoallelic expression in the mouse. Genome Biol. 2012;13(2):R10.
-
56Gray MW, Covello PS. RNA editing in plant mitochondria and chloroplasts. FASEB J. 1993;7(1–2):64-71.
-
57Danecek P, Nellåker C, McIntyre RE, et al. High levels of RNA-editing site conservation amongst 15 laboratory mouse strains. Genome Biol. 2012;13(4):26.
-
58Villegas J, Muller I, Arredondo J, et al. A putative RNA editing from U to C in a mouse mitochondrial transcript. Nucleic Acids Res. 2002;30(9):1895-1901.
-
59Klimek-Tomczak K, Mikula M, Dzwonek A, et al. Editing of hnRNP K protein mRNA in colorectal adenocarcinoma and surrounding mucosa. Br J Cancer. 2006;94(4):586-592.
-
60Gardes M, Wong KK, Fortin JA. Interactions between monokaryotic and dikaryotic isolates of Laccaria bicolor on roots of Pinus banksiana. Symbiosis 1990;8(3):233-250.
-
61Crockatt ME, Pierce GI, Camden RA, et al. Homokaryons are more combative than heterokaryons of Hericium coralloides. Fungal Ecol. 2008;1(1):40-48.
-
62Hiscox J, Hibbert C, Rogers HJ, Boddy L. Monokaryons and dikaryons of Trametes versicolor have similar combative, enzyme and decay ability. Fungal Ecol. 2010;3(4):347-356.
-
63Clark TA, Anderson JB. Dikaryons of the basidiomycetes fungus Schizophyllum commune: evolution in long-term culture. Genetics 2004;167(4):1663-1675.
-
64Matsumoto T, Fukumasa-Nakai Y. Mitochondrial DNA inheritance in sexual crosses of Pleurotus ostreatus. Curr Genet. 1996;30(6):549-552.
Publication Dates
-
Publication in this collection
Apr-Jun 2017
History
-
Received
14 June 2015 -
Accepted
20 Sept 2016