SciELO - Scientific Electronic Library Online

 
vol.49 suppl.1Phenotype-driven strategies for screening Candida parapsilosis complex for molecular identificationNon-viral microbial keratitis in adults: clinical and laboratory aspects author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Brazilian Journal of Microbiology

Print version ISSN 1517-8382On-line version ISSN 1678-4405

Braz. J. Microbiol. vol.49  supl.1 São Paulo  2018

http://dx.doi.org/10.1016/j.bjm.2018.04.002 

Clinical Microbiology

Bacteremia and meningitis caused by OXA-23-producing Acinetobacter baumannii – molecular characterization and susceptibility testing for alternative antibiotics

Kamile Francine Schuertza  1

Felipe Francisco Tuonb  1* 

Jussara Kasuko Palmeiroc  1

Danieli Contea  1

João Paulo Marochi Tellesd  1

Lucas Eduardo Trevisolia  1

Libera Maria Dalla-Costaa  c  1

aInstituto de Pesquisa Pele Pequeno Principe, Curitiba, PR, Brazil

bPontifícia Universidade Católica do Paraná, Escola de Medicina, Curitiba, PR, Brazil

cUniversidade Federal do Paraná, Hospital de Clinicas, Curitiba, PR, Brazil

dHospital de Infectologia Emilio Ribas, São Paulo, SP, Brazil

Abstract

Background:

Carbapenem-resistant Acinetobacter baumannii infection is a concern in developing countries due to high incidence, few therapeutic options, and increasing costs.

Objective:

Characterize and analyze the antibiotic susceptibility patterns of carbapenem-resistant A. baumannii isolates and evaluate clinical data of meningitis and bacteremia caused by this microorganism.

Methods:

Twenty-six A. baumannii isolates from 23 patients were identified by MALDI-TOF and automated methods and genotyped using pulsed field genotyping electrophoresis. Clinical data and outcomes were evaluated. Susceptibility of isolates to colistin, tigecycline, meropenem, imipenem, and doxycycline was determined.

Results:

Mortality due to A. baumannii infections was 73.91%; all patients with meningitis and 7/8 patients with ventilator-associated pneumonia died. All isolates were susceptibility to polymyxin (100%; MIC50, MIC90: 1 µg/mL, 1 µg/mL) and colistin (100%; MIC50, MIC90: 2 µg/mL, 2 µg/mL), and 92% were susceptible to tigecycline (MIC50, MIC90: 1 µg/mL, 1 µg/mL) and doxycycline (MIC50, MIC90: 2 µg/mL, 2 µg/mL). bla OXA-23 was identified in 24 isolates. Molecular typing showed 8 different patterns: 13 isolates belonged to pattern A (50%).

Conclusion:

Carbapenem-resistant A. baumannii infections mortality is high. Alternative antimicrobial therapy (doxycycline) for selected patients with carbapenem-resistant A. baumannii infection should be considered.

Keywords Acinetobacter baumannii; Oxacillinases; Carbapenem; Multidrug resistance; Doxycycline

Introduction

Acinetobacter baumannii healthcare associated infections (HAIs) are considered a serious public health problem owing to their prevalence and mortality in developing countries.1,2 The susceptibility of A. baumannii to the most commonly used antibiotics has decreased.3

The treatment of carbapenem-resistant A. baumannii (CR-AB) has been a challenge because carbapenem is the first option in most hospitals for empirical treatment of HAI. Consequently, older drugs with increased toxicity, including polymyxins and aminoglycosides, have been used based solely on empirical evidence.4 Doxycycline is an oral tetracycline with activity against A. baumannii and this drug can achieve therapeutic levels in cerebrospinal fluid when adequate dosage is used.5 Tigecycline is another option approved for intra-abdominal and soft tissue infections that has also been used extensively for the treatment of multidrug resistant infections at other anatomic locations. Unfortunately, clinical and antimicrobial susceptibility data are rarely evaluated together, so the true efficacy of non-carbapenem antibiotics against CR-AB is unknown. The aims of this study were to characterize the molecular types of A. baumannii isolates from cerebrospinal fluid and blood culture and to evaluate clinical data and susceptibility patterns of these isolates to treatment with polymyxin, colistin, tigecycline, doxycycline, meropenem, and imipenem.

Material and methods

Study setting

A transversal study was carried out at Hospital Universitario Evangelico de Curitiba (HUEC), a tertiary-care, trauma reference hospital, in Southern Brazil, with a total number of 660 beds. The study included patients admitted from April 2010 through April 2013. This study was approved by the Ethics Committee of FEPAR and FPP (311.769).

Clinical data

Data were collected from medical charts and/or hospital computer system databases. The clinical data evaluated included age, gender, site of infection, comorbidities, admission at intensive care unit, antimicrobial therapy, and outcome. Antimicrobial therapy was included in the analysis when it was started within 72 h of infection diagnosis. Infections where classified according to CDC criteria.6 Thirty-day mortality was also analyzed.

Microbiological studies

Twenty-six isolates of A. baumannii from 23 patients admitted at HUEC from April 2010 through April 2013 were evaluated. Nineteen isolates were obtained from blood culture and 7 from cerebrospinal fluid culture. All isolates were identified using the Vitek2® Compact System (bioMérieux, Durham, USA) and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF) using Biotyper 2.0 software (Bruker151 Daltonik Inc, Bremen, Germany).

Antibiotic susceptibility tests

Minimal inhibitory concentration (MIC) of colistin, doxycycline, imipenem, meropenem, polymyxin B and tigecycline was estimated by the agar dilution method according to the CLSI, M7-A9 approved standard.7 Polymyxin B and colistin were also tested by a broth microdilution method according to CLSI M7-A9.8 Interpretation of MIC was performed according to CLSI, M100-S24,9 except for tigecycline.10 The MIC50 and MIC90 were calculated for both the agar and broth methods. We also compared broth and agar dilution for colistin and polymyxin using a concordance level of ±≤1 log2.11

Molecular detection of oxacillinase genes

To determine oxacillinase-encoding genes, polymerase chain reaction (PCR) was performed for all isolates by using the following primers: blaOXA-23 (F-5′ GATCGGATTGGAGAACCAGA 3′; R-5′ ATTTCTGACCGCATTTCCAT 3′), blaOXA-51 (F-5′ TAATGCTTTGATCGGCCTTG 3′; R-5′ TGGATTGCACTTCATCTTGG 3′), blaOXA-58 (F-5′ AAGTATTGGGGCTTGTGCTG 3′; R-5′ CCCCTCTGCGCTCTACATAC 3′), blaOXA-143 (F-5′ TGGCACTTTCAGCAGTTCCT 3′; R-5′ TAATCTTGAGGGGGCCAACC 3′). PCR was performed in a final volume of 25 µL with a final DNA concentration of 100 ng/mL. The amplification conditions were 94 °C for 25 s, followed by 52 °C for 40 s and 72 °C for 50 s.12

Pulsed field gel electrophoresis (PFGE)

All 26 isolates were genotyped by PFGE and DNA was prepared as described previously.13 The entire chromosomal DNA of the strains was digested with 30 U of ApaI (Fermentas – Life Science, Glen Burnie, MD). PFGE was performed by using a clamped homogeneous electric field electrophoresis (CHEF) DRIII apparatus (Bio-Rad Laboratories, Hercules, USA). The conditions employed were as follows: temperature of 12 °C, voltage of 6 V/cm, run time of 30 h, and switch time of 5–35 s. The pattern of bands was interpreted according to previously described criteria.14 PFGE clustering was determined by using the unweighted-pair group method with arithmetic averages (UPGMA) and by using Dice's coefficient. The tolerance was set at 1%. Identical isolates were assigned the same capital letter. Those with 80% similarity were assigned as a subtype of the major type, followed by an Arabic number (e.g. A1, A2, A3, A4).

Results

Patient data

Twenty-six isolates from 23 patients were evaluated. The median age of patients was 42 years (10–60 years). All patients were hospitalized in the intensive care unit when clinical samples were collected. Isolates were obtained from blood culture or cerebrospinal fluid. Samples from other body sites (sputum or bronchoalveolar lavage, urine or tissue biopsy) were not evaluated. Clinical characteristics are presented in Table 1.

Table 1 Clinical and laboratorial data from 23 patients with Acinetobacter baumannii causing infection. 

Ne Sex Age Site of infection Disease HAIc Outcome Treatmentb , d Broth dilution method Agar dilution
IPM MEM DC TGC COL POL COL POL PFGE
C3 F 54 Meningitis Neoplasm Yes Death MEM, VAN, SXT, AK >32 >32 1 1 0.5 ≤0.25 0.5 0.125 D1
C6 M 23 Meningitis Trauma Yes Death AK, TGC >32 >32 1 2 0.5 0.5 2 0.25 A11
C8 F 41 Meningitis Neoplasm Yes Death MEM, VAN, POL >32 >32 ≤0.5 2 0.5 ≤0.25 1 0.25 A5
C7 M 22 Meningitis Trauma Yes Death AK, TGC, IPM >32 >32 ≤0.5 2 1 0.5 1 0.5 C3
C9 >32 >32 1 2 1 0.5 1 1 A6
H14 >32 >32 ≤0.5 2 0.5 ≤0.25 1 0.5 G1
C10 M 41 Meningitis Hydrocephalus Yes Death RIF, COL 0.5 0.5 ≤0.5 0.5 1 0.5 2 1 E2
C11 F 20 Meningitis Head trauma Yes Death MEM, VAN, POL >32 >32 1 2 1 0.5 1 0.5 B1
H2 M 42 VAPa Acute Lymphocytic Leukemia Yes Survival IPM, VAN 32 >32 1 2 1 0.5 1 0.5 F3
H7 M 49 VAP Acute Lymphocytic Leukemia Yes Death IPM, VAN >32 >32 1 2 1 2 1 0.5 A9
H8 M 49 SSTI Hemorragic stroke Yes Death RIF, TZP, VAN, POL >32 >32 ≤0.5 2 1 0.5 2 1 H1
H9 F 10 Bacteremia Burn Yes Survival AK 0.125 0.25 ≤0.5 0.5 1 ≤0.25 1 0.5 C1
H10 F 46 VAP Ureteral calculus Yes Survival LZD, MEM >32 >32 ≤0.5 2 1 1 1 0.5 C2
H18 >32 >32 ≤0.5 2 0.5 ≤0.25 1 0.25 A10
H11 M 41 Bacteremia Myelodysplasic syndrome Yes Death LZD, MEM >32 >32 1 2 0.5 0.5 1 0.5 A3
H13 M 42 Bacteremia Renal transplant No Survival CIP >32 >32 1 2 1 0.5 1 1 A3
H15 M 75 VAP Trauma Yes Death ETP >32 >32 1 2 1 0.5 2 0.25 A7
H16 M 88 Bacteremia Trauma Yes Death TZP >32 >32 1 2 0.5 ≤0.25 1 0.5 A7
H17 F 51 VAP Trauma Yes Death IPM, LZD, SXT, POL >32 >32 ≤0.5 2 0.5 ≤0.25 1 0.5 A8
H19 M 52 VAP Acute renal failure Yes Death IPM, VAN >32 >32 1 1 1 0.5 1 0.5 E1
H20 M 31 SSTI Trauma Yes Death MEM, VAN, POL >32 >32 1 2 1 ≤0.25 1 0.25 A1
H21 M 68 VAP Sarcoidosis Yes Death IPM, LZD >32 >32 1 2 1 ≤0.25 1 0.25 A4
H22 M 32 SSTI Trauma Yes Survival RIF, LZD, MEM, POL >32 >32 ≤0.5 2 0.5 0.5 1 0.25 A2
H24 M 78 UTI Acute infarct Yes Survival TZP, MEM, POL >32 >32 1 2 1 1 1 1 F1
H25 M 68 VAP Chronic renal failure Yes Death MEM, LZD >32 >32 8 4 0.5 ≤0.25 1 0.5 F1
H26 M 38 VAP HIV infection Yes Death POL, MEM >32 >32 8 4 1 0.5 1 0.5 F2

aVAP, ventilator-associated pneumonia; UTI, urinary tract infection; SSTI, skin and soft tissue infection.

bTherapy within 72 h of diagnosis of HAI.

cHAI, hospital-acquired infection.

dIPM, imipenem; MEM, meropenem; COL, colistin; POL, polymyxin; DC, doxycycline; AK, amikacin; LZD, linezolid; ETP, ertapenem; VAN, vancomcycin; TZP, piperacillin-tazobactam; SXT, sulfamethoxazole/trimetoprim; CIP, ciprofloxacin; RIF, rifampin.

eH, blood sample; C, cerebrospinal fluid.

Meningitis

Six patients presented with nosocomial meningitis. The median age was 33 years (15–56 years) with 3 females and 3 males. All patients presented with meningitis secondary to external ventricular shunt due to head trauma or neoplasm with a mortality rate of 100%. All strains in these patients were susceptible to polymyxins (colistin and polymyxin) and doxycycline. When bacterial susceptibility to polymyxins was taken into account, 3 patients received the correct treatment. The 3 remaining patients were treated with carbapenems, and the MIC of this antibiotic was determined to be >32 mg/L in all strains isolated from these patients. There was no clonality shared among the meningitis cases. In one patient with A. baumannii meningitis, the clone isolated from cerebrospinal fluid was identical to one found in blood culture and another cerebrospinal fluid sample that was obtained 5 days later (Clone A).

Bacteremia

Seventeen patients presented with A. baumannii bacteremia, 4 of them primary and 13 of them secondary to infection at another site. Ventilator-associated pneumonia (VAP) with secondary bacteremia was the most common infection (9 cases), followed by secondary bacteremia caused by skin and soft tissue infection (3 cases) and urinary tract infection (1 case). The median age of patients was 50 years (10–60 year), with 14 males and 3 females. There was no clonal association with a specific site of infection. Considering the therapeutic and microbiological aspect of bacteremic patients, 7 patients received correct therapy within 72 h (41.17%). The mortality of patients with A. baumannii bacteremia was 64.70%; specifically, 7 of 9 patients with VAP, and 1 of 3 with skin-soft tissue infections died. There was no correlation of survival with correct antibiotic therapy within first hours of culture sample. There was no clonality among cases of A. baumannii bacteremia.

Antimicrobial susceptibility

More than 90% of isolates were resistant to carbapenem (MIC50 and MIC90 > 32 µg/mL).

Isolates were susceptibility to polymyxin and colistin (MIC50 and MIC90 = 1 µg/mL for polymyxin; MIC50 = 0.5 µg/mL and MIC90 = 1 µg/mL for colistin). Broth and agar dilutions for colistin and polymyxin susceptibility showed a high concordance level (100%).

Bacterial isolates also had susceptibility to tigecycline and doxycycline (MIC50 and MIC90 = 1 µg/mL for tigecycline; MIC50 and MIC90 = 2 µg/mL for doxycycline). Only two samples were resistant to these drugs.

PCR amplified bla OXA-51 in all isolates. The bla OXA-23 gene was amplified in all 24 isolates resistant to carbapenem, but was not detected in the two isolates susceptible to carbapenem.

PFGE

Molecular typing with PFGE revealed 8 distinct patterns with 80% similarity (see dendrogram, Fig. 1). Thirteen isolates belong to pattern A (50%), including 11 subtypes. Other patterns (B, C, D, E, F, G and H) were found in 1, 3, 1, 2, 4, 1 and 1 samples, respectively. Both isolates of carbapenem-susceptible A. baumannii showed 70.3% similarity (patterns G and H)

Fig. 1 Dendrogram of 26 isolates from 23 patients with Acinetobacter baumannii causing infection. See Table 1 to correlation of isolates and site of infection. 

Discussion

Carbapenem-resistant A. baumannii infections are severe and result in high mortality in critically ill patients. All patients with meningitis ultimately died despite adequate therapy, a mortality rate previously described by our group.15 The outcome is not different for bacteremia, although previous studies have shown that delay in the adequate therapy can reduce the mortality.16 Carbapenem-resistant A. baumannii is becoming increasingly prevalent in Brazil, and more than 60% of strains in some areas are resistant. OXA-23 carbapenemase has been described as endemic since 2003 in Southern Brazil17 and was identified in all carbapenem-resistant A. baumannii in other publications.18 The current study confirms that this oxacillinase is prevalent and probably the main mechanism of carbapenem resistance. However, isolates from some hospitals have a different carbapenemase profile, including a low prevalence of OXA-23 in A. baumannii.19

Out of 26 isolates, 24 were susceptible to doxycycline and two isolates showed intermediate resistance. Timurkaynak et al. found a similar doxycycline susceptibility pattern in A. baumannii,20 this drug has a bactericidal effect against A. baumannii in some isolates, including carbapenem-resistant strains.21 Although minocycline has been more potent against Acinetobacter, this tetracycline is not available in Brazil.

In our study, there was a high concordance between susceptibility to colistin and polymyxin, but we did not test resistant isolates. Similar results were described by Gales et al., who reported 94.3% concordance in susceptibility to these drugs.11 Furthermore, among the 26 isolates of A. baumannii, 5 showed skipped well phenomena for colistin and 8 for polymyxin (data not shown). This phenomenon occurs when these drugs are tested in broth microdilution and is associated with hetero-resistance.22

PFGE demonstrated a predominant clone (A) with the remaining isolates characterized as related clones. The mechanism of carbapenem resistance was associated with the presence of the gene bla OXA-23, although we cannot exclude combined mechanisms such as pump efflux and porin loss.23

The question of whether to use combined therapy to treat Acinetobacter infections remains unanswered. In vitro studies are controversial and clinical studies are comprised of retrospective cohorts with small sample numbers. However, in the context of multidrug-resistant Acinetobacter, few options are available, mainly for hard-to-treat infections, like meningitis. Tigecycline has a low penetration into cerebrospinal fluid.24 Tigecycline is also contra-indicated for the treatment of primary bacteremia as peak concentration of less than 1 mg/L can be achieved, an insufficient level for treatment of bloodstream infection. Furthermore, sub-therapeutic concentrations are associated with increasing resistance.25 Polymyxin is the drug primarily used for treatment of CR-AB. The use of polymyxin B is less reported than that of colistin, although this drug has shown successful results with less acute renal injury than colistin.26 However, to date, there are no reports regarding the penetration of polymyxin B, the most common polymyxin used in Brazil, in the central nervous system. Colistin has been used for the treatment of meningitis with reasonable outcomes.26 Despite the presence of a susceptibility pattern to polymyxins in most of our isolates, these drugs should be cautiously used due to increasing resistance, nephrotoxicity, and neurotoxicity. When these drawbacks are taken into consideration, doxycycline is an attractive alternative for or potential addition to other active drugs to treat nosocomial meningitis.

In summary, A. baumannii infections in our patient cohort resulted in high mortality, and carbapenem resistance was frequent in these severe infections. OXA-23 continues to be the main mechanism of resistance of A. baumannii in this region of the Brazil, with a predominant clonal pattern. Fortunately, alternative drugs are available for use under specific conditions that must be decided by experts.

1All authors meet the ICMJE authorship criteria.

Ethical approval

Yes (2014 – 0118)

Informed consent

N/A

Funding

None.

References

1 Climaco EC, Oliveira ML, Pitondo-Silva A, et al. Clonal complexes 104, 109 and 113 playing a major role in the dissemination of OXA-carbapenemase-producing Acinetobacter baumannii in Southeast Brazil. Infect Genet Evol. 2013;19:127-133. [ Links ]

2 Fournier PE, Richet H. The epidemiology and control of Acinetobacter baumannii in health care facilities. Clin Infect Dis. 2006;42(5):692-699. [ Links ]

3 Maragakis LL, Perl TM. Acinetobacter baumannii: epidemiology, antimicrobial resistance, and treatment options. Clin Infect Dis. 2008;46(8):1254-1263. [ Links ]

4 Fernandez-Cuenca F, Tomas-Carmona M, Caballero-Moyano F, et al. [In vitro activity of 18 antimicrobial agents against clinical isolates of Acinetobacter spp.: multicenter national study GEIH-REIPI-Ab 2010]. Enferm Infec Microbiol Clin. 2013;31(1):4-9. [ Links ]

5 Karlsson M, Hammers S, Nilsson-Ehle I, Malmborg AS, Wretlind B. Concentrations of doxycycline and penicillin G in sera and cerebrospinal fluid of patients treated for neuroborreliosis. Antimicrob Agents Chemother. 1996;40(5):1104-1107. [ Links ]

6 Emori TG, Culver DH, Horan TC, et al. National nosocomial infections surveillance system (NNIS): description of surveillance methods. Am J Infect Control. 1991;19(1):19-35. [ Links ]

7 CLSI (Clinical and Laboratory Standards Institute). Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically; Approved Standard—Tenth Edition (M07-A9). Clinical and Laboratory Standard Institute; 2012. [ Links ]

8 CLSI. Clinical and Laboratory Standards Institute. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically; Approved Standard—Tenth Edition (M07-A10). Clinical and Laboratory Standard Institute; 2015. [ Links ]

9 CLSI (Clinical and Laboratory Standards Institute). Performance Standards for Antimicrobial Susceptibility Testing. Approved Standard M100-S24. Clinical and LaboratoryStandard Institute; 2014. [ Links ]

10 Marchaim D, Pogue JM, Tzuman O, et al. Major variation in MICs of tigecycline in Gram-negative bacilli as a function of testing method. J Clin Microbiol. 2014;52(5):1617-1621. [ Links ]

11 Gales AC, Reis AO, Jones RN. Contemporary assessment of antimicrobial susceptibility testing methods for polymyxin B and colistin: review of available interpretative criteria and quality control guidelines. J Clin Microbiol. 2001;39(1):183-190. [ Links ]

12 Woodford N, Ellington MJ, Coelho JM, et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents. 2006;27(4):351-353. [ Links ]

13 Kaufmann ME. Pulsed-field gel electrophoresis. In: Woodford N, Johnson AP, eds. Molecular Bacteriology: Protocols and Clinical Applications. Vol 15. Humana Press; 1998:33–51. [ Links ]

14 Tenover FC, Arbeit RD, Goering RV, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol. 1995;33(9):2233-2239. [ Links ]

15 Tuon FF, Penteado-Filho SR, Amarante D, Andrade MA, Borba LA. Mortality rate in patients with nosocomial Acinetobacter meningitis from a Brazilian hospital. Braz J Infect Dis. 2010;14(5):437-440. [ Links ]

16 Tuon FF, Rymsza AM, Penteado-Filho SR, Pilonetto M, Arend LN, Levin AS. Should polymyxin be used empirically to treat infections in patients under high risk for carbapenem-resistant Acinetobacter?. J Infect. 2011;62(3):246-249. [ Links ]

17 Schimith Bier KE, Luiz SO, Scheffer MC, et al. Temporal evolution of carbapenem-resistant Acinetobacter baumannii in Curitiba, southern Brazil. Am J Infect Control. 2010;38(4):308-314. [ Links ]

18 Cieslinski JM, Arend L, Tuon FF, et al. Molecular epidemiology characterization of OXA-23 carbapenemase-producing Acinetobacter baumannii isolated from 8 Brazilian hospitals using repetitive sequence-based PCR. Diagn Microbiol Infect Dis. 2013;77(4):337-340. [ Links ]

19 Werneck JS, Picao RC, Girardello R, et al. Low prevalence of blaOXA-143 in private hospitals in Brazil. Antimicrob Agents Chemother. 2011;55(9):4494-4495, author reply 5. [ Links ]

20 Timurkaynak F, Can F, Azap OK, Demirbilek M, Arslan H, Karaman SO. In vitro activities of non-traditional antimicrobials alone or in combination against multidrug-resistant strains of Pseudomonas aeruginosa and Acinetobacter baumannii isolated from intensive care units. Int J Antimicrob Agents. 2006;27(3):224-228. [ Links ]

21 Bantar C, Schell C, Posse G, Limansky A, Ballerini V, Mobilia L. Comparative time-kill study of doxycycline, tigecycline, sulbactam, and imipenem against several clones of Acinetobacter baumannii. Diagn Microbiol Infect Dis. 2008;61(3):309-314. [ Links ]

22 Hawley JS, Murray CK, Griffith ME, et al. Susceptibility of acinetobacter strains isolated from deployed U.S. military personnel. Antimicrob Agents Chemother. 2007;51(1):376-378. [ Links ]

23 Zarrilli R, Crispino M, Bagattini M, et al. Molecular epidemiology of sequential outbreaks of Acinetobacter baumannii in an intensive care unit shows the emergence of carbapenem resistance. J Clin Microbiol. 2004;42(3):946-953. [ Links ]

24 Pallotto C, Fiorio M, D’Avolio A, et al. Cerebrospinal fluid penetration of tigecycline. Scand J Infect Dis. 2014;46(1):69-72. [ Links ]

25 Navon-Venezia S, Leavitt A, Carmeli Y. High tigecycline resistance in multidrug-resistant Acinetobacter baumannii. J Antimicrob Chemother. 2007;59(4):772-774. [ Links ]

26 Falagas ME, Kasiakou SK. Colistin: the revival of polymyxins for the management of multidrug-resistant gram-negative bacterial infections. Clin Infect Dis. 2005;40(9):1333-1341. [ Links ]

Received: August 1, 2017; Accepted: April 3, 2018; pub: April 24, 2018

*Corresponding author. E-mail: tuon@ufpr.br (F.F. Tuon).

Associate Editor: Afonso Barth

Conflict of interest

Felipe Tuon is a CNPQ researcher.

There is not conflict of interest.

Creative Commons License This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial No Derivative License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium provided the original work is properly cited and the work is not changed in any way.