SciELO - Scientific Electronic Library Online

 
vol.17 issue3Physical fitness profile of Le Parkour practitionersLow-intensity swimming training does not protect the skeletal muscle against exhaustive exercise-induced injuries in rats author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Article

Indicators

Related links

  • Have no similar articlesSimilars in SciELO

Share


Revista Brasileira de Medicina do Esporte

Print version ISSN 1517-8692

Rev Bras Med Esporte vol.17 no.3 São Paulo May/June 2011

http://dx.doi.org/10.1590/S1517-86922011000300011 

ARTIGO ORIGINAL
CIÊNCIAS DO EXERCÍCIO E DO ESPORTE

 

O exercício físico melhora a sensibilidade à insulina de ratos expostos à fumaça de cigarro

 

 

Patrícia Ebersbach SilvaI; Thâmara AlvesI; Ágatha Tomoko Sakata FonsecaI; Márcia Aparecida do Nascimento OliveiraII; Ubiratan Fabres MachadoII; Patrícia Monteiro SeraphimI

IDepartamento de Fisioterapia FCT/ UNESP - Presidente Prudente SP - Brasil
IIDepartamento de Fisiologia e Biofísica - ICB-1 / USP -São Paulo SP - Brasil

Correspondência

 

 


RESUMO

INTRODUÇÃO E OBJETIVO: Sabe-se que o tabagismo pode provocar alterações cardiovasculares e redução na sensibilidade à insulina, e que o exercício físico melhora este quadro. O objetivo do estudo foi avaliar o efeito do tabagismo e da prática de atividade física sobre a sensibilidade à insulina em músculo cardíaco de ratos, através da avaliação de expressão do transportador de glicose GLUT4.
MÉTODOS: Ratos machos Wistar foram divididos em quatro grupos: (CS) controle, (CE) controle exercitado, (FS) fumante sedentário e (FE) fumante submetido ao exercício físico. Os grupos FS e FE foram submetidos à combustão de quatro cigarros/30 min/60 dias, 2x/dia. Os grupos CE e FE executaram corrida em esteira rolante durante 60 min/60 dias. Foi realizado teste de tolerância à insulina, e a expressão de GLUT4 no coração foi feita através de Western Blotting - ECL e RT-PCR. Foi utilizado método estatístico descritivo e o teste ANOVA, e as diferenças entre os grupos foram consideradas significantes quando P < 0,05.
RESULTADOS: Nem o tabagismo nem a atividade física alteraram o peso corpóreo (CS: 364,7 ± 9,7; CE: 372,4 ± 7,2, FS: 368,9 ± 6,7; FE: 376,4 ± 7,8g) e o peso do coração (CS: 1,12 ± 0,05; CE: 1,16 ± 0,04; FS: 1,14 ± 0,05; FE: 1,19 ± 0,05g). A sensibilidade à insulina foi reduzida no grupo fumante, porém, a prática de exercício físico melhorou este quadro (CS: 3,7 ± 0,3; CE: 5,28 ± 0,5*; FS: 2,1 ± 0,7*; FE: 4,8 ± 0,09** %/min; *P < 0,05 vs. CS, **P < 0,05 vs. FS). Os conteúdos de RNAm e de proteína não se alteraram entre os grupos. Porém, quando se calculou o conteúdo total de proteína GLUT4 por grama de tecido, observou-se que o tabagismo causou redução e que o exercício induziu aumento neste parâmetro (CS: 119,72 ± 9,98; CE: 143,09 ± 9,09; FS: 84,36 ± 10,99*; FE: 132,18 ± 11,40# UA/g tecido, *P < 0,05 vs. CS, #P < 0,01 vs. FS).
CONCLUSÃO: Conclui-se que o tabagismo reduz a sensibilidade à insulina e a capacidade do coração captar glicose. Já a prática de exercício físico moderado reverte este quadro por completo.

Palavras-chave: transportador de glicose, tabagismo, resistência à insulina, GLUT4.


 

 

INTRODUÇÃO

O tabagismo é hoje um dos principais problemas de saúde pública. É notória a participação do tabaco no aumento e/ou agravamento de doenças cardiovasculares, pulmonares, circulatórias e numerosos tipos de câncer, contribuindo para o incremento da morbidade e mortalidade populacional(1).

Sabe-se que o tabagismo altera o metabolismo celular em vários aspectos, entre os quais se pode observar alteração na sensibilidade à insulina com desenvolvimento de estado de resistência ao hormônio, o qual, se não cuidado em tempo hábil, poderia culminar no desenvolvimento de um quadro de diabetes tipo 2(2-4). O fumo é, claramente, associado com aumento da gordura abdominal (maior relação cintura-quadril)(5,6), aumento de ácidos graxos livres e mobilização de glicerol, quadro de dislipidemias (aumento de LDL e diminuição de HDL), disfunção endotelial, aumento na viscosidade sanguínea e estado de hipercoagulabilidade(7,8). O tabagismo está associado também a um quadro de inflamação sistêmica de baixo grau(9) e estresse oxidativo(10), caracterizado pelo aumento de citocinas pró-inflamatórias(11). A literatura aponta que o aumento de citocinas pró-inflamatórias participa na gênese da resistência à insulina, uma vez que podem interferir na sinalização insulínica(12-14).

Sabe-se que, no nível celular, a resistência insulínica está associada à alteração na via de sinalização insulínica, à redução da expressão do transportador de glicose GLUT4 ou à alteração na translocação do GLUT4 para a membrana plasmática de células adiposas e musculares, o que, em última instância, provoca menor ação biológica do hormônio, atrapalhando a homeostasia da glicose(15,16).

A atividade contrátil também estimula a captação de glicose, promovendo maior quantidade de transportadores de glicose GLUT4 no sarcolema pelo aumento de translocação, independentemente da presença de insulina(17). Estudos sugerem que existam diferentes compartimentos intracelulares de GLUT4, um estimulado por insulina e outro estimulado pelo exercício, e que a combinação dos dois resulta em efeitos aditivos em relação ao transporte de glicose(18,19). Há evidências de que, devido ao aumento na proporção entre [AMP]:[ATP] e [creatina]:[fosfocreatina] pelas necessidades teciduais durante a contração muscular, ocorre a ativação de uma cinase denominada proteína cinase dependente de 5'-AMP (AMPK) a qual participaria da translocação do GLUT4 estimulada pela atividade(18,20).

O coração sendo um tecido muscular muito ativo é um ótimo captador de glicose. Sabe-se que o tabagismo é uma das principais causas de doenças cardiovasculares e circulatórias. Um aumento na expressão de transportador de glicose GLUT4 em músculo cardíaco aumenta a oxidação de glicose no miocárdio, favorecendo a performance cardíaca(21). Assim, a prática de atividade física aparece como um método importante para combater os malefícios causados pelo fumo, modificando o risco dos indivíduos tabagistas para o desenvolvimento de resistência à insulina e provável quadro de diabetes, bem como melhorando a capacidade cardíaca.

Dentro deste contexto, este trabalho teve por objetivo quantificar a proteína e o RNAm do GLUT4 no músculo cardíaco de ratos tabagistas e submetidos à atividade física moderada em esteira rolante para caracterização da sensibilidade à insulina periférica e possível papel do tecido cardíaco.

 

MÉTODOS

Animais e programa de treinamento: Ratos machos Wistar foram mantidos em biotério à temperatura média de 22 ± 2ºC, com ciclos de 12 horas de luminosidade, sendo das 7:00 às 19:00 horas (período claro) e 19:00 às 7:00 horas (período escuro), e alimentados com ração padrão e água fornecida ad libitum. Os animais foram divididos em quatro grupos: (CS) controle sedentário, (CE) controle exercitado, (FS) fumante sedentário e (FE) fumante exercitado. Os grupos FS e FE foram submetidos à combustão de quatro cigarros/vez, por 30 minutos, duas vezes/dia, durante 60 dias. Como câmara de inalação para o fumo passivo foi utilizada uma caixa fechada dividida em dois compartimentos. Um dos compartimentos da caixa foi utilizado para a colocação de quatro cigarros acesos em um suporte, e o outro compartimento foi destinado à alocação dos animais. Do lado que ficaram os cigarros, foi conectada uma fonte de ar comprimido com fluxo de 10L/min permitindo a combustão dos cigarros e propiciando a condução da fumaça para o outro lado da caixa, onde estavam os animais. No compartimento dos animais havia também um orifício de drenagem de ar, por onde era feita a exaustão da mistura.

Os grupos CE e FE executaram protocolo de corrida em esteira rolante para animais de pequeno porte. A esteira foi acionada por um motor de 12V que proporcionou uma velocidade de 10 metros por minuto para o deslizamento da lona e consequentemente movimento induzido do animal em estudo. A sessão de treinamento teve duração de 60 minutos, realizado durante 60 dias, cinco dias por semana, sendo caracterizado como exercício físico moderado, já que não houve aumento de intensidade.

Todos os procedimentos experimentais foram aprovados pelo Comitê de Ética em Pesquisa da FCT-UNESP, Campus de Presidente Prudente, processo 262/2008.

Avaliação da sensibilidade à insulina: Para a avaliação da sensibilidade à insulina in vivo, foi realizado um teste de tolerância à insulina (ITT). Uma semana antes do sacrifício, seis animais de cada grupo foram anestesiados intraperitonealmente (i.p.) com cloridrato de quetamina e Cloridrato de xilazina (60mg/kg PC). Foi realizada pequena secção na extremidade distal da cauda dos animais para coleta das amostras de sangue. A primeira coleta foi realizada antes da administração de insulina (basal). Posteriormente, 0,5UI/kg PC de insulina regular (Novolin 100U/ml, Novo Nordisk, Dinamarca) foi administrada. A dosagem de glicemia foi realizada a cada cinco minutos, nos tempos 0 (basal) a 20 min após a administração de insulina. A glicemia foi verificada por meio de tiras reagentes e glicosímetro (Biocheck TD-4225 / Bioeasy Diagnóstica Ltda. / MG - Brasil). Posteriormente, foi calculada a constante de decaimento (kITT, %/min.) a partir da regressão linear das concentrações de glicemia obtidas durante o teste(22).

Obtenção de amostras: Após 24 horas da última sessão de treinamento, os animais foram anestesiados com cloridrato de quetamina e cloridrato de xilazina (60mg/kg PC) i.p. para a obtenção das amostras de sangue e tecido. Após a anestesia, foi feita a remoção do músculo cardíaco, e separados 0,1g para RT-PCR, e o restante para Western Blotting.

Quantificação de proteína GLUT4 - Western Blotting: A amostra foi pesada, homogeneizada e centrifugada em tampão TRIS HCl 10mM; EDTA 1mM, sacarose 250mM, pH 7,4 obtendo-se fração total de membranas celulares(22). A concentração de proteína total foi detectada pelo método de Lowry(23). Quantidades iguais de proteínas foram solubilizadas em tampão Laemmli, sujeitas a SDS-PAGE (10%) e então transferidas para membrana de nitrocelulose Hybond-C Super (GE healthcare, AMERSHAM Biosciences, UK). Após bloqueio durante uma hora com 3% de leite desnatado, as membranas foram incubadas com anticorpo anti-GLUT4 (Chemicon International, Temecula California, EUA), diluição 1:3000 em PBS (NaCl 0,8%, Na2HPO4[12H2O] 0,115%, KCl 0,02%, KH2PO4 0,02%), adicionado de albumina bovina sérica (BSA 8%), durante três horas a 37ºC. Foi feita incubação com o anticorpo secundário (anti-IgG de coelho), marcado com enzima peroxidase (HRP) (GE Helthcare, Amersham, UK), diluído 1:6000 em solução bloqueadora durante uma hora. Após lavagem em tampão, a membrana foi exposta à reação de ECL (Luminol 1,1%, Ácido P-Cumárico 0,48%, Tris 1M pH 8,5 11,1%, H2O destilada) por dois minutos e posteriormente exposta ao Hyperfilm (IGF - Corporation, New Jersey, EUA) para detecção das bandas resultantes. O filme foi fotografado por uma câmera (Gel Logic 100, Kodak Molecular Imaging, EUA) e as imagens foram analisadas por densitometria utilizando-se o software Scion Image for Windows (Scion Corporation, EUA).

RT-PCR: Semi-Quantificação do RNAm do GLUT4: As amostras de tecidos musculares foram processadas em homogeneizador modelo OMNI TH - EUA (Lodan) com TRIZOL Reagent (Invitrogen, EUA) para extração de RNA total. Em seguida foi realizado o ensaio de RT-PCR. A transcrição reversa foi feita de acordo com as instruções do manufaturante (Invitrogen, EUA), utilizando-se cinco microgramas de RNA total extraído do coração, enzima RT M-MLV Reverse Transcriptase (200 U/mL; Invitrogen®, EUA), e mistura de dNTPs (10mM cada). Alíquotas de um microlitro do produto final de RT (cDNA), foi adicionado à mistura de 10pmol/µL primers específicos do GLUT4 (Sense: 5'- CCCCTCCAGGGCAAAGGAT - 3'; Antisense: 5'-TCCTGGAGGGGAACAAGAA - 3' - fragmento de 203pb), tampão específico, mistura de dNTPs (10 mM), enzima GoTaq DNA Polymerase 5U/µL (Promega, EUA), e água destilada, em um volume final de 50µL. As reações de PCR foram realizadas em termociclador marca Techne, modelo Endurance TC-312 (Techne Inc. New Jersey, EUA) em diferentes temperaturas, com 28 ciclos, e 54 ºC de temperatura de anelamento. Os produtos amplificados foram submetidos à eletroforese em gel de agarose 2,0% e brometo de etídio 0,02%. As amostras no gel foram visualizadas com luz UV, e as imagens adquiridas em equipamento de fotovideodocumentação (Mod. Gel Logic 100 c/ epi-iluminescência, Kodak Molecular Imaging, EUA). A expressão do RNA do gene do GLUT4 foi normalizada pela expressão do gene da proteína constitutiva β-actina (Sense: 5' - ATGAAGATCCTGACCGAGCGTG - 3'; Antisense: 5' - CTTGCTGATCCACATCTGCTGG - 3'; fragmento de 512pb; temperatura de anelamento: 54ºC, e 24 ciclos), calculada pela razão entre os valores da densitometria do gene de interesse e do gene constitutivo.

Análise estatística: Para análise dos dados foi utilizado o método estatístico descritivo, com os resultados apresentados como média ± EPM. A avaliação estatística dos resultados foi feita através da comparação das médias, utilizando o teste ANOVA, paramétrico, com pós-teste quando necessário (Bonferroni). As diferenças entre os grupos foram consideradas significantes quando o valor de P foi menor que 0,05.

 

RESULTADOS

Como verificado na tabela 1, o peso corpóreo médio e o peso do tecido cardíaco no dia do sacrifício não diferiram entre os grupos estudados, evidenciando que nem o tabagismo imposto nem o exercício físico tiveram efeitos sobre parâmetros morfométricos dos animais estudados. A glicemia de jejum também foi semelhante para todos os grupos.

A constante de decaimento da glicemia (kITT) (figura 1) evidenciou menor sensibilidade periférica à insulina no grupo FS comparado aos demais grupos (CS: 3,7 ± 0,3; CE: 5,3 ± 0,5*; FS: 2,1 ± 0,7* #; FE: 4,8 ± 0,098* &; n = 6, *P < 0,05 vs. CS, #P < 0,03 vs. CE; &P < 0,05 vs. FS). Já o exercício físico reverteu este quadro.

 

 

O tabagismo imposto não foi suficiente para causar alteração no conteúdo de RNAm do transportador de glicose GLUT4 quando comparado ao grupo não-fumante (CS). Também não foi observada alteração no conteúdo de RNAm de GLUT4 nos grupos exercitados CE e FE quando comparados aos seus respectivos pares CS e FS (CS: 75,7 ± 9,7; CE: 82,12 ± 8,5; FS: 75,9 ± 7,08; FE: 76,73 ± 7,8 UA, n = 10) (figura 2).

 

 

Avaliando a quantidade de proteína GLUT4 expressa em unidades arbitrárias por µg de proteína (UA/µg de proteína), não foram observadas diferenças significantes entre os grupos (CS: 100,9 ± 6,2; CE: 109,2 ± 4,7; FS: 95,9 ± 7,3; FE: 107,9 ± 6,4 UA, n = 10), evidenciando uma clara correlação entre conteúdo de proteína e conteúdo de RNAm para o gene do GLUT4 no tecido cardíaco (Figura 3).

 

 

A partir destes resultados expressos em UA/µg de proteína e de valores de recuperação proteica, calculou-se o conteúdo total de GLUT4 por grama de tecido cardíaco(22). Observou-se que o fumo causou uma redução, e que o exercício provocou um aumento significante do conteúdo total de GLUT4 por grama de tecido cardíaco (CS: 119,72 ± 9,98; CE: 143,09 ± 9,09; FS: 84,36 ± 10,99*; FE: 132,18 ± 11,40# UA/g tecido, *P < 0,05 vs. CS, #P < 0,01 vs. FS, n = 10 animais) (Figura 4).

 

 

DISCUSSÃO

Um crescente corpo de evidências indica que o tabagismo, tanto ativo quanto passivo, está associado com um quadro de resistência à insulina e diminuição da tolerância à glicose(3,4,8). A resistência à insulina (RI) é uma característica da síndrome metabólica (SM) e diabetes tipo 2 (DM2) e envolve tecidos-alvos, tais como tecido adiposo, fígado, músculos esquelético e cardíaco(24).

O fumo provoca inflamação das vias aéreas e inflamação sistêmica de baixo grau(9) pela ativação de macrófagos, neutrófilos e linfócitos T, que liberam proteases e espécies reativas de oxigênio (ROS). O aumento do estresse oxidativo leva a ativação de fatores de transcrição redox-sensíveis, que são críticos para a transcrição de citocinas pró-inflamatórias(11). Há relatos de que a secreção destas citocinas pró-inflamatórias participa na gênese da RI(14) e estudos mostraram que a reação inflamatória subclínica com presença de IL-1, IL-6 e TNF-α tem um papel importante da patogênese do DM2(25).

A literatura atual apresenta que o exercício físico tem sido recomendado para a prevenção e tratamento da RI e DM2, uma vez que pode aumentar a capacidade de transporte de glicose pelo músculo independente da ação insulina(26), através de aumento de expressão e translocação de transportadores de glicose GLUT4 para a membrana plasmática dos cardiomiócitos(16).

No presente estudo, o peso dos animais estudados não variou entre os grupos. Uma provável hipótese para isso ter ocorrido seria o tempo (60 dias) de tabagismo ao que os animais foram expostos no estudo. Talvez este tempo de exposição não tenha sido o suficiente para afetar a ingestão alimentar e, portanto, causar redução na incorporação de massa nos animais estudados, não ocorrendo, portanto, variação no peso corpóreo. Porém, na literatura(27), foi verificado que o peso e o consumo alimentar de ratos machos expostos à fumaça por apenas 30 dias foram inferiores aos dos não-expostos.

Embora a glicemia de jejum não esteja alterada com o tabagismo, foi verificada uma importante redução na sensibilidade à insulina dos animais fumantes. Já o exercício físico moderado melhorou este quadro na presença e na ausência de tabagismo, demonstrando que a prática de exercício físico é fundamental para melhorar a homeostasia glicêmica e aumentar a sensibilidade periférica à insulina. Estudos apontam que o exercício físico determina melhora na ação insulínica(28) e que, no coração, os estímulos contrátil e hipóxico provocados pelo exercício levam à translocação de GLUT4 à membrana plasmática pela via sinalizadora da AMPK (proteína quinase AMP-ativada)(16). O fator desencadeador da queda na sensibilidade à insulina frente à exposição à fumaça de cigarro ainda precisa ser determinado.

Pela análise dos resultados de conteúdo de proteína GLUT4 em UA/µg de proteína, verificou-se que o fumo não alterou a expressão de transportador na musculatura cardíaca. Estes resultados se correlacionam com conteúdo de RNAm encontrado no grupo fumante. Estudos na literatura apontam que a nicotina pode interferir na translocação do GLUT4, mas não diretamente em sua expressão(29). Assim, os resultados aqui encontrados, a priori, condizem com os relatos da literatura.

Contudo, quando se analisou o conteúdo total de GLUT4 por grama de tecido cardíaco, o que representa a capacidade do tecido em captar glicose, verificou-se que o fumo causou redução de 24% comparado ao controle, e que a prática de exercício físico associado ao tabagismo causou aumento de 56%. Ao se correlacionar estes valores com a sensibilidade à insulina encontrada nos animais estudados, pode-se sugerir que o coração está interferindo na homeostasia glicídica do organismo, mesmo representando uma massa tecidual pequena comparado, por exemplo, à musculatura esquelética, tecido que também sofre influência da insulina.

Verificou-se também que o exercício per se aumentou a capacidade do coração captar glicose, pois se detectou aumento na quantidade de proteína GLUT4 por grama de tecido nos animais controles exercitados. Este aumento pode contribuir para uma melhor oxidação da glicose no miocárdio e melhorar o desempenho cardíaco no exercício. Este mecanismo de aumento da captação de glicose pelo aumento de GLUT4 é importante para a proteção miocárdica durante uma isquemia(30).

Diante desses resultados, conclui-se que fumar, além de todas as alterações já descritas em literatura envolvendo doenças cardiopulmonares e vasculares, pode também ser prejudicial à homeostasia glicídica, com prejuízo na capacidade do tecido cardíaco captar glicose. A prática de exercício físico moderado recorrente parece ser um método importante para combater os efeitos deletérios causados pelo fumo, melhorando, sobretudo, a captação de glicose pelo miocárdio e a sensibilidade periférica à insulina.

 

AGRADECIMENTOS

Este trabalho teve o apoio financeiro da FAPESP, processos 2004/10130-0 e 2008/01955-6.

 

REFERÊNCIAS

1. World Health Organization. Confronting the tobacco epidemic in an era of trade liberalization. Geneva: WHO, 2003.         [ Links ]

2. Foy CP, Bell RA, Farmer DF, Goff DC, Wagenknecht LE. Smoking and Incidence of Diabetes Among U.S. Adults. Findings from the Insulin Resistance Atherosclerosis Study. Diabetes Care 2005;28:2501-7.         [ Links ]

3. Sairenchi T, Iso H, Nishimura A, Hosoda T, Irie F, Saito Y, et al. Cigarette Smoking and Risk of Type 2 Diabetes Mellitus among Middle-aged and Elderly Japanese Men and Women. Am J Epidemiol 2004;160:158-62        [ Links ]

4. Nakanishi N, Nakamura K, Matsuo Y, Suzuki K, Tatara K. Cigarette Smoking and Risk for Impaired Fasting Glucose and Type 2 Diabetes in Middle-Aged Japanese Men. Ann Intern Med 2000;133:183-91.         [ Links ]

5. Eliasson B, Attvall S, Taskinen MR, Smith U. The insulin resistance syndrome in smokers is related to smoking habits. Arterioscler Thromb Vasc Biol 1994;14;1946-50.         [ Links ]

6. Chiolero A, Faeh D, Paccaud F, Cornuz J. Consequences of smoking for body weight, body fat distribution, and insulin resistance. Am J Clin Nutr 2008;87:801-9.         [ Links ]

7. Pinto ERC. Associação Entre Dislipidemia, Fumo e Perda Óssea Alveolar Radiográfica Em Uma População Brasileira. [Dissertação de mestrado] Duque de Caxias (RJ): Universidade do Grande Rio; 2007.         [ Links ]

8. Weitzman M, Cook S, Auinger P, Florin TA, Daniels S, Nguyen M, et al. Tobacco Smoke Exposure Is Associated With the Metabolic Syndrome in Adolescents. Circulation 2005;112:862-9.         [ Links ]

9. Weis L, Schwanck GB, Silva JS, Lenzi LGS, Machado MB, Balotin R, et al. O papel da Proteína C Reativa (PCR) na detecção precoce de inflamação sistêmica em fumantes. Revista da AMRIGS 2007;51:128-31.         [ Links ]

10. Zhang J, Liu Y, Shi J, Larson DF, Rosswatson R. Side-Stream Cigarette Smoke Induces Dose-Response in Systemic Inflammatory Cytokine Production and Oxidative Stress. Exp Biol Med 2002;227:823-9.         [ Links ]

11. Yang SR, Chida AS, Bauter MR, Shafiq N, Seweryniak K, Maggirwar SB, et al. Cigarette smoke induces proinflammatory cytokine release by activation of NF-kB and posttranslational modifications of histone deacetylasein macrophages. Am J Physiol Lung Cell Mol Physiol 2006;291:L46-57.         [ Links ]

12. Marreiro DN, Geloneze B, Tambascia MA, Lerário AC, Halpern A, Cozzolino SMF. Participação do zinco na resistência à insulina. Arq Bras Endocrinol Metab 2004;48:234-9.         [ Links ]

13. Stienstra R, Duval C, Muller M, Kersten S. PPARs, obesity, and inflammation. Hindawi Publishing Corporation 2007:1-10.         [ Links ]

14. Fernández-Real JM, Ricart W. Insulin resistance and chronic cardiovascular inflammatory syndrome. Endocr Rev 2003;24:278-301.         [ Links ]

15. Shulman GI. Cellular mechanisms of insulin resistance. J Clin Invest 2000;106:171-6.         [ Links ]

16. Machado UF, Schaan BD, Seraphim PM. Transportadores de glicose na síndrome metabólica. Arq Bras Endocrinol Metab 2006;50:177-89.         [ Links ]

17. Teran-Garcia M, Rankinen T, Koza RA, Rao DC, Bouchard C. Endurance training-induced changes in insulin sensitivity and gene expression. Am J Physiol Endocrinol Metab 2005;288:1168-78.         [ Links ]

18. Ropelle ER, Pauli JR, Carvalheira JBC. Efeitos moleculares do exercício físico sobre as vias de sinalização insulínica. Motriz 2005;11:49-55.         [ Links ]

19. Gomes MR, Rogero MM, Tirapegui J. Considerações sobre cromo, insulina e exercício físico. Rev Bras Med Esporte 2005;11:262-6.         [ Links ]

20. Jessen N, Goodyear L. Contraction signaling to glucose transport in skeletal muscle. J Appl Physiol 2005;99:330-337.         [ Links ]

21. Tian R, Abel ED. Responses of GLUT4-Deficient Hearts to Ischemia Underscore the Importance of Glycolysis. Circulation 2001;103:2961-6.         [ Links ]

22. Seraphim PM, Nunes MT, Machado UF. GLUT4 protein expression in obese and lean 12-month-old rats: insights from different types of data analysis. Braz J Med Biol Res 2001;34:1353-62.         [ Links ]

23. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265-75.         [ Links ]

24. Fu Y, Luo L, Luo N, Garvey WT. Proinflammatory cytokine production and insulin sensitivity regulated by overexpression of resistin in 3T3-L1 adipocytes. Nutr Metab 2006;3:28.         [ Links ]

25. Spranger J, Kroke A, Möhlig M, Hoffmann K, Bergmann MM, Ristow M, et al. Inflammatory Cytokines and the Risk to Develop Type 2 Diabetes Results of the Prospective Population-Based European Prospective Investigation into Cancer and Nutrition (EPIC)-Potsdam Study. Diabetes 2003;52:812-7.         [ Links ]

26. Ciolac EG, Guimarães GV. Exercício físico e síndrome metabólica. Rev Bras Med Esporte 2004;10:319-24.         [ Links ]

27. Gonçalves-Silva RMV, Lemos-Santos MG, Botelho C. Influência do tabagismo no ganho ponderal, crescimento corporal, consumo alimentar e hídrico de ratos. J Pneumol 1997;23:124-30.         [ Links ]

28. Angelis K, Pureza DY, Flores LJF, Rodrigues B, Melo KFS, Schaan BD, et al. Efeitos Fisiológicos do Treinamento Físico em Pacientes Portadores de Diabetes Tipo 1. Arq Bras Endocrinol Metab. 2006;50:1005-13.         [ Links ]

29. Morita T, Terada E, Tatebe J, Yoshino G, Saji T, Yamazaki J. Nicotine impaires GLUT4 translocation in skeletal muscle cells through mechanisms involving oxidative stress/PKC Theta/Nuclear Factor-KB/AKT pathway J Clinical Lipidology 2008;2:S19.         [ Links ]

30. Tian R, Abel ED. Responses of GLUT4-Deficient Hearts to Ischemia Underscore the Importance of Glycolysis. Circulation 2001;103:2961-6.         [ Links ]

 

 

Correspondência:
Patrícia Monteiro Seraphim
Departamento de Fisioterapia Bloco III FCT / UNESP
Rua Roberto Simonsen, 305 Centro Educacional
19060-900 Presidente Prudente - SP
E-mail: patricia@fct.unesp.br

Todos os autores declararam não haver qualquer potencial conflito de interesses referente a este artigo.