SciELO - Scientific Electronic Library Online

 
vol.40 número5Barbadocladius Cranston & Krosch, a new genus of Orthocladiinae (Diptera: Chironomidae) from South AmericaA new species group of the genus Epicauta dejean of southern south america, the bella group (Coleoptera: Meloidae) índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Artigo

Indicadores

Links relacionados

Bookmark


Neotropical Entomology

versão impressa ISSN 1519-566X

Neotrop. entomol. vol.40 no.5 Londrina set./out. 2011

http://dx.doi.org/10.1590/S1519-566X2011000500008 

SYSTEMATICS, MORPHOLOGY AND PHYSIOLOGY

 

New mariner elements in Anastrepha species (Diptera: Tephritidae)

 

 

HS MarconI; DS DominguesII; VE CoscratoI; D SelivonIII; ALP PerondiniIII; CL MarinoI

IDepto de Genética, Instituto de Biociências, Univ Estadual Paulista Júlio de Mesquita Filho, Botucatu, SP, Brasil
IILab de Biotecnologia Vegetal, Instituto Agronômico do Paraná, Londrina, PR, Brasil
IIIDepto de Genética e Biologia Evolutiva, Instituto de Biociências, Univ de São Paulo, São Paulo, SP, Brasil

Correspondence

 

 


ABSTRACT

Mariner-like elements (MLE) are members from class II of transposable elements also known as DNA transposons. These elements have a wide distribution among different groups of organisms, including insects, which can be explained by horizontal and vertical gene-transfer. MLE families have been described in tephritid flies and other genera. During screening for Wolbachia bacteria in fruit flies of the genus Anastrepha, we discovered two sequences related to mariner-like elements. Based on these sequences, we designed primers that allowed us to isolate and characterize two new mariner-like elements (Anmar1 and Anmar2) in Anastrepha flies. These elements, which belong to the mellifera and rosa subfamilies have a low nucleotide diversity, and are probably inactive and acquired by vertical transfer. This is the first report of mariner-like transposons in flies found in South America.

Keywords: Fruit fly, mellifera, tephritid, transposon, rosa


 

 

Introduction

Transposable elements are repetitive DNA segments that can change position within the genome and account for a large portion of the genetic material of eukaryotes (Bowen & Jordan 2002), e.g., 45% of the genome in humans and 50-80% of the genome in plants (as reviewed by Feschotte et al 2002). Traditionally, transposable elements have been classified into two classes: retrotransposons (class I) and DNA transposons (class II). Class I elements (or retrotransposons) are widely distributed among eukaryotes and their transposition involve a RNA intermediate, in a "copy and paste" transposition. Class II transposable elements occur in prokaryotes and in almost all eukaryotes as segments inserted in the genome or as part of complex structures (Wicker et al 2007). DNA transposons usually transpose through a "cut-and-paste" mechanism, i.e., under normal conditions the copy number of these elements does not increase exponentially. Based on the classification proposed by Wicker et al (2007), mariner-like elements (MLE) are DNA transposons belonging to subclass I that have terminal inverted repeats and a transposition mechanism that involves a "classic" transposase with a DDE motif (Silva et al 2005). Mariner-like elements are divided into 15 subfamilies that have been classified phylogenetically based on their sequence similarity (Rouault et al 2009).

The first MLE was identified in Drosophila mauritiana (Tsacas & David), where it occurred as an insertion within a gene (Jacobson & Hartl 1985). Mariner-like elements have since been described in plants, fungi, vertebrates and prokaryotes (Bigot et al 1994, Auge-Gouillou et al 1995, Robertson 1995, Plasterk et al 1999, Feschotte & Wessler 2002). The distribution of mariner-like elements among species of different phyla can be explained by two ways: vertical transfer (elements evolved from a common ancestor) and horizontal transfer (recent transference among phylogenetically unrelated species) (reviewed by Sperb et al 2009).

Among insects, mariner-like elements have been described in tephritid flies (Torti et al 1997, Gomulski et al 2001). Anastrepha are considered pests because of the damage they cause to commercially important fruits. Anastrepha is endemic to the Americas, and 103 species are reported to occur in Brazil (Zucchi 2008). Anastrepha species from different localities in Brazil are usually positive for the presence of the bacterial endosymbiont Wolbachia (Mascarenhas 2007, Coscrato et al 2009, Marcon 2009), which is known to transfer DNA segments into eukaryotic hosts (Kondo et al 2002, Hotopp et al 2007).

In a manner analogous to Carr (2008), who accidentally identified mariner transposable elements in stalk-eyed flies during screening for the sex determination gene dsx, we also serendipitously discovered mariner-like elements during screening for Wolbachia in Anastrepha fruit flies. Based on the sequences obtained, we designed specific primers to investigate the occurrence and diversity of mariner-like elements in Wolbachia-infected fruit flies. In this report, we describe the isolation and characterization of two mariner-like elements families (Anmar1 e Anmar2) in three subspecies of Anastrepha that belong to the A. fraterculus complex of cryptic species (Selivon et al 2004, 2005), and analyze their diversity and phylogenetic relationship to other mariner-like elements.

 

Material and Methods

Fly samples and mariner-like elements isolation

Samples of Anastrepha sp.1 affinis fraterculus, Anastrepha sp.2 aff. fraterculus and Anastrepha sp.3 aff. fraterculus were collected in five regions of São Paulo state, southeastern Brazil (Table 1). Genomic DNA was extracted from the abdomen of individual adult flies according to the protocol of Jowett (1998). Wolbachia were detected using the wsp primers (F1: 5'TGAAATTTTACCTCTTTTC 3' and R1: 5´AAAAATTAAACGCTACTCCA 3'; and F2: 5'TGGTCCAATAAGTGATGAAGAAAAC 3' and R2: 5´ACCAGCTTTTGCTTGATA 3´), as proposed by Zhou et al (1998). Polymerase chain reactions (PCRs) followed the conditions described in Coscrato et al (2009). The ~600 bp amplicons obtained were cloned into the pGEM®-T Easy Vector (Promega) and plasmids obtained from positive clones were subjected to bidirectional sequencing in order to obtain consensus sequences. Using this approach we identified two sequences related to mariner-like elements (see Results) that were amplified using the wsp primers indicated above.

Based on the sequences of the two mariner-like elements identified, we designed the following specific primers: Anmar1 forward (5' CCTGCTCGAACGACTGATTT 3') and Anmar1 reverse (5' CCACGATTTATTGGGTGGTC 3'), Anmar2 forward (5' AGGCGGAAAAGCTGAAGAGT 3') and Anmar2 reverse (5' AAGCCGGCCAAACATTAAC 3'). These primers were subsequently used to identify Anmar1 and Anmar2 elements, respectively, in 11 samples from the three Anastrepha fraterculus (Wiedemann) subspecies. The amplification reaction followed Coscrato et al (2009), with some adaptations in annealing temperature. It consisted of an initial cycle at 94ºC for 4 min, 55ºC for 1 min and 72ºC for 2 min, followed by 37 cycles of denaturation at 94º C for 15 s, annealing at 55ºC for 1 min and extension at 72ºC for 2 min, a further cycle of 95ºC for 15 s and 58ºC for 1 min and a final extension at 72ºC for 7 min. PCR products were analyzed in 1% agarose gels and PCR products were purified with Exosap enzyme mixture (GE), according to the manufacturer´s protocol. The purified products were sequenced in a Genetic Analyzer 3100 sequencer (Applied Biosystems) and the similarity of the mariner-like elements was confirmed by BLAST (Altschul et al 1997). All sequences obtained were deposited in GenBank with accession numbers HM773359 to HM773366 and HM775148 to HM775156.

Phylogenetic analyses

For phylogenetic analyses, we compared the sequences of Anmar1 and Anmar2 with previously reported sequences for mariner-like elements from the subfamilies mauritiana, cecropia, mellifera and rosa (Torti et al 1997, Gomulski et al 2001, Sinzelle et al 2006, Bui et al 2008, Rouault et al 2009). Thirty-two sequences were aligned using the MUSCLE alignment tool (Edgar 2004) and cured by Gblocks (Castresana 2000), using the site www.phylogeny.fr (Dereeper et al 2008). The resulting alignment was used to draw a Maximum Likelihood tree with Kimura-2-parameters distance and based on 10,000 bootstrap replicates using MEGA 5.0 software (Tamura et al in press).

The sequences related to the MLE mellifera subfamily were aligned with the GenBank sequence corresponding to accession number AAO12862 and those related to the MLE rosa subfamily were aligned with the GenBank sequence corresponding to accession number AAK61417 using blast2seq (Tatusova & Madden 1999) in both cases. Based on this alignment, regions shared by the sequences and the two accession numbers indicated above were selected manually. From this selection, we calculated the mean diversity (Pi) using the software DnaSP 5.00.05 (Librado & Rozas 2009) and the pairwise distance (p) using MEGA 5.0 software (Tamura et al in press), after gap exclusion.

 

Results

Anmar1 and Anmar2 identification

In a BLASTN analysis of sequences obtained using wsp primers, we identified one sequence with similarity to a mariner transposase from Bactrocera tryoni (Froggatt) (GenBank accession number AF349134.1) and another sequence similar to a Ceratitis rosa (Karsch) mariner transposase (GenBank accession number AY426626.1). Since these samples were positive for Wolbachia, specific primers for the Anastrepha Internal Transcribed Spacer (ITS) region (Prezotto 2008) were used to confirm the presence of Anastrepha DNA in these preparations. The resulting PCR products confirmed the presence of Anastrepha DNA in all samples, as expected (data not shown), once it is impossible to dissociate bacterial cells from fly tissue in DNA extraction.

These sequences, designated as Anmar1 (similar to AF349134.1) and Anmar2 (similar to AY426626.1), were used to design specific primers for each new mariner element. The new primers were then used in PCR reactions with the MLE clones obtained in wsp amplification, which allowed confirmation of the primer specificity. We subsequently screened other Wolbachia-positive Anastrepha samples with the Anmar1 and Anmar2 primers and obtained 13 samples that yielded PCR fragments (Table 1). The sequences of these purified PCR products were similar to the mariner-like elements originally observed with wsp primers. All analyzed sequences were obtained using Anmar1 and Anmar2 specific primers.

Anmar1 and Anmar2 characterization and phylogenetic analysis

Initial BLAST results suggested that the Anmar1 and Anmar2 elements belonged to the mellifera and rosa subfamilies, respectively. To confirm this, we generated a phylogenetic tree with the Anmar1 and Anmar2 sequences and the sequences from four mariner subfamilies (mauritiana, cecropia, mellifera and rosa). The clade distribution and bootstrap values in the phylogenetic analysis confirmed that these elements belonged to the mellifera and rosa subfamilies (Fig 1).

 

 

Eight and nine sequences were obtained for the Anmar1 (mellifera) and Anmar2 (rosa) elements, respectively. Both Anmar1 and Anmar2 sequences had stop codons in their coding region, and manual analysis of these two sequences detected common regions of 201 (Fig 2a) and 115 nucleotides (Fig 2b), respectively; these regions were further used to analyze nucleotide diversity. Anmar1 (Anmar1.1 to Anmar1.8) sequences had a Pi diversity of 0.045 ± 0.01 and those for Anmar2 (Anmar2.1 to Anmar2.9) had a Pi of 0.068 ± 0.02, indicating a higher diversity in the Anmar2 element than in the Anmar1. P distances among the Anmar1 and Anmar2 sequences indicated that both families had three identical sequences (Tables 2 and 3), although distinct distance values were observed: P distances in the Anmar1 sequences ranged from 0.010 to 0.094 (Table 2), but were higher in Anmar2, ranging from 0.010 to 0.173 (Table 3). The p distance between Anmar1.1 and Anmar2.1 was 0.51 (Online Supplementary Material 1). Higher distances in Anmar2.1 were also observed comparing this element to other sequences used for phylogenetic characterization (Fig 1, Online Supplementary Material 1): Anmar1.1 distances ranged from 0.18 to 0.59 and from 0.48 to 0.62 in Anmar2.1.

 

Discussion

Mariner-like elements are widely distributed among tephritids, and Ccmar1 and Tcmar1 elements have distinct distributions among related tephritids species due to their relatively recent transmission between species (Torti et al 1997, Green & Frommer 2001). Our findings therefore agree with these and other investigations (Robertson 1993, Robertson & MacLeod 1993) showing that mariner-like elements are widely distributed in insects.

Sequence comparisons and phylogenetic analyses have classified mariner-like elements into various subfamilies. In the present work, we first describe mariner-like elements of the rosa and mellifera subfamilies in subspecies of A. fraterculus. The Anmar2 element was classified as a member of the rosa subfamily, which also contains Crmar2, Asmar1 and Almar1 (Gomulski et al 2001). The Anmar1 element is a member of the mellifera subfamily (Fig 2).

BLASTN analyses indicated that the Anastrepha sp. mariner-like elements shared similarity with transposases from Bactrocera tryoni and C. rosa, thus reinforcing the suggestion that mariner transposases have spread among tephritids over a long period of time; this finding also suggested that dispersal of the Anmar1 and Anmar2 elements did not involve horizontal gene transfer. Rather, these elements were probably present in an ancestral Anastrepha lineage that gave rise to the species analyzed here.

Although the mellifera and rosa subfamilies have been identified in other tephritids (Gomulski et al 2001, Green & Frommer 2001), the Anmar1 and Anmar2 elements are distinct from the other members of these subfamilies (Fig 2). This analysis indicated that Anmar1 occurs in the same clade as Demar1 and Gpmar1 from the Drosophilidae and tsetse flies, respectively (Lohe et al 1995, Blanchetot & Gooding 1995). In contrast, Anmar2 clustered with members of the rosa subfamily, all of which were originally identified in dipteran flies. Our data indicate that similar mariner-like elements identified here also occur in other genera of the same family, suggesting an acquisition by vertical transmission.

The Anmar1 and Anmar2 sequences showed a low level of diversity (4.5% and 6.8%, respectively) that has also been observed in mariner elements of B. tryoni (Green & Frommer 2001) and other insects (Carr 2008), which suggests that insect mariner-like elements have not been under pressure to diverge. The presence of a stop codon in all sequences suggested that they were inactive.

In conclusion, we have identified two new mariner-like elements in A. fraterculus subspecies that share similarities with other dipteran mariner-like elements. This finding indicates that the Anmar1 and Anmar2 families are present in a common ancestor of many dipterans and that there is no horizontal transfer. These results provide new perspectives for future studies on the distribution, transcription and functional character of these elements in Anastrepha sp. and other flies.

 

Acknowledgments

This research was supported by a grant from FAPESP (03/02698-3) to DS, ALPP, and CLM. HSM had fellowships from CAPES / FAPESP and VEC from FAPESP. DS is a fellow of CNPq.

 

References

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: 403-410.         [ Links ]

Auge-Gouillou C, Bigot Y, Pollet N, Hamelin M-H, Meunier-Rotival M, Perique G (1995) Human and other mammalian genomes contain transposons of the mariner family. FEBS Letters 68: 541-546.         [ Links ]

Bigot Y, Hamelin MH, Capy P, Periquet G (1994) Mariner-like elements in hymenopteran species: insertion site and distribution. Proc Natl Acad Sci USA 91: 3408-3412.         [ Links ]

Blanchetot A, Gooding RH (1995) Identification of a mariner element from the tsetse fly, Glossina palpalis palpalis. Insect Mol Biol 4: 89-96.         [ Links ]

Bowen NJ, Jordan IK (2002) Transposable elements and the evolution of eukaryotic complexity. Curr Issues Mol Biol 4: 65-76.         [ Links ]

Bui Q-T, Casse N, Leignel V, Nicolas V, Chénais B (2008) Widespread occurrence of mariner transposons in coastal crabs. Mol Phylogenet Evol 47: 1181-1189.         [ Links ]

Carr M (2008) Multiple subfamilies of mariner transposable elements are present in stalk-eyed ûies (Diptera: Diopsidae). Genetica 132: 113-122.         [ Links ]

Castresana J (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol 17: 540-552.         [ Links ]

Coscrato VE, Braz ASK, Perondini ALP, Selivon D, Marino CL (2009) Wolbachia in Anastrepha fruit flies (Diptera: Tephritidae). Curr Microbiol 59: 291-301.         [ Links ]

Dereeper A, Guignon V, Blanc G, Audic S, Buffet S, Chevenet F, Dufayard JF, Guindon S, Lefort V, Lescot M, Claverie JM, Gascuel O (2008) Phylogeny.fr: robust phylogenetic analysis for the non-specialist. Nucleic acids res 1: 465-469.         [ Links ]

Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic acids res 32: 1792-1797.         [ Links ]

Feschotte C, Jiang N, Wessler SR (2002) Plant transposable elements: where genetics meets genomics. Nat Rev Genet 3: 329-341.         [ Links ]

Feschotte C, Wessler SR (2002) Mariner-like transposases are widespread and diverse in flowering plants. Proc Natl Acad Sci USA 99: 1280-1285.         [ Links ]

Green CL, Frommer M (2001) The genome of the Queensland fruit fly Bactrocera tryoni contains multiple representatives of the mariner family of the transposable elements. Insect Mol Biol 10: 371-386.         [ Links ]

Gomulski LM, Torti C, Bonizzoni M, Moralli D, Raimondi E, Capy P, Gasperi G, Malacrida AR (2001) A new basal subfamily of mariner elements in Ceratitis rosa and other tephritid flies. J Mol Evol 53: 597-606.         [ Links ]

Hotopp JCD, Clark ME, Oliveira DCSG, Foster JM, Fischer P, Torres MCM, Giebel JD, Kumar N, Ishmael N, Wang S, Ingram J, Nene RV, Shepard J, Tomkins J, Richards S, Spiro DJ, Ghedin E, Slatko BE, Tettelin H, Werren JH (2007) Widespread lateral gene transfer from intracellular bacteria to multicellular eukaryotes. Science 317: 1753-1756.         [ Links ]

Jacobson JW, Hartl DL (1985) Coupled instability of two X-linked genes in Drosophila mauritiana: germinal and somatic mutability. Genetics 111: 57-65.         [ Links ]

Jowett T (1998) Preparation of nucleic acids, p.347-372. In Roberts DB (ed) Drosophila: a pratical approach 2nd edn. Oxford, Oxford University Press, 389p.         [ Links ]

Kidwell MG (1994) The evolutionary history of the P family of transposable elements. J Heredity 85: 339-346.         [ Links ]

Kondo N, Nikoh N, Ijichi N, Shimada N, Fukatsu T (2002) Genome fragment of Wolbachia endosymbiont transferred to X chromosome of host insect. Proc Natl Acad Sci USA 99: 14280-14285.         [ Links ]

Librado P, Rozas J (2009) DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25: 1451-1452.         [ Links ]

Lohe AR, Moriyama EN, Lidholm D-A, Hartl DL (1995) Horizontal transmission, vertical inactivation, and stochastic loss of mariner-like transposable elements. Mol Biol Evol 12: 62-72.         [ Links ]

Marcon HS (2009) Identificação da bactéria endossimbionte Wolbachia em populações de moscas-das-frutas do complexo Anastrepha fraterculus (Diptera: Tephritidae). M. Sc. Dissertation, Botucatu, Instituto de Biociências - UNESP, 110p.         [ Links ]

Mascarenhas RO (2007) Endossimbionte Wolbachia em moscas-das-frutas do gênero Anastrepha (Tephritidae) e em vespas parasitóides (Braconidae) associadas. M. Sc. Dissertation, São Paulo, Instituto de Biociências - USP, 80p.         [ Links ]

Plasterk RHA, Izsvák Z, Ivics Z (1999) Resident aliens: the Tc1/mariner superfamily of transposable elements. Trends Genet 15: 326-332.         [ Links ]

Prezotto LF (2008) Análise de ITS1 do DNA do ribossômico em espécies do complexo Anastrepha frarterculus (Diptera: Tephritidae). M. Sc. Dissertation, São Paulo, Instituto de Biociências - USP, 52p.         [ Links ]

Robertson HM (1993) The mariner transposable element is widespread in insects. Nature 38: 241-245.         [ Links ]

Robertson HM (1995) The Tcl-mariner superfamily of transposons in animals. J Insect Physiol 41: 99-105.         [ Links ]

Robertson HM, MacLeod EG (1993) Five major subfamilies of mariner transposable elements in insects, including the Mediterranean fruit fly, and related arthropods. Insect Mol Biol 2: 125-139.         [ Links ]

Rouault J-D, Casse N, Chénais B, Hua-Van A, Filée J, Capy P (2009) Automatic classification within families of transposable elements: application to the mariner family. Gene 448: 227-232.         [ Links ]

Selivon D, Perondini ALP, Morgante JS (2005) A genetic-morphological characterization of two cryptic species of the Anastrepha fraterculus complex (Diptera:Tephritidae). Ann Entomol Soc Am 98: 367-381.         [ Links ]

Selivon D, Vretos C, Fontes L, Perondini ALP (2004) New variant forms in the Anastrepha complex (Diptera: Tephritidae), p.253-258. In Barnes BN (ed) Proceedings 6th International Symposium on Fruit Flies of Economic Importance. Isteg Scientific Publication, Irene, South Africa.         [ Links ]

Silva JC, Bastida F, Bidwell SL, Johnson PJ, Carlton JM (2005) A potentially functional mariner transposable element in the protist Trichomonas vaginalis. Mol Biol Evol 22: 126-134.         [ Links ]

Sinzelle L, Chesneau A, Bigot Y, Mazabraud A, Pollet N (2006) The mariner transposons belonging to the irritans subfamily were maintained in chordate genomes by vertical transmission. J Mol Evol 62: 53-65.         [ Links ]

Sperb F, Schuck DC, Rodrigues JJS (2009) Occurrence and abundance of a mariner-like element in freshwater and terrestrial planarians (Platyhelminthes, Tricladida) from southern Brazil. Genet Mol Biol 32: 731-739.         [ Links ]

Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (in press) MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol doi: 10.1093/molbev/msr121.         [ Links ]

Tatusova TA, Madden TL (1999) BLAST 2 Sequences, a new tool for comparing protein and nucleotide sequences. FEMS Microbiol Lett 174: 247-250.         [ Links ]

Torti C, Gomulski LM, Malacrida AR, Capy P, Gasperi G (1997) Characterization and evolution of mariner elements from closely related species of fruit flies (Diptera: Tephritidae). J Mol Evol 46: 288-298.         [ Links ]

Wicker T, Sabot F, Hua-Van A, Bennetzen JL, Capy P, Chalhoub B, Flavell A, Leroy P, Morgante M, Panaud O, Paux E, San Miguel P, Schulman AH (2007) A unified classification system for eukaryotic transposable elements. Nat Rev Genet 8: 973-982.         [ Links ]

Zhou W, Rousset F, O'Neill SL (1998) Phylogeny and PCR based classification of Wolbachia strains using wsp gene sequences. Proc R Soc Lond Ser B 265: 509-515.         [ Links ]

Zucchi RA (2008) Fruit flies in Brazil - Anastrepha species and their host plants. (http://www.lea.eslq.usp.br/anastrepha/).         [ Links ]

 

 

Correspondence:
Helena S Marcon
Instituto de Biociências
Departamento de Genética, Botucatu - UNESP
Distrito de Rubião Junior, s/n
18618-970; marcon@ibb.unesp.br

Received 19 November 2010 and accepted 29 March 2011

 

 

Edited by Fernando B Noll - UNESP

 

 


Online Supplementary Material 1 - Click to enlarge