Neotropical Entomology
versión impresa ISSN 1519-566X
Neotrop. entomol. vol.40 no.5 Londrina sept./oct. 2011
http://dx.doi.org/10.1590/S1519-566X2011000500010
SYSTEMATICS, MORPHOLOGY AND PHYSIOLOGY
A morphometric and molecular study of Anastrepha pickeli Lima (Diptera: Tephritidae)
ZV BomfimI; KM LimaII; JG SilvaII; MA CostaII; RA ZucchiI
IDepto de Entomologia e Acarologia, Escola Superior de Agricultura Luiz de Queiroz, Univ de São Paulo, Piracicaba, SP, Brasil
IIDepto de Ciências Biológicas, Univ Estadual de Santa Cruz, Ilhéus, BA, Brasil
ABSTRACT
This study investigated the level of morphometric and genetic variability among populations of Anastrepha pickeli Lima from several localities in Brazil, one locality in Bolivia and one in Paraguay. Traditional and geometric morphometric analyses were used, as well as sequencing of a fragment of the cytochrome oxidase gene (COI). Six variables were measured from the aculeus for traditional morphometric analysis and 14 landmarks from the right wing were used for geometric analysis, using 10 specimes/population. The aculeus tip length, aculeus width at the end of the cloaca opening, and the serrate part length contributed with 62.7% for grouping. According to the results from traditional morphometry, there was no significant difference, but the multivariate tests showed that the canonical variables were statistically significant, indicating a difference in the wing conformation among populations. Molecular phylogenetic analysis indicated that the populations clustered into three clades and revealed a high level of genetic variation within A. pickeli populations from various geographic regions. Anastrepha pickeli populations differed among them according to the methods used in this study, showing incongruence among the methods used.
Keywords: Fruit fly, geometric and traditional morphometry, molecular phylogeny, cytochrome oxidase I (COI), taxonomy
Introduction
Species identification is highly problematic in some Anastrepha species groups and misidentifications can pose serious problems for the implementation of quarantine restrictions, integrated pest management, and other control programs (McPheron 2000). Therefore, there is an ongoing need to explore additional morphological and molecular characters so as to more accurately elucidate species identification. Utilization of combined morphological and molecular methodologies will also improve our basic knowledge of the relationships among the species within the various Anastrepha species groups (McPheron et al 1999, Norrbom et al 1999, Smith-Caldas et al 2001).
Morphometric methods based on the size (traditional morphometry) and on the shape (geometric morphometry) variation of several structures have been used in the identification of some insect species by establishing landmarks (Strauss & Bookstein 1982, Sklorz 1992). In Anastrepha, morphometry has been used, for example, to analyze populations of the Anastrepha fraterculus complex (Hernández-Ortiz et al 2004, Selivon et al 2005).
Besides morphometric analysis, molecular methods have been used in Anastrepha systematics to complement morphological and ecological data to address questions such as species identification, speciation, geographic variation, structured genetic variation, and phylogeny (Silva 2000, Silva & Barr 2008). Sequencing of fragments of mitochondrial and nuclear genes has been used to make inferences about relationships among specimens, populations, and species (Avise 1994).
It is known that some of what were considered widespread species such as A. fraterculus are in fact cryptic species complexes and Anastrepha pickeli Lima could be an example of such a complex based on the morphological study by Canal (1997) (Norrbom et al 1999). Anastrepha pickeli belongs to the spatulata group (Norrbom et al 1999), and is reported from Costa Rica to Guyana and Tobago, Venezuela to Peru, Brazil, and Argentina (Norrbom 2004). In Brazil, it is recorded in 15 states comprising all five Brazilian geographic regions (Zucchi 2007), where it has received attention as it infests the fruit of cassava (Manihot esculenta, Euphorbiaceae), consuming the pulp and the seeds, causing losses of up to 30% in fruit production (Lozano et al 1983, Morgante et al 1996). Although cassava is most important as a root crop, the effect of seed predation negatively affects cassava breeding programs (Farias & Bellotti 2006).
In this study, we investigated the morphometric and genetic variation among A. pickeli populations using traditional and geometric morphometry and sequencing of a fragment of the COI gene to improve identification of this cassava pest. We aimed at verifying if A. pickeli, a specialist species, shows cryptic speciation based on specimens collected in Bolivia, Brazil and Paraguay.
Material and Methods
Anastrepha pickeli females were collected in McPhail traps in Brazil, in the states of Bahia, Espírito Santo, Rio Grande do Norte and Amazonas, and also in Bolivia and Paraguay and preserved in frozen ethanol (Table 1). Voucher specimens were deposited at the insect collection at the Escola Superior de Agricultura "Luiz de Queiroz", USP, Piracicaba, SP, Brazil. The same specimens were used for both morphometric studies (the aculeus for traditional morphometry, the wing for geometric morphometry, and the thorax and legs for the molecular analysis).
Traditional morphometry
Ten females from each locality were used. The aculeus of each female was dissected and treated with 10% sodium hydroxide for 24h and then mounted on a microscope slide with glycerine. Aculei were placed ventral side up and carefully oriented in a consistent level position. The aculei were photographed with a camera attached to a stereomicroscope and the Motic Images Advanced 3.2® software was used for image analysis. Five variables: L1 (aculeus tip length), L2 (width of the aculeus apex at base of serrate part), L3 (distance between the cloaca opening and base of serrate part), L4 (aculeus length at the cloacal opening), and L5 (serrate part length) were measured (Fig 1). The aculeus length (variable L6) was measured under a stereomicroscope attached to a digital micrometric ocular. The average length (arithmetic mean) was calculated for each population and used for the UPGMA cluster analysis, followed by a principal component analysis to verify which variable most contributed to clustering. Differences among populations were assessed by the Wilk's Lambda test (Statistica 9.0®).

Geometric morphometry
Ten females from each locality were used. The right wing of each female was dissected and mounted on a microscope slide with glycerine and photographed with a camera attached to a stereomicroscope and the analySIS getIT® software was used. A TPS file was created from the image file in the software tpsUtil version 1.4® following Rohlf (2009a). Fourteen homologous landmarks were manually plotted at the designated vein intersections (Fig 2) for each specimen using the software tpsDig version 2.12® following Rohlf (2009b), based on previous morphometric studies on Anastrepha (Nascimento 2005, Selivon et al 2005). The centroid size was calculated for all anatomic landmark configurations for each wing, as well as the canonical variables and matrix of relative warps, using the software tpsRelw version 1.46® (Rohlf 2009c) and tpsRegr version 1.37® (Rohlf 2009d). Differences among populations were assessed by the Mann-Whitney test (centroid size) and Wilk's Lambda (relative warps) (Statistica 9.0®). We used Statistica 9.0® to calculate the Mahalanobis distance matrix and to carry out the multivariate analysis, MANOVA.

Molecular analyses
Total nucleic acid extractions from thorax and legs of individual specimens followed the protocol for alcohol-preserved specimens by Han & McPheron (1997). A fragment of 1,050 bp within the mitochondrial COI gene was amplified by polymerase chain reaction (PCR) using primers tRNA-cys2 (ACTCCTTTAGAATTGCAGTCTAAT) and COld-r (GGGCTCATACAATAAATCCTAAT) (Ruiz-Arce 2009). PCR reactions were carried out in 25 µl according to Gasparich et al (1995) using from 3-5µl of genomic DNA. The cycle program consisted of an initial denaturation step of 3 min at 94°C, followed by 39 cycles of 1 min at 94°C, 1 min at 50°C, 1 min at 72°C, with a final extension step of 10 min at 72°C. The amplified fragments were purified using exonuclease I and shrimp alkaline phosphatase (SAP) (Fermentas®) and incubated in a thermocycler for 1h at 37°C, followed by 15 min at 80°C. DNA sequencing was carried out at the Centro de Estudos do Genoma Humano at the Universidade de São Paulo (CEGH-USP) using the DYEnamic ET Dye Terminator Kit in a MegaBACE 1000 automated DNA sequencer. We sequenced one specimen per location for each population of A. pickeli and one specimen for each species used as outgroups. Sequences were aligned using the Bioedit Sequence Alignment Editor 7.0.9® (Hall 1999) which uses the ClustalW Multiple Alignment® tool (Thompson et al 1994).
Phylogenetic analyses were conducted using maximum parsimony (MP) and neighbor-joining (NJ) methods using the MEGA 4.1® software (Tamura et al 2007). A consensus NJ tree was generated using the Jukes-Cantor distance (chosen based upon criteria in Kumar et al 1993). Bootstrapping of the MP and NJ analyses (1,000 replicates) was performed. Two species of the Anastrepha serpentina group, Anastrepha serpentina (Wiedemann) and Anastrepha striata Schiner were used as outgroups.
Results
Traditional morphometric variables L1 (aculeus apex length), L4 (aculeus width at the apex of the cloacal opening), and L5 (serrate part length) showed significant differences among the analyzed populations (Wilk's Lambda test, P < 0.05). The principal component analysis showed that these three morphometric characters were significantly different among Amazonas and Espírito Santo, Bolivia and Rio Grande do Norte, Paraguay and Rio Grande do Norte population pairs (Wilk's Lambda test, P < 0.05), whereas Amazonas and Bolivia, and Rio Grande do Norte and Espírito Santo populations were not statistically different (Wilk's Lambda test, P > 0.05).
In all characters analyzed by traditional morphometry, the population of A. pickeli from Bahia was significantly different from all other populations (Wilk's Lambda test, P < 0.0001). The variables L1, L4 and L5 explained 62.6% of the data variability. The dendrogram (Fig 3) shows that the population from Bahia did not cluster with the remaining populations analyzed, which formed two clusters, one with populations from Paraguay, Rio Grande do Norte and Espirito Santo, and a second one with populations from Bolivia and Amazonas. However, the MANOVA of the traditional morphometric data indicated that populations were not statistically different (Wilk's Lambda test = 0.33, P > 0.05).

Centroid size ranged between 7.0 and 8.0. Average and standard deviation values are graphically represented in Fig 4. Centroid size analysis indicated that most populations were not statistically different among themselves at the 95% confidence level (Mann-Whitney test, P > 0.05), except for the population from Paraguay that was significantly different from all remaining populations (Mann-Whitney test, P < 0.05), and the population from Bolivia that was significantly different from that of Rio Grande do Norte (Mann-Whitney test, P < 0.05). The significant differences between populations from Paraguay and Bolivia indicate that they harbor individuals with larger wings when compared to the remaining populations.

A total of 24 relative warps was generated (k = 2n - 4), where k represents the number of relative warps and n the number of anatomic landmarks. The MANOVA of the canonical variables of relative warps showed significant differences among populations (Wilk's Lambda = 0.006; P < 0.05). Significant differences were observed between populations from Paraguay and Espírito Santo (Wilk's Lambda test, P < 0.05), but they were not significantly different from populations from Bahia and Rio Grande do Norte (Wilk's Lambda test, P > 0.05), which, in turn, were significantly different from each other (Wilk's Lambda test, P < 0.05). Populations of A. pickeli from Bolivia and Amazonas can be readily distinguished from each other and also from the other populations (Wilk's Lambda test, P < 0.05). The two first canonical variables explained, respectively, 42.7% and 24.5% of the data variability (Fig 5).
The Mahalanobis distance matrix indicated the largest distances between population pairs from Bolivia and Bahia (35.9%), Amazonas and Rio Grande do Norte (30.6%), and Amazonas and Bahia (29.3%) (Table 2).

Aligned sequences, including the outgroups, resulted in a data matrix containing 685 characters, of which 129 were variable and 59 sites were informative for parsimony analysis. Sequences were deposited in GenBank under accession numbers JN002428 - JN002435.
Three most parsimonious trees were recovered from MP analysis of the COI data and the strict consensus tree is shown in Fig 6. The neighbor-joining tree is very similar in its placement of the various populations to the MP tree (Fig 7). The average distance among A. pickeli populations was 0.040 ± 0.031. The level of sequence divergence ranged from a minimum of 0.003 to a maximum distance of 0.085 between populations. The lowest distance observed within A. pickeli (0.003) was between the populations from Amazonas and Rio Grande do Norte and the highest level of divergence (0.085) was verified between those from Paraguay and Bahia.

Discussion
The MANOVA indicated that the differences among the populations were not statistically significant based on traditional morphometry, as opposed to the significant differences observed with the geometric morphometry. Anastrepha pickeli is a specialist species and therefore it would be expected to have a more uniform morphology among its populations. However, these morphological differences may be attributed to variation in both biotic (host plants) and abiotic factors (temperature, pluviosity and humidity among others). For example, aculeus measurements for five species in the fraterculus group have been shown to vary along the geographic distribution range and also among specimens from the same host (Araujo & Zucchi 2006). Alencar-Souza (1998) analyzed the aculeus of two generalist species, Anastrepha fraterculus (Wiedemann) and Anastrepha zenildae Zucchi, and one specialist, A. pickeli, from Rio Grande do Norte and found remarkable intraspecific differences among A. pickeli populations and concluded that there were two new species in the sample. It is likely that in the sample studied by Alencar-Souza (1998), besides specimens of A. pickeli, there were specimens of a species that is not yet formally described and has been denominated Anastrepha sp. aff. pickeli (Araujo et al 2005).
In our study, samples were collected in various geographic regions (Table 1), which can explain the differentiation among A. pickeli populations. According to some researchers, the morphometric differences related to the size of the structures among the populations studied are doubtful (Rohlf & Marcus 1993, Adams et al 2004). However, the significant difference in wing size observed in populations from Bolivia and Paraguay relative to the remaining populations generated by the centroid size analysis, minimizes the influence of some external factors as this measurement represents the geometric center of the wing as well as the mass center of a configuration, which is paramount for size definition (Monteiro & Reis 1999). Our results agree with the centroid size reported by Nascimento (2005), who analyzed a laboratory population of A. pickeli and other populations of generalist Anastrepha species. However, further comparisons were prevented as that author did not specify the origin of the laboratory colony of A. pickeli studied.
The canonical variables analysis revealed that populations of A. pickeli tended to form clusters; however, most of them showed partial or total overlap. Populations from Amazonas and Bolivia showed a tendency to be located in the superior end of VC 1, as opposed to those from Rio Grande do Norte and Espírito Santo (Fig 5). The specimens of A. pickeli analyzed by Nascimento (2005) had wings widened at the base and narrowed apically and were distributed along the axis between the two ends when compared to generalist species in different infrageneric groups. The deformation diagram shows that populations from Amazonas and Bolivia diverged from the remaining populations, showing differences mainly in the landmark 4 (apex of vein R4+5), which indicated a tendency to narrow the wing, and landmark 6 (apex of vein CuA1), which widened the wing.
This is the most extensive molecular study of A. pickeli populations to date, both in number of included samples and localities, even though we could not obtain specimens from the entire range of distribution of this species in Brazil. Populations of A. pickeli were recovered as a monophyletic group with strong support in the NJ tree. The COI data obtained indicated the existence of three groups within the populations analyzed with reasonable support. The first group included populations from Amazonas, Bolivia and Rio Grande do Norte, the second from Bahia and Espirito Santo, and the third was represented by a single population from Paraguay, which is a strongly supported and highly divergent clade at the base of the remaining A. pickeli populations in the trees. Interestingly, the topology of both MP and NJ trees reflects the geographic proximity among samples from north southwards. This is consistent with the fact that northern Amazonia is considered the place of domestication of cassava (Nassar 1978), which is the main host of A. pickeli throughout its geographic range.
Our data revealed a high level of genetic variation within A. pickeli populations from various geographic regions. There is a strong molecular divergence (JC distance = 0.074-0.085) between the population from Paraguay, situated at the extreme south of the distribution range, and the remaining populations. Additional studies, including sampling across the species distribution, are warranted to explore the boundaries of this species, since recent studies have revealed that what were believed to be widespread species are actually cryptic species complexes, such as A. fraterculus (see Norrbom et al 1999).
Further morphometric and genetic studies of populations along the entire distribution range would help to better evaluate variations in A. pickeli. In order to advance further with molecular approaches, a gene or genes with an even higher level of divergence may be required to actually track patterns of the evolutionary history of the spatulata group.
Acknowledgments
This study was conducted as partial requirement for the Ph.D. degree of the first author. We would like to thank Beatriz Ronchi-Teles, Elizabeth Quisberth Ramos, Elton Lucio de Araujo, Keiko Uramoto, Miguel Francisco de Souza Filho, and Osmar Arias for kindly providing some of the specimens used in this study. We would also like to thank Carter Robert Miller and two anonymous reviewers for their helpful comments on the manuscript. Thanks also to Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) for the fellowship to ZVB. RAZ is a fellow of the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq). This study was supported by CNPq (grant n° 471048/2007-0).
References
Adams DC, Rohlf FJ, Slice DE (2004) Geometric morphometrics: ten years of progress following the "revolution". Ital J Zool 71: 5-16. [ Links ]
Alencar-Souza JMG (1998) Caracterização de populações e espécies de moscas-das-frutas (Diptera: Tephritidade) no Rio Grande do Norte, através de morfometria multivariada. Dissertação de mestrado, Instituto de Biociências, Universidade de São Paulo, São Paulo, 79p. [ Links ]
Araujo EL, Medeiros MKM, Silva VE, Zucchi RA (2005) Moscas-das-frutas (Diptera: Tephritidae) no Semi-Árido do Rio Grande do Norte: plantas hospedeiras e índices de infestação. Neotrop Entomol 34: 889-894. [ Links ]
Araujo EL, Zucchi RA (2006) Medidas do acúleo na caracterização de cinco espécies de Anastrepha do grupo fraterculus (Diptera: Tephritidae). Neotrop Entomol 35: 329-337. [ Links ]
Avise JC (1994) Molecular markers, natural history, and evolution. 2ed. Sunderland, Massachusetts, Sinauer Associates, 684p. [ Links ]
Barr NB, Liwang C, McPheron BA (2005) Molecular systematics of nuclear gene period in genus Anastrepha (Tephritidae). Ann Entomol Soc Am 98: 173-180. [ Links ]
Farias ARN, Belloti AC (2006) Pragas e seu controle, p.591-671. In Souza L da S, Farias ARN, Mattos PLP de, Fukuda WMG (eds) Aspectos socioeconômicos e agronômicos da mandioca. Cruz das Almas, Embrapa Mandioca e Fruticultura Tropical, 817p. [ Links ]
Gasparich GE, Sheppard WS, Han HY, McPheron BA, Steck GJ (1995) Analysis of mitochondrial DNA and development of PCR-based diagnostic molecular markers for Mediterranean fruit fly (Ceratitis capitata) populations. Insect Mol Biol 1: 61-67. [ Links ]
Hall TA (1999) Bioedit: a user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucl Acids Symp Ser 41: 95-98. [ Links ]
Han HY, McPheron BA (1997) Molecular phylogenetic study of Tephritidae (Insecta: Diptera) using partial sequences of the mitocondrial 16S ribosomal DNA. Mol Phylogen Evol 7: 17-32. [ Links ]
Hernández-Ortiz V, Gómez-Anaya JA, Sánchez A, McPheron BA, Aluja M (2004) Morphometric analysis of Mexican and South American populations of the Anastrepha fraterculus complex (Diptera: Tephritidae) and recognition of a distinct Mexican morphotype. Bull Entomol Res 94: 487-499. [ Links ]
Kumar S, Tamura K, Nei M (1993) MEGA: Molecular evolutionary genetics analysis, version 1.0. Institute of Molecular Evolutionary Genetics, Pennsylvania State University, University Park. [ Links ]
Lozano JC, Belloti A, Reys JA, Howeler R, Leihner D, Doll J (1983) Problemas en el cultivo de la yuca. Centro Internacional de Agricultura Tropical - CIAT. Traduzido por Silva JR, EMBRATER, Serviço de Extensão Rural. Brasilia, Ministério da Agricultura/Brasil, 208p. [ Links ]
McPheron BA (2000) Population genetics and cryptic species, p.483-490. In Tan KH (ed) Area-wide control of fruit flies and other insect pests. Penang, Penerbit Universiti Sains Malaysia, 782p. [ Links ]
McPheron BA, Han HY, Silva JG, Norrbom AL (1999) Phylogeny of the genera Anastrepha and Toxotrypana (Trypetinae: Toxotrypanini) based upon 16SrRNA mitochondrial DNA sequences, p.343-361. In Aluja M, Norrbom AL (eds) Fruit flies (Tephritidae): phylogeny and evolution of behavior. Boca Raton, CRC Press, 944p. [ Links ]
Monteiro LR, Reis SF (1999) Princípios de morfometria geométrica. Ribeirão Preto, Holos Editora, 188p. [ Links ]
Morgante JS, Selivon D, Solferini VN, Nascimento AS do (1996) Genetic and morphological differentiation in the specialist species Anastrepha pickeli and A. montei, p.273-276. In Steck JG, McPheron BA (eds) Fruit fly pest: a world assessment of their biology and management. Delray Beach, St. Lucie Press, 596p. [ Links ]
Nascimento FM (2005) Morfometria geométrica aplicada ao estudo de variações alares em espécies de Anastrepha (Diptera: Tephritidae). Tese de doutorado, Instituto de Biociências da Universidade de São Paulo, São Paulo, 84p. [ Links ]
Nassar NMA (1978) Wild Manihot species of central Brazil for cassava breeding. Can J Plant Sci 58: 257-261. [ Links ]
Norrbom AL (2004) Host plant database for Anastrepha and Toxotrypana (Diptera: Tephritidae: Toxotrypanini). Diptera Data Dissemination Disk (CD-ROM) 2. [ Links ]
Norrbom AL, Zucchi RA, Hernández-Hortiz V (1999) Phylogeny of the genera Anastrepha and Toxtrypana (Trypetinae: Toxotrypanini) based on morphology, p.299-342. In Aluja M, Norrbom AL (eds) Fruit flies (Tephritidae): phylogeny and evolution of behavior. Boca Raton, CRC Press, 944p. [ Links ]
Rohlf FJ (2009a) tpsUtil, version 1.44. Departament of Ecology and Evolution, State University of New York, Stony Brook. (http//life.bio.sunysb.edu/morph/-7k, accessed in 15/ August /2009). [ Links ]
Rohlf FJ (2009b) tpsDig version 2.12. Stony brook: State University of New York, Departament of Ecology and Evolution. (http//life.bio.sunysb.edu/morph/-7k, accessed in 15/ August /2009). [ Links ]
Rohlf FJ (2009c) tpsRelw version 1.46. Stony brook: State University of New York, Departament of Ecology and Evolution. (http//life.bio.sunysb.edu/morph/-7k, accessed in 15/ August /2009). [ Links ]
Rohlf FJ (2009d) tpsRegr version 1.37. Stony brook: State University of New York, Departament of Ecology and Evolution. (http//life.bio.sunysb.edu/morph/-7k, accessed in 15/ August /2009). [ Links ]
Rohlf FJ, Marcus LF (1993) A revolution in morphometrics. Trends Ecol Evol 8: 129-132. [ Links ]
Ruiz-Arce R (2009) Phylogeography of Anastrepha ludens and Anastrepha obliqua. Tese de doutorado, Department of Entomology, The Pennsylvania State University, University Park, PA, 105p. [ Links ]
Selivon D, Perondini ALP, Morgante JS (2005) A genetic-morphological characterization of two cryptic species of the Anastrepha fraterculus complex (Diptera: Tephritidae). Ann Entomol Soc Am 98: 367-381. [ Links ]
Smith-Caldas MRB, McPheron BA, Silva JG, Zucchi RA (2001) Phylogenetic relationships among species of the fraterculus group (Anastrepha: Diptera: Tephritidae) inferred from DNA sequences of mitochondrial cytochrome oxidase I. Neotrop Entomol 30: 565-573. [ Links ]
Silva JG (2000) Estudos moleculares, p.29-39. In Malavasi A, Zucchi RA (eds) Moscas-das-frutas de importância econômica no Brasil: conhecimento básico e aplicado. Ribeirão Preto, Holos Editora, 327p. [ Links ]
Silva JG, Barr NB (2008) Recent advances in molecular systematics of Anastrepha Schiner. In Sugayama RL, Zucchi RA, Ovruski S, Sivinski J (orgs) Proc. 7th International Symposium on Fruit Flies of Economic Importance. Salvador, Press Color, p. 13-18. [ Links ]
Sklorz RT (1992) Identificação da fauna de Drosophila (Diptera, Drosophilidae) da Cadeia do Espinhaço, e análises morfométricas das populações da espécie politípica D. serido. Tese doutorado, Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo, Ribeirão Preto, 115p. [ Links ]
Strauss RE, Bookstein FL (1982) The truss: body form reconstructions in morphometrics. System Zool 31: 113-135. [ Links ]
Tamura K, Dudley J, Nei M, Kumar S (2007) Molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biol Evol 24: 1596-1599. [ Links ]
Thompson JD, Higgins DG, Gibson TJ (1994) Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673-4680. [ Links ]
Zucchi RA (2007) Diversidad, distribucíón y hospederos del género Anastrepha en Brasil, p. 7-100, In Hernández-Ortiz V (ed) Moscas de la fruta en Latinoamérica (Diptera: Tephritidae): diversidad, biología y manejo. México, D. F. , S y G Editores, viii + 167p. [ Links ]
Correspondence:
Roberto A Zucchi
Departamento de Acarologia e Entomologia
Escola Superior de Agricultura Luiz de Queiroz - ESALQ/USP
13418-900, Piracicaba, SP, Brasil
razucchi@esalq.usp.br
Received 9 February 2011 and accepted 31 March 2011
Edited by Takumasa Kondo - CORPOICA











uBio 