Distinct carbapenems susceptibility profiles in isogenic isolates of Klebsiella pneumoniae presenting Ompk36 disruption and expression of down-regulated bla_KPC-2

Perfis distintos de suscetibilidade a carbapenêmicos em isolados isogênicos de Klebsiella pneumoniae apresentando interrupção de Ompk36 e expressão de bla_KPC-2 negativamente regulada

Abstract

The isolation of multidrug-resistant Klebsiella pneumoniae in hospitals is a major public health threat, increasing patient hospitalization costs, morbidity and mortality. Therefore, this work investigated the resistance mechanisms that produced different carbapenems susceptibility profiles in two isogenic strains of K. pneumoniae isolated from the same patient in a public hospital in Recife, Pernambuco. The genes that encode the main porins in K. pneumoniae, ompK35 and ompK36, and several beta-lactamase genes were analyzed. The expression of these genes was evaluated by quantitative real time PCR (polymerase chain reaction) with reverse transcriptase (RT-qPCR). SDS-PAGE (sodium dodecyl sulphate–polyacrylamide gel electrophoresis) was performed to analyze the outer membrane proteins. The analysis of the ompK36 genetic environment disclosed an IS903 insertion sequence disrupting this gene in the ertapenem resistant isolate (KPN133). The bla_KPC-2 gene showed down-regulated expression in both isolates. Our findings show that changes in porins, especially OmpK36, are more determinant to carbapenems susceptibility profile of bacterial isolates than variations in bla_KPC gene expression.

Keywords:
bacterial outer membrane proteins; antimicrobial drug resistance; beta-lactam resistance

Resumo

O isolamento de Klebsiella pneumoniae multirresistente em hospitais é uma grande ameaça à saúde pública, aumentando os custos de internação, morbidade e mortalidade dos pacientes. Portanto, este trabalho investigou os mecanismos de resistência que produziram diferentes perfis de suscetibilidade aos carbapenêmicos em duas cepas isogênicas de K. pneumoniae isoladas do mesmo paciente em um hospital público em Recife, Pernambuco. Foram analisados ​​os genes que codificam as principais porinas em K. pneumoniae, ompK35 e ompK36, e diversos genes de beta-lactamases. A expressão desses genes foi avaliada por PCR (reação em cadeia da polimerase quantitativa em tempo real) com transcriptase reversa (RT-qPCR). SDS-PAGE (dodecil sulfato de sódio-poliacrilamida gel eletroforese) foi realizada para analisar as proteínas da membrana externa. A análise do ambiente genético ompK36 revelou uma sequência de inserção IS903 interrompendo este gene no isolado resistente ao ertapenem (KPN133). O gene bla_KPC-2 apresentou expressão negativamente regulada em ambos os isolados. Nossos achados mostram que alterações nas porinas, especialmente OmpK36, são mais determinantes no perfil de suscetibilidade aos carbapenêmicos de isolados bacterianos do que variações na expressão do gene bla_KPC.

Palavras-chave:
proteínas da membrana externa bacteriana; resistência a drogas antimicrobianas; resistência a beta-lactâmicos

1. Introduction

Klebsiella pneumoniae is an important opportunistic pathogen in the Enterobacterales order which causes infections related to healthcare (Munoz-Price et al., 2013). The number of hospital outbreaks related to this microorganism is increasingly frequent, mainly due to the change in the pattern of susceptibility to antimicrobials (Castanheira et al., 2019).

Resistance to carbapenems in this species is mainly related to the acquisition of β-lactamases, the most common of which are carbapenemases, especially the Klebsiella pneumoniae carbapenemase (KPC). KPC-producing strains of K. pneumoniae, originally isolated in the USA, have spread and reached a wide geographical distribution (Villegas et al., 2006; Gupta et al., 2011; Nordmann et al., 2012; Melo et al., 2024; Zagui et al., 2022).

In addition to the enzymatic mechanisms, the reduced permeability of the outer membrane due to the loss or deficiency of transmembrane proteins (porins), may be necessary for the KPC-producing microorganism to reach high levels of carbapenem resistance, because It is through these channels that these antimicrobials penetrate the bacterial cell (Vera-Leiva et al., 2017; Wise et al., 2018).

In K. pneumoniae, the main porins of the outer membrane protein (OMP), OmpK35 and OmpK36, homologous to the well-studied OmpF and OmpC, respectively, in Escherichia coli, have been implicated in reduced susceptibility to carbapenem (Doménech-Sánchez et al., 2003).

Although the occurrence of changes in porins are frequently reported in K. pneumoniae, studies that relate these findings to the expression of OMPKs and beta-lactamases genes have been reported uncommonly.

2. Materials and Methods

2.1. Bacterial strains and susceptibility profile

The bacterial isolates of K. pneumoniae used, KPN132 and KPN133, were obtained from blood samples from a single patient admitted to the intensive care unit in a public hospital from Recife, Pernambuco, Brazil. Species identification and antimicrobial susceptibility tests were performed using the automated Vitek2® system (BioMerieux, Marcy l'Etoile, France). After isolation and identification, the strains were transferred to preservation medium, 15% glycerol and Müeller Hinton broth (HIMEDIA®) containing the Meropenem (8 μg/mL), and kept in frozen stock, at -80 ºC, until the day of use.

The interpretation of the results was performed according to Clinical and Laboratory Standards Institute (CLSI, 2021).

2.2. Clonal relatedness analysis

The PFGE (pulsed field gel electrophoresis) of the K. pneumoniae isolates was performed using CHEF 415 DR II (Bio-Rad, Richmond, CA, USA). The restriction patterns were determined by the Xba1 enzyme, analyzed, and interpreted according to the criteria of Tenover and colleagues (Tenover et al., 1995). The determination of the sequence type (ST) was performed by PCR for the constitutive expression genes (rpoB, gapA, mdh, pgi, phoE, infB, and tonB) according to Diancourt and colleagues (Diancourt et al., 2005) and compared using the Institut Pasteur platform.

2.3. Plasmid analysis and transformation

Plasmid DNA was isolated using the Plasmid Mini Kit (QIAGEN). E. coli R861 and E. coli Top10 isolates were used as size determinants and chromosomal DNA patterns, respectively. The plasmid transfer was carried out using E. coli DH5alfa as a receptor strain. The transformant cells were selected in Müeller Hinton medium with 100 µg/mL ampicillin.

2.4. PCR amplification and DNA sequence analysis

The genomic DNA of the bacterial isolates was extracted using the Wizard® Genomic DNA Purification Kit (Promega) and quantified by spectrophotometry on NanoDrop 2000® equipment (Thermo Scientific). The analysis of the genes of porins (ompK35 and ompK36) and beta-lactamases (bla_KPC, bla_TEM, bla_CTX-M, bla_SHV) was performed by PCR (Hangzhou Bioer Techonology). The primers used in the reactions are described in Table 1. The amplification products were purified using the Clean-Up Purification Kit (Promega) and sequenced using a 3500 Genetic Analyzer and BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). Sequences from the GenBank database were used as the reference for the analysis of mutations in gene sequences (ATCC 13883 KN046818.1 and KCTC 2242 CP002910.1). The IS Finder (https://isfinder.biotoul.fr/) was used to identify and analyze insertion sequences.

Table 1
Oligonucleotides used for beta-lactamases and porin analysis.

Primer		Sequence 5’ 3’	Target gene	Using	Length	Reference
KPC	F	TGTCACTGTATCGCCGTC	bla KPC-2	coding region	1011	Yigit et al., 2001
	R	CTCAGTGCTCTACAGAAAACC
	F	TCGCTAAACTCGAACAGG		expression	59	This study
	R	TTACTGCCCGTTGACGCCCAATCC
CTX-M	F	SCSATGTGCAGYACCAGTAA	blaCTXM-2	coding region	500	Cao et al., 2002
	R	CCGCRATATGRTTGGTGGTG
TEM	F	TCGGGGAAATGTGCGCG	bla TEM		700
	R	TGCTTAATCAGTGAGGCACC
SHV	F	TTATCTCCCTGTTAGCCACC	bla SHV-11		900
	R	GATTTGCTGATTTCGCTCGG
ompK35	F	GCGCAATATTCTGGCAGTGG	ompK35	genetic environment	1996	Doumith et al., 2009
	R	TAAACGATACCAACCGCAGCCT
	F	TCCCTGCCCTGCTGGTAG		expression	93	This study
	R	CTGGTGTCGCCATTGGTGG
ompK36	F	GACCCGCCAGAAGGTGCCCA	ompK36	genetic environment	2159	Doumith et al., 2009
	R	TGATGTTGCCGGGGATCAGGGA
	F	AACCCAGATCAACGACCAGC		expression	98	This study
	R	ATCGCTGGAGCTTTCAGTGT
rpoB	F	CTGATGCCTCAGGATATGATCAAC	rpoB	expression	72	This study
	R	CTGGCTGGAACCAAAGAACTCT

2.5. Analysis of outer membrane proteins

For analysis of porins OmpK35 and OmpK36 by SDS-PAGE, bacterial cells were cultured in Müeller Hinton broth for a period of 5 h at 37 °C and later lysed by sonication. The OMPs were isolated with Sarcosil 20% and recovered by centrifugation at 14000 rpm for 60 minutes at 4 °C. Protein quantification was performed using Coomassie Blue G-250 and 20 μg of protein was applied on a 12.5% ​​SDS-PAGE gel. The images of the one-dimensional gels were analyzed in Gel Analyzer 2010 (http://www.gelanalyzer.com/index.html).

2.6. Analysis of gene expression

The bacterial total RNA was extracted using the TRIzol® Reagent Kit (Thermo Fisher Scientific). The synthesis of complementary DNA (cDNA) was carried out using the EasyScript ™ Reverse Transcriptase/EasyScript ™ cDNA Synthesis Kit (Applied Biological Materials Inc. ABM®). The relative expression of the ompK35, ompK36, and bla_KPC genes was evaluated by RT-qPCR, using 25 ng from each sample tested. The constitutive expression gene rpoB was used as an endogenous control, and a sensitive strain of K. pneumoniae was used as a reference sample (KPN077). The reactions were performed in the StepOne TM Real-time PCR System (Applied Biosystems), using SYBR Green I as the detector. All tests were done in technical triplicates. The expression levels of the genes were analyzed by the method 2^-ΔΔCq (Livak and Schmittgen, 2001).

Ethics. This work was approved by the Research Ethics Committee of the University of Pernambuco, Brazil (reference nº 265.604).

3. Results

3.1. Clonal relationship and susceptibility to antimicrobials

The PFGE showed that the isolates have an indistinguishable restriction pattern (Figure S1, Supplementary Material) and the analysis of the allelic profile revealed that they belong to ST11. According to the susceptibility profile, the isolates showed an MDR (multidrug resistance) phenotype with resistance to beta-lactams and quinolones. KPN133 isolate showed a higher resistance profile, especially to carbapenems (Table S1, Supplementary Material).

3.2. Transfer of resistance determinants

The plasmid profile of the clinical isolates KPN132 and KPN133 showed that they harbored four plasmids (39 kb, 11 kb, and two plasmids smaller than 6.9 kb). An IncK 39kb plasmid was transferred by transformation to recipient E. coli cells using plasmid DNA from both clinical samples. The bla_KPC-2, bla_TEM, and bla_CTX-M-2-like genes were detected in transformant cells, TF132 and TF 133, suggesting their localization in the IncK plasmid.

3.3. Disruption of porin genes

The analysis of the ompK36 genetic environment (Figure S2, Supplementary Material) showed the presence of the IS903-like insertion sequence interrupting this gene in the KPN133 isolate. Our results indicated that the ompK35 gene sequence was preserved.

3.4. Gene expression

The expression of the bla_KPC-2, ompK35, and ompK36 genes was negatively regulated in both clinical isolates when compared to passive reference levels (Table 2).

Table 2
Characteristics of KPC-producing Klebsiella pneumoniae.

Isolates	Carbapenem MIC (µg/mL)			β-Lactamases	Codify region		Relative Expression
	IPM	MER	ETP		ompK35	ompK36	ompK35	ompK36	blakpc
KPN 132	64 R	32 R	0.12 S	blaKPC-2, blaTEM, blaCTX-M-2, blaSHV-11	Preserved	Preserved	-46.945 SD: 0.002	-17.963 SD: 0.0019	-416.575 SD: 0.00045
TF 132	32 R	32 R	ND	blaKPC-2, blaTEM, blaCTX-M-2	-	-	-	-	-
KPN 133	256 R	64 R	> 32 R	blaKPC-2, blaTEM, blaCTX-M-2, blaSHV-11	Preserved	Disruption by IS 903	-106.352 SD: 0.034	-58,193.964 SD: 9.317	-3,924.585 SD: 5.194
TF 133	32 R	8 R	ND	blaKPC-2, blaTEM, blaCTX-M-2	-	-	-	-	-

• TF—transformant; IMI—imipenem; MER—meropenem; ETP—ertapenem; R—resistant; S—susceptible.

3.5. Outer proteins

The analysis of OMPs by SDS-PAGE revealed that both isolates have a decrease in the production of OmpK36 compared to the control isolate. Moreover, the KPN133 isolate showed a more evident decrease. For the OmpK35 porin, there were no visible differences between the isolates (Figure 1).

Figure 1
One-dimensional gel SDS-PAGE. The bands highlighted by the red frame correspond to 35 KDa (OmpK35) and 36 KDa (OmpK36), respectively. There is a lower abundance of the 36 KDa band in isolate KPN133 compared to strain KPN132 and the control (KPN077). Legend: M— Marker; 132A, 132B, 132C— KPN132 Triplicates; 133A, 133B, 133C — KPN133 Triplicates; 077A, 077B, 077C — Control triplicates.

4. Discussion

This work reported a high carbapenem resistance level in ST11 K. pneumoniae isogenic isolates belonging to clonal complex 258 (CC258), one of the most widespread clonal complexes in the world. This high-risk international CC is of concern for its contribution to the spread of multiple β-lactamases, such as KPC (Yu et al., 2019).

The susceptibility profiles of the isolates indicated that alterations in the ompK36 gene may be the main cause of the different MIC values for carbapenems presented by the isolates, especially for ertapenem. We propose that the increase in MIC for ertapenem in isolate KPN133 was due to the inactivation of the ompK36 gene by an IS903, resulting in a significant decrease in the availability of unaltered DNA to be transcribed and translated.

The results of the relative expression of bla_KPC indicate that there may be a strict control in the mechanisms of regulation of the expression of this gene, mainly in strains that present alterations in the porins, because the decrease of these proteins disturbs the entry of the antimicrobial in the cell. A similar hypothesis was inferred by Doumith and colleagues previously (Doumith et al., 2009).

Other studies that evaluated the expression of OMPs and KPC genes mentioned a codependency relationship between them. The increase in the expression of porin genes results a decrease in carbapenem MICs, especially to ertapenem, despite the bla_KPC gene expression (Jacoby et al., 2004; Landman et al., 2009; Wong et al., 2022).

These data are reinforced by the decrease in the expression of the bla_KPC gene in the KPN133 isolate that also presented ompK36 expression down-regulated, that resulted in resistance to carbapenems, mainly to meropenem and ertapenem as also demonstrated by Fernandéz and Hancock (Fernandéz and Hancock, 2012).

According to our findings, it is estimated that the membrane permeability in the KPN132 isolate was less affected than in KPN133 and that, for this reason, a greater amount of the antimicrobial will enter the cell. However, given the less down-regulated expression of bla_KPC-2 in KPN132, even reaching the bacterial intracellular medium, part of the drug can be hydrolyzed by KPC but not reaching resistance levels.

The results of this study reinforce the role of outer membrane proteins in the resistance to beta-lactams, such as ertapenem. Lumbreras-Iglesias and colleagues already detected that ertapenem can be particularly affected by the concomitant loss of these two main porins and this fact may reflect the slower penetration of this drug through the smaller porins, if present in the outer membrane (Lumbreras-Iglesias et al., 2021).

The importance of porins in antimicrobial susceptibility over other β-lactam resistance mechanisms is supported by the results of a recent multicenter study by Wise et al., which analyzed 487 isolates of K. pneumoniae that did not have carbapenemase genes but were resistant to ertapenem. In 83% of the strains investigated, the presence of interruptions in one or both ompK35 and ompK36 genes was detected (Wise et al., 2018).

The coding region of the ompK35 gene was conserved in both isolates and it was observed that expression of this gene in KPN133 isolate was only – 2.26-fold level in relation to KPN132 isolate. On the other hand, the ompK36 gene was disrupted by an IS903 in KPN133. Furthermore, its expression was – 3423.17-fold level in this isolate, compared to KPN132 isolate. Codify regions analyzes and relative expression porin genes data suggesting that OmpK36 has an important role in a susceptibility profile to carbapenems, in isolates reported here, as well as those, reported by some authors (Doumith et al., 2009; Landman et al., 2009).

Finally, as demonstrated in this work, high levels of resistance to carbapenems, as well as to other β-lactams, may require the association of different resistance mechanisms, such as production of β-lactamases, inactivation or decrease in the expression of porin genes and overexpression of efflux systems, as suggested by some studies (Doménech-Sánchez et al., 2003; Kitchel et al., 2010; Fernández and Hancock, 2012).

Supplementary Material

Supplementary material accompanies this paper.

Table S1. Antimicrobial susceptibility profile shown in isolates KPN132, KPN133 and their transformants.

Figure S1. PFGE. The indicative columns of KPN132 and KPN133 (only column 12 and 13, respectively) show an identical pattern of bands in both samples, which classifies them as indistinguishable (isogenic), according to the criteria of Tenover et al. (1995)http://dx.doi.org/10.1128/jcm.33.9.2233-... . The other columns refer to samples unrelated to this study.

Figure S2. Schematic representation of the genetic environment of ompK36 in isolate KPN 133, showing the integration site of the IS903-like insertion sequence. The arrow represents the direction of the transcript.

This material is available as part of the online article from https://doi.org/10.1590/1519-6984.269946

Acknowledgements

We thank the Genomics and Gene Expression Technological Platform of the Center for Biological Sciences of the Federal University of Pernambuco for gene sequencing, the Laboratory of Plant Genetics and Proteomics (LGPP) of the Federal University of Pernambuco for the protein analysis and the Research Support Center from the Federal Rural University of Pernambuco (CENAPESQ) for the equipment to carry out gene expression experiments. This study was partially financed by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior, Brasil (CAPES) – Finance code 001.

5. References

• CAO, V., LAMBERT, T., NHU, D.Q., LOAN, H.K., HOANG, N.K., ARLET, G. and COURVALIN, P., 2002. Distribution of extended-spectrum beta-lactamases in clinical isolates of Enterobacteriaceae in Vietnam. Antimicrobial Agents and Chemotherapy, vol. 46, no. 12, pp. 3739-3743. http://dx.doi.org/10.1128/AAC.46.12.3739-3743.2002 PMid:12435670.
  » http://dx.doi.org/10.1128/AAC.46.12.3739-3743.2002
• CASTANHEIRA, M., DESHPANDE, L.M., MENDES, R.E., CANTON, R., SADER, H.S. and JONES, R.N., 2019. Variations in the occurrence of resistance phenotypes and Carbapenemase genes amongEnterobacteriaceaeisolates in 20 years of the SENTRY Antimicrobial Surveillance Program. Open Forum Infectious Diseases, vol. 6, suppl. 1, pp. S23-S33. http://dx.doi.org/10.1093/ofid/ofy347 PMid:30895212.
  » http://dx.doi.org/10.1093/ofid/ofy347
• CLINICAL AND LABORATORY STANDARDS INSTITUTE – CLSI, 2021. M100: Performance Standards for Antimicrobial Susceptibility Testing 31th ed. Wayne, PA: CLSI.
• DIANCOURT, L., PASSET, V., VERHOEF, J., GRIMONT, P.A. and BRISSE, S., 2005. Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates. Journal of Clinical Microbiology, vol. 43, no. 8, pp. 4178-4182. http://dx.doi.org/10.1128/JCM.43.8.4178-4182.2005 PMid:16081970.
  » http://dx.doi.org/10.1128/JCM.43.8.4178-4182.2005
• DOMÉNECH-SÁNCHEZ, A., MARTÍNEZ-MARTÍNEZ, L., HERNÁNDEZ-ALLÉS, S., DEL CARMEN CONEJO, M., PASCUAL, A., TOMÁS, J.M., ALBERTÍ, S. and BENEDÍ, V.J., 2003. Role of Klebsiella pneumoniae OmpK35 porin in antimicrobial resistance. Antimicrobial Agents and Chemotherapy, vol. 47, no. 10, pp. 3332-3335. http://dx.doi.org/10.1128/AAC.47.10.3332-3335.2003 PMid:14506051.
  » http://dx.doi.org/10.1128/AAC.47.10.3332-3335.2003
• DOUMITH, M., ELLINGTON, M.J., LIVERMORE, D.M. and WOODFORD, N., 2009. Molecular mechanisms disrupting porin expression in ertapenem-resistant Klebsiella and Enterobacter spp. clinical isolates from the UK. The Journal of Antimicrobial Chemotherapy, vol. 63, no. 4, pp. 659-667. http://dx.doi.org/10.1093/jac/dkp029 PMid:19233898.
  » http://dx.doi.org/10.1093/jac/dkp029
• FERNÁNDEZ, L. and HANCOCK, R.E.W., 2012. Adaptive and mutational resistance: role of porins and efflux pumps in drug resistance. Clinical Microbiology Reviews, vol. 25, no. 4, pp. 661-681. http://dx.doi.org/10.1128/CMR.00043-12 PMid:23034325.
  » http://dx.doi.org/10.1128/CMR.00043-12
• GUPTA, N., LIMBAGO, B.M., PATEL, J.B. and KALLEN, A.J., 2011. Carbapenem-resistant Enterobacteriaceae: epidemiology and prevention. Clinical Infectious Diseases, vol. 53, no. 1, pp. 60-67. http://dx.doi.org/10.1093/cid/cir202 PMid:21653305.
  » http://dx.doi.org/10.1093/cid/cir202
• JACOBY, G.A., MILLS, D.M. and CHOW, N., 2004. Role of beta-lactamases and porins in resistance to ertapenem and other beta-lactams in Klebsiella pneumoniae. Antimicrobial Agents and Chemotherapy, vol. 48, no. 8, pp. 3203-3206. http://dx.doi.org/10.1128/AAC.48.8.3203-3206.2004 PMid:15273152.
  » http://dx.doi.org/10.1128/AAC.48.8.3203-3206.2004
• KITCHEL, B., RASHEED, J.K., ENDIMIANI, A., HUJER, A.M., ANDERSON, K.F., BONOMO, R.A. and PATEL, J.B., 2010. Genetic factors associated with elevated carbapenem resistance in KPC-producing Klebsiella pneumoniae. Antimicrobial Agents and Chemotherapy, vol. 54, no. 10, pp. 4201-4207. http://dx.doi.org/10.1128/AAC.00008-10 PMid:20660684.
  » http://dx.doi.org/10.1128/AAC.00008-10
• LANDMAN, D., BRATU, S. and QUALE, J., 2009. Contribution of OmpK36 to carbapenem susceptibility in KPC-producing Klebsiella pneumoniae. Journal of Medical Microbiology, vol. 58, no. Pt 10, pp. 1303-1308. http://dx.doi.org/10.1099/jmm.0.012575-0 PMid:19556371.
  » http://dx.doi.org/10.1099/jmm.0.012575-0
• LIVAK, K.J. and SCHMITTGEN, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)). Method. Methods., vol. 25, no. 4, pp. 402-408. http://dx.doi.org/10.1006/meth.2001.1262 PMid:11846609.
  » http://dx.doi.org/10.1006/meth.2001.1262
• LUMBRERAS-IGLESIAS, P., RODICIO, M.R., VALLEDOR, P., SUÁREZ-ZARRACINA, T. and FERNÁNDEZ, J., 2021. High-level carbapenem resistance among OXA-48-producing Klebsiella pneumoniae with functional OmpK36 alterations: maintenance of Ceftazidime/Avibactam Susceptibility. Antibiotics, vol. 10, no. 10, pp. 1174. http://dx.doi.org/10.3390/antibiotics10101174 PMid:34680754.
  » http://dx.doi.org/10.3390/antibiotics10101174
• MELO, M.C., CARVALHO NETO, A.P.M., MARANHÃO, T.L.G.Q., COSTA, E.S., NASCIMENTO, C.M.A., CAVALCANTI, M.G.S., FERREIRA-JÚNIOR, G.C., ROCHA, M.A.N., SILVA, K.M., SANTOS JÚNIOR, C.J. and ROCHA, T.J.M., 2024. Microbiological characteristics of bloodstream infections in a reference hospital in northeastern Brazil. Brazilian Journal of Biology = Revista Brasileira de Biologia, vol. 84, pp. e253065. http://dx.doi.org/10.1590/1519-6984.253065 PMid:34817043.
  » http://dx.doi.org/10.1590/1519-6984.253065
• MUNOZ-PRICE, L.S., POIREL, L., BONOMO, R.A., SCHWABER, M.J., DAIKOS, G.L., CORMICAN, M., CORNAGLIA, G., GARAU, J., GNIADKOWSKI, M., HAYDEN, M.K., KUMARASAMY, K., LIVERMORE, D.M., MAYA, J.J., NORDMANN, P., PATEL, J.B., PATERSON, D.L., PITOUT, J., VILLEGAS, M.V., WANG, H., WOODFORD, N. and QUINN, J.P., 2013. Clinical epidemiology of the global expansion of Klebsiella pneumoniae carbapenemases. The Lancet. Infectious Diseases, vol. 13, no. 9, pp. 785-796. http://dx.doi.org/10.1016/S1473-3099(13)70190-7 PMid:23969216.
  » http://dx.doi.org/10.1016/S1473-3099(13)70190-7
• NORDMANN, P., DORTET, L. and POIREL, L., 2012. Carbapenem resistance in Enterobacteriaceae: here is the storm! Trends in Molecular Medicine, vol. 18, no. 5, pp. 263-272. http://dx.doi.org/10.1016/j.molmed.2012.03.003 PMid:22480775.
  » http://dx.doi.org/10.1016/j.molmed.2012.03.003
• TENOVER, F.C., ARBEIT, R.D., GOERING, R.V., MICKELSEN, P.A., MURRAY, B.E., PERSING, D.H. and SWAMINATHAN, B., 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. Journal of Clinical Microbiology, vol. 33, no. 9, pp. 2233-2239. http://dx.doi.org/10.1128/jcm.33.9.2233-2239.1995 PMid:7494007.
  » http://dx.doi.org/10.1128/jcm.33.9.2233-2239.1995
• VERA-LEIVA, A., BARRÍA-LOAIZA, C., CARRASCO-ANABALÓN, S., LIMA, C., AGUAYO-REYES, A., DOMÍNGUEZ, M., BELLO-TOLEDO, H. and GONZÁLEZ-ROCHA, G., 2017. Klebsiella pneumoniae carbapenemasa, principal carbapenemasa en enterobacterias. Revista Chilena de Infectologia, vol. 34, no. 5, pp. 476-484. http://dx.doi.org/10.4067/S0716-10182017000500476 PMid:29488590.
  » http://dx.doi.org/10.4067/S0716-10182017000500476
• VILLEGAS, M.V., LOLANS, K., CORREA, A., SUAREZ, C.J., LOPEZ, J.A., VALLEJO, M. and QUINN, J.P., 2006. First detection of the plasmid-mediated class A carbapenemase KPC-2 in clinical isolates of Klebsiella pneumoniae from South America. Antimicrobial Agents and Chemotherapy, vol. 50, no. 8, pp. 2880-2882. http://dx.doi.org/10.1128/AAC.00186-06 PMid:16870793.
  » http://dx.doi.org/10.1128/AAC.00186-06
• WISE, M.G., HORVATH, E., YOUNG, K., SAHM, D.F. and KAZMIERCZAK, K.M., 2018. Global survey of Klebsiella pneumoniae major porins from ertapenem non-susceptible isolates lacking carbapenemases. Journal of Medical Microbiology, vol. 67, no. 3, pp. 289-295. http://dx.doi.org/10.1099/jmm.0.000691 PMid:29458684.
  » http://dx.doi.org/10.1099/jmm.0.000691
• WONG, J.L.C., DAVID, S., SANCHEZ-GARRIDO, J., WOO, J.Z., LOW, W.W., MORECCHIATO, F., GIANI, T., ROSSOLINI, G.M., BEIS, K., BRETT, S.J., CLEMENTS, A., AANENSEN, D.M., ROUSKIN, S. and FRANKEL, G., 2022. Recurrent emergence ofKlebsiella pneumoniaecarbapenem resistance mediated by an inhibitoryompK36mRNA secondary structure. Proceedings of the National Academy of Sciences of the United States of America, vol. 119, no. 38, pp. e2203593119. http://dx.doi.org/10.1073/pnas.2203593119 PMid:36095213.
  » http://dx.doi.org/10.1073/pnas.2203593119
• YIGIT, H., QUEENAN, A.M., ANDERSON, G.J., DOMENECH-SANCHEZ, A., BIDDLE, J.W., STEWARD, C.D., ALBERTI, S., BUSH, K. and TENOVER, F.C., 2001. Novel carbapenem-hydrolyzing beta-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrobial Agents and Chemotherapy, vol. 45, no. 4, pp. 1151-1161. http://dx.doi.org/10.1128/AAC.45.4.1151-1161.2001 PMid:11257029.
  » http://dx.doi.org/10.1128/AAC.45.4.1151-1161.2001
• YU, F., HU, L., ZHONG, Q., HANG, Y., LIU, Y., HU, X., DING, H., CHEN, Y., XU, X., FANG, X. and YU, F., 2019. Dissemination of Klebsiella pneumoniae ST11 isolates with carbapenem resistance in integrated and emergency intensive care units in a Chinese tertiary hospital. Journal of Medical Microbiology, vol. 68, no. 6, pp. 882-889. http://dx.doi.org/10.1099/jmm.0.000981 PMid:31050634.
  » http://dx.doi.org/10.1099/jmm.0.000981
• ZAGUI, G.S., TONANI, K.A.A., FREGONESI, B.M., MACHADO, G.P., SILVA, T.V., ANDRADE, L.N., ANDRADE, D. and SEGURA-MUÑOZ, S.I., 2022. Tertiary hospital sewage as reservoir of bacteria expressing MDR phenotype in Brazil. Brazilian Journal of Biology = Revista Brasileira de Biologia, vol 82, pp. e234471. http://dx.doi.org/10.1590/1519-6984.234471
  » http://dx.doi.org/10.1590/1519-6984.234471

Publication Dates

• Publication in this collection
  02 June 2023
• Date of issue
  2023

History

• Received
  28 Nov 2022
• Accepted
  27 Apr 2023