SciELO - Scientific Electronic Library Online

 
vol.40 issue3SBPC/ML: 60 anosEffect of cell culture system on the production of human viral antigens author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

  • Portuguese (pdf)
  • Article in xml format
  • How to cite this article
  • SciELO Analytics
  • Curriculum ScienTI
  • Automatic translation

Indicators

Related links

Share


Jornal Brasileiro de Patologia e Medicina Laboratorial

Print version ISSN 1676-2444On-line version ISSN 1678-4774

J. Bras. Patol. Med. Lab. vol.40 no.3 Rio de Janeiro June 2004

http://dx.doi.org/10.1590/S1676-24442004000300003 

ARTIGO ORIGINAL ORIGINAL PAPER

 

Comparação de três protocolos de extração de DNA a partir de tecido fixado em formol e incluído em parafina

 

Comparison of three DNA extraction protocols from formaldehyde-fixed and paraffin-embedded tissues

 

 

José Veríssimo FernandesI; Rosely de Vasconcellos MeissnerII; Thales Allyrio Araújo de Medeiros FernandesIII; Luiz Reginaldo Menezes da RochaIV; Maulori Curie CabralV; Luisa Lina VillaVI

IM. Sc. do Departamento de Microbiologia e Parasitologia da Universidade Federal do Rio Grande do Norte (UFRN)
IID. Sc. do Departamento de Microbiologia e Parasitologia da UFRN
IIIBolsista do Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) pela UFRN
IVEsp. do Departamento de Patologia da UFRN
VD. Sc. do Departamento de Virologia do Instituto de Microbiologia Prof. Paulo de Góes, Universidade Federal do Rio de Janeiro (UFRJ)
VID. Sc. do Instituto Ludwig de Pesquisa sobre o Câncer

Endereço para correspondência

 

 


RESUMO

OBJETIVO: Padronizar um método alternativo para extração de DNA a partir de tecido fixado em formol e conservado em arquivos de blocos de parafina, visando à realização de estudos retrospectivos.
MÉTODOS: Comparou-se a eficiência de protocolos de extração de DNA a partir de tecido parafinado, para análise por reação em cadeia de polimerase (PCR), tomando-se como parâmetro um protocolo baseado em um kit comercial. Foram feitas extrações do DNA de 60 espécimes por três métodos: o protocolo A, baseado no kit GlassMAX; o B, utilizando-se o kit GFXTM; e o C, tendo como base o método de Banerjee et al.(2). A integridade e a suficiência do DNA presente na amostra foram avaliadas pela amplificação por PCR de um segmento de 110pb do gene da b-globina humana, com visualização por meio de eletroforese em gel de poliacrilamida, corado pela prata. Resultados: Das 60 amostras analisadas, 45 apresentaram resultado positivo na PCR quando o DNA foi extraído por qualquer um dos três protocolos. Em seis amostras, a amplificação foi positiva apenas para o DNA extraído pelos protocolos A e C. Em três amostras, o resultado foi positivo apenas para o DNA extraído pelo protocolo A, e em duas, apenas para o DNA extraído pelo protocolo C.
CONCLUSÕES: O protocolo C apresentou desempenho semelhante ao do protocolo A, com as vantagens de apresentar menor custo, dispensar o uso de kit comercial, além de não utilizar solventes orgânicos, revelando-se uma alternativa viável para a obtenção de DNA a partir de tecido fixado em formol e incluído em parafina.

Unitermos: Material parafinado, Extração de DNA, PCR


ABSTRACT

OBJECTIVE: To set up a method for DNA extraction from paraffin embedded cervical cancer specimens, previously formalin-fixed, aiming to accomplish retrospective analysis.
METHODS: Sixty specimens were submitted to DNA extraction by three different methods. All of them involved digestion of the tissues by proteinase K, followed by DNA purification, based in three different approaches: protocol A used a DNA isolation kit, GlassMax (Gibco/BRL); protocol B was performed with the kit GFXTM Amersham Pharmacia Biotech; and protocol C was based on the method proposed by Banerjee et al.(2), with modifications. To evaluate the integrity and sufficiency of the DNA, the samples were submitted to a in vitro amplification of a segment of the human b-globin gene, and the PCR products were analyzed by electrophoresis on 7% polyacrylamide gels, followed by silver staining. Results: Among 60 analyzed samples, 45 showed positive results when submitted to the three protocols. In six samples, PCR fragments were obtained with DNAs extracted through protocols A e C; in three samples, DNA extraction was achieved with protocol A only; and in two samples the DNA was successfully extracted only through protocol C.
CONCLUSIONS: Protocols A and C generated similar results. Although protocol C is more labor-intensive and time consuming, it does not require a commercial kit and therefore has a lower cost. Furthermore, it does not require the use of organic solvents and may be considered a good alternative for DNA extraction from paraffin embedded tissues.

Key words: Paraffin-embedded tissue, DNA extraction, PCR


 

 

Introdução

O desenvolvimento da biologia molecular e da genética nas últimas décadas permitiu o estabelecimento de um amplo corpo de técnicas aplicadas na investigação biológica que tiveram profunda influência nas pesquisas médicas(4). Entre esses grandes avanços tecnológicos destaca-se a possibilidade de amplificação de DNA utilizando-se a reação em cadeia da polimerase (PCR). Descrita inicialmente por Saiki et al., em 1985(14), essa técnica ganhou rapidamente extensivo uso por ser o método mais sensível para a detecção de agentes infecciosos, bem como de desordens genéticas(11). Com o advento dessa técnica surgiram novos tipos de abordagens nos campos da biologia e da medicina, inclusive a análise retrospectiva de espécimes antigos conservados em arquivos de blocos de parafina(1, 10, 18, 21). Assim, geneticistas têm utilizado espécimes clínicos de arquivos para investigar doenças hereditárias; pesquisadores de câncer têm usado esses recursos para estudar as relações entre as mutações e a doença, bem como para identificar metástases de tumores primários(5, 7, 19). Além disso, essa técnica permite aos patologistas estabelecer uma melhor relação entre as alterações histopatológicas observadas no tecido, com a possível participação de agentes infecciosos, como vírus(3, 18).

Diariamente amostras de tecidos são removidas do corpo humano para análise, visando ao diagnóstico de doenças, e fragmentos desses materiais são fixados em formol, incluídos em parafina e estocados nos serviços de patologia. Esses espécimes representam importante fonte de material biológico para a pesquisa. Estudos retrospectivos empregando técnicas de biologia molecular tornaram-se possíveis com o estabelecimento de técnicas de extração de DNA a partir de tecido parafinado, trazendo grande contribuição para a obtenção de dados epidemiológicos sobre várias doenças(6, 8, 11, 20). Com este tipo de abordagem, espécimes biológicos arquivados por mais de 40 anos puderam ser analisados com sucesso pela técnica de PCR(13, 18, 19). Um fator limitante desse tipo de estudo é a obtenção do DNA em condições propícias para a amplificação(11). Seqüências de DNA com tamanhos que variam de cem a 1.500 pares de bases podem ser obtidas a partir de tecido fixado em formol tamponado e incluído em parafina(8, 10, 11). Contudo, tem sido demonstrado que a fixação do tecido, dependendo do tempo e do fixador utilizado, pode resultar na degradação do DNA, prejudicando significativamente a sua amplificação por PCR, de forma que, em geral, a detecção de fragmentos maiores que 200 pares de bases não é obtida com sucesso(12).

Em geral, os métodos de extração de DNA a partir de tecido parafinado requerem múltiplos tratamentos com xileno para a remoção da parafina, seguidos de digestão com proteases e extração do DNA com fenol-clorofórmio-álcool isoamílico(21). Apesar de eficiente, esse método é laborioso e requer o uso de solventes orgânicos, que são tóxicos e podem trazer prejuízos para o meio ambiente, além de exigir várias lavagens e centrifugações, o que aumenta o risco de contaminação das amostras. Um método alternativo para extração de DNA a partir de tecido parafinado que promove a remoção da parafina pelo aquecimento em forno de microondas e que dispensa o uso de solventes orgânicos foi proposto por Banerjee et al.(2). Posteriormente, Pinto e Villa(13) estabeleceram um protocolo alternativo para extração de DNA a partir de tecido parafinado, em substituição ao método do fenol/clorofórmio, utilizando o kit GlassMAX (Gibco/BRL), que era ao mesmo tempo simples e eficiente, permitindo o sucesso da amplificação de DNA extraído de espécimes arquivados por até 20 anos. Esse protocolo vinha sendo empregado no nosso laboratório, mas, com a saída de linha do produto, tornou-se necessária a busca de um outro método.

Nesse trabalho apresentamos os resultados obtidos na extração de DNA de 60 amostras de câncer do colo do útero que haviam sido fixadas em formol não-tamponado e conservadas em blocos de parafina, empregando-se dois tipos de protocolos alternativos e comparando-se os resultados com aqueles obtidos com o protocolo padronizado por Pinto e Villa(13) empregando o kit comercial GlassMAX.

 

Material e método

Extração do DNA

Foram selecionados 60 blocos de parafina contendo espécimes cervicais obtidos de pacientes com diagnóstico de câncer do colo do útero, cujos fragmentos de tecido haviam sido fixados em formol não-tamponado, incluídos em parafina e arquivados no Departamento de Patologia da Universidade Federal do Rio Grande do Norte. Após a limpeza do bloco, fazendo-se a remoção da parafina da parte externa, foram cortadas três a quatro fatias de 8mm cada, utilizando-se micrótomo limpo, com navalhas descartáveis. Após o corte, as fatias foram coletadas com auxílio de palitos estéreis e colocadas em tubos de microcentrífuga de 1,5ml. De cada bloco contendo os espécimes foram cortadas fatias, as quais foram colocadas em três tubos separados e submetidas à extração do DNA utilizando-se três tipos de protocolo.

Protocolo A (kit GlassMax)

Esse protocolo, que permite a extração de DNA a partir de tecido parafinado empregando-se o kit comercial GlassMax (Gibco BRL, USA), foi utilizado seguindo-se os procedimentos previamente descritos por Pinto e Villa(13).

Protocolo B (kit GFXTM Genomic Blood DNA Purification

Adicionaram-se 200ml de solução de Tris 10mM, EDTA 10mM e 200mg/ml de proteinase K (TEP) aos tubos contendo os espécimes, incubando-se logo após, por 48 horas, a 55ºC para digestão. Em seguida, foram incubados a 95ºC durante 10 minutos para a inativação da proteinase residual e de outras proteínas contaminantes e colocados numa posição inclinada para que a parafina, ao se solidificar, se depositasse nas paredes dos tubos. O material digerido foi transferido para um tubo limpo e, a partir daí, seguiu-se o procedimento recomendado pelo fabricante.

Protocolo C

Esse protocolo foi estabelecido com base no proposto por Banerjee et al.(2) com a introdução de algumas modificações. O Tween 20 foi substituído por Triton X-100 no tampão de digestão (Tris-HCl 50mM, pH 8,5, EDTA 1mM e Triton X-100 0,5%). Duzentos microlitros deste tampão foram adicionados aos tubos contendo os espécimes de tecido parafinado. Os tubos foram bem fechados, vedados com parafilme, levados ao forno de microondas e submetidos a cinco pulsos de 10 segundos cada, na potência máxima, para fundir a parafina. Em seguida foram centrifugados por 10 minutos, a 19.000xg, ficando a parafina depositada como um anel nas paredes dos tubos. O tecido parcialmente digerido, presente no sobrenadante, foi transferido para outro tubo limpo. Posteriormente, foram adicionados 200ml da solução TEP e os tubos foram incubados em banho-maria, durante 24 horas, a 42ºC, e mais 3 horas a 56ºC. Após a digestão completa do tecido, os tubos foram incubados a 95ºC, durante 10 minutos, para a inativação da proteinase K residual e de proteínas contaminantes. A seguir, foram adicionados 200ml de solução de acetato de amônio 6M, pH 8,5, a cada tubo, agitados durante 20 segundos por inversão e submetidos à centrifugação a 19.000xg durante 5 minutos, à temperatura ambiente, para a precipitação das proteínas. Em seguida, o sobrenadante foi transferido para um tubo limpo e foram adicionados 600ml de isopropanol gelado, agitado suavemente e incubado durante a noite a -20°C. Centrifugou-se a 19.000xg, por 10 minutos, a 4ºC, para precipitação do DNA. Desprezou-se o sobrenadante e os tubos foram invertidos sobre papel-toalha para retirar o líquido residual. Logo após, foram adicionados 600ml de etanol a 70% gelado, misturando-se várias vezes por inversão e centrifugando-se novamente a 19.000xg por 10 minutos, a 4ºC, para purificação do DNA. Os tubos foram novamente invertidos sobre papel-toalha e deixados abertos por 15 minutos para secar. O precipitado contendo o DNA purificado foi ressuspenso em 100 a 200ml de água ultrapura (Milli-Q) estéril, incubado por 30 minutos a 65ºC para dissolução completa e estocado a -20ºC.

Avaliação da eficiência da extração do DNA por PCR

Todas as amostras de DNA extraídas pelo três protocolos foram analisadas para a presença de DNA através de PCR para amplificação de um segmento do gene da b-globina humana, utilizando-se um par de iniciadores designados PCO3+ (5’CTTCTGACACAACTGTGTTCACTAGC3’) e PCO4+ (5’TCACCGCAACTTCATCCACGTTCACC3’), que flanqueiam uma seqüência de 110 pares de bases(14). Em cada reação, o DNA extraído de células humanas da linhagem C33 foi utilizado como controle positivo e a água, como controle negativo. A reação foi realizada em um termociclador MJ Research, utilizando-se os seguintes componentes com suas respectivas concentrações para um volume final de 50ml: PCO3+ e PCO4+ 0,5mM; Taq DNA polimerase (GibcoBRL) 2,5U; 20mM de Tris HCl pH 8,4; 50mM de KCl; MgCl2 1,5mM, 200mM de cada dNTPs (Amersham Pharmacia Biotech) e 5 ou 7ml de DNA das amostras. As condições da reação foram as seguintes: um passo inicial de desnaturação por 4 minutos a 95°C, seguido de 40 ciclos com 1 minuto a 95°C para desnaturação; 1 minuto a 50°C para anelamento; 1 minuto a 72°C para extensão; e um último passo de 10 minutos a 72°C para a extensão final. Em seguida, 5ml dos produtos de cada reação de PCR foram misturados a 5ml do tampão de amostra, aplicados em gel de poliacrilamida a 7% e submetidos à eletroforese a 20mA(16). Como padrão de tamanho molecular utilizou-se o 100 Base-Pair Ladder (Amersham Pharmacia Biotech). Após a corrida, os géis foram corados pela prata, conforme descrito por Sanguinetti et al.(17).

Análise estatística

A análise de significância estatística foi realizada por meio do teste de c2, utilizando-se o programa Pepi, desenvolvido por Gahlinger e Abramson(9).

Esse estudo foi aprovado pelo Comitê de Ética em Pesquisa da Universidade Federal do Rio Grande do Norte.

 

Resultados

A amplificação por PCR a partir do DNA extraído usando-se os protocolos em avaliação é mostrada na Figura 1, para uma seqüência alvo do gene da b-globina humana em que os produtos da reação foram submetidos a eletroforese em gel de poliacrilamida a 8% e corados pela prata. Das 60 amostras processadas para extração do DNA, 54 (90%) foram positivas quando submetidas à extração pelo protocolo A; 45 (75%), pelo protocolo B; e 53 (88,3%), pelo protocolo C (Tabela). Do total de amostras analisadas, 45 (75%) se mostraram positivas para a amplificação da seqüência alvo quando o DNA foi extraído por qualquer um dos três protocolos utilizados. Em seis amostras foi obtido DNA em condições de ser amplificado apenas pelos protocolos A e C; em três amostras, os resultados da amplificação foram positivos apenas para o DNA extraído pelo protocolo A; e em duas, a amplificação da seqüência alvo foi observada apenas para o DNA extraído utilizando-se o protocolo C (Figura 2).

 

 

 

 

 

 

Discussão

A aplicação dos métodos moleculares na análise de espécimes biológicos conservados em arquivos tem sido limitada por certas condições técnicas em virtude de dificuldades para a obtenção do DNA em condições de ser amplificado(11). O aperfeiçoamento dos métodos de extração de DNA a partir de tecido conservado em parafina, de forma a torná-los de execução mais simples e de menor custo, facilitaria enormemente a utilização desses materiais em estudos retrospectivos. Nesse trabalho apresentamos os resultados da comparação de três protocolos de extração de DNA a partir de tecido fixado em formol não-tamponado e incluído em parafina na obtenção de DNA em condições de ser amplificado por PCR.

O protocolo A, estabelecido por Pinto e Villa(13), fundamentado na utilização de um kit comercial (GlassMax), apesar de ter se mostrado eficiente, de execução simples, de grande praticidade e, adequado para uso de rotina, tornou-se inviável, tendo-se em vista que o kit foi retirado do comércio pelo fabricante, o que nos levou a buscar um método alternativo que pudesse substituí-lo com a mesma eficiência. Para isso foram testados o protocolo B, resultante de uma adaptação do kit comercial GFXTM, utilizado com sucesso na extração de DNA a partir de células sangüíneas e células cervicais em suspensão, e o protocolo C, estabelecido como base no proposto por Banerjee et al.(2). No protocolo C foram introduzidas modificações, tendo-se em vista que o protocolo original não apresentou resultado satisfatório, talvez por causa do estado de conservação do DNA presente nos espécimes analisados. Isso pode ter ocorrido em conseqüência do tratamento recebido durante a fixação do tecido, tornando-se necessária uma purificação, ainda que parcial, do DNA, obtida por meio das modificações introduzidas. A eficiência do método pode ser considerada satisfatória, considerando-se que os espécimes haviam sido fixados em formol não-tamponado, o que provavelmente resultou na degradação do DNA, prejudicando a sua amplificação por PCR.

Os resultados da amplificação da seqüência alvo do DNA extraído pelos três protocolos revelam que os protocolos A e C apresentaram desempenho semelhante na obtenção de DNA em condições de ser amplificado por PCR (p = 0,769). A eficiência apresentada pelo protocolo C não mostrou diferença significativa em relação ao protocolo B, embora tenha ficado muito próxima do limite de significância estatística (p = 0,059). Além disso, o protocolo B apresentou eficiência significativamente mais baixa em relação ao A (p = 0,031). Assim, o protocolo C se mostrou mais adequado para substituir o A, não apenas pelo fato de ser mais eficiente que o B, mas principalmente por dispensar o uso de kit comercial, o que significa menor custo, embora seja ligeiramente mais laborioso.

Comparando-se os resultados conseguidos com o protocolo C com aqueles obtidos utilizando-se os métodos convencionais de extração de DNA a partir de tecido parafinado, que dependem da utilização de solventes orgânicos para a remoção da parafina e de fenol/clorofórmio para a extração do DNA, o protocolo C se apresenta como alternativa viável para a extração de DNA a partir de espécimes biológicos conservados nessas condições. Ele apresenta algumas vantagens em relação aos protocolos convencionais, pois requer um número menor de centrifugações e lavagens, que se constituem em etapas que favorecem a introdução de contaminantes. Além de ser de execução mais simples e rápida, o protocolo C dispensa, ainda, o uso de solventes orgânicos, que são substâncias tóxicas, representando risco para o manipulador e para o meio ambiente.

 

Referências

1. ARNHEIM, N.; WHITE, T.; RAINEY, W. E. Application of PCR: organismal and population biology. Bioscience, v. 40, p. 174-82, 1990.        [ Links ]

2. BANERJEE, S. K. et al. Microwave-based DNA extraction from paraffin-embedded tissue for PCR amplification. BioTechniques, v. 18, n. 5, p. 768-73, 1995.        [ Links ]

3. BRANDSMA, J. L. et al. Detection and typing of papillomavirus DNA in formaldehyde-fixed paraffin-embedded tissue. Arch Otolaryngol Head Neck Surg, v. 116, p. 844-8, 1990.        [ Links ]

4. BARRY, I; EISENSTEIN, M. D. The polymerase chain reaction. New England J Med, v. 322, p. 178-83, 1990.        [ Links ]

5. BUMER, G. C.; RABINOVITCH, P. S.; LOEB, L. A. Analysis of c-Ki-ras mutations in human colon carcinoma by cell sorting polymerase chain reaction and DNA sequencing. Cancer Res, v. 49, p. 2141-6, 1989.        [ Links ]

6. DUBEAU, L. et al. Southern blot analysis of DNA extracted from formalin-fixed pathology specimens. Cancer Res, v. 46, p. 2964-9, 1986.        [ Links ]

7. FRYE, R. A.; BENZ, C. C.; LIU, E. Detection of amplified oncogenes by differential polymerase chain reaction. Oncogene, v. 4, p. 1153 -7, 1989.        [ Links ]

8. GOELZ, S. E.; HAMILTON, S. R.; VOGELSTEIN, B. Purification of DNA from formaldhyde fixed and paraffin embedded human tissue. Biochem Biophys Res Commun, v. 130, p. 118 26, 1985.        [ Links ]

9. GAHLINGER, P. M.; ABRAMSON J. H. Computer programs for epidemiologic analysis: PEPI. Stoen Mountain: USD, 1995.        [ Links ]

10. IMPRAIM, C. C. et al. Analysis of DNA extracted from formalin-fixed, paraffin-embedded tissue by enzymatic amplification and hybridization with sequence-specific oligonucleotides. Biochem Biophys Res Commun, v. 142, p. 710-6, 1987.        [ Links ]

11. KALLIO, P. et al. A simple method for isolation of DNA from formalin-fixed paraffin-embedded samples for PCR. J Virol Methods, v. 35, p. 39-47, 1991.        [ Links ]

12. PÄÄBO, S. Ancient DNA: extraction, characterization, molecular cloning, and enzymatic amplification. Proc Natl Acad Sci USA, v. 86: 1939-43, 1989.        [ Links ]

13. PINTO, À. P.; VILLA, L. L. A spin cartridge system for DNA extraction from paraffin wax embedded tissues. Mol Pathol, v. 51, p. 48-9, 1998.        [ Links ]

14. SAIKI, R. K. et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science, v. 230, p. 1350-4,1985.        [ Links ]

15. SAIKI, R. K. et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science, v. 239, p. 487-91,1988.        [ Links ]

16. SAMBROOK, J.; FRITSCH, E. F.; MANNIATIS, T. Molecular cloning: a laboratory manual. 2. ed. New York: Cold Spring Harbor Laboratory Press, 1992.        [ Links ]

17. SANGUINETTI, C. J.; DIAS NETO, E.; SIMPSON, A. J. Rapid silver staining and recovery of PCR products separated on polyacrylamide gels. BioTechniques, v. 17, n. 5, p. 914-21, 1994.        [ Links ]

18. SHIBATA, D.; MARTIN, W. J.; ARNHEIM, N. Analysis of DNA sequences in forty-year-old paraffin-embedded thin-tissue sections: a bridge between molecular biology and classical histology. Cancer Res, v. 48, p. 4564-6, 1988.        [ Links ]

19. SHIBATA, D. et al. Detection of human papillomavirus DNA in fine-needle aspirations of metastatic squamous-cell carcinoma of the uterine cervix using the polymerase chain reaction. Diagn Cytopathol, v. 5, p. 40-3, 1989.        [ Links ]

20. WARFORD, A. et al. Soutern blot analysis of DNA extracted from formal-saline fixed and paraffin wax embedded tissue. J Pathol, v. 154, p. 313- 20, 1988.        [ Links ]

21. WRIGHT, D. K.; MANOS, M. M. Sample preparation from paraffin-embedded tissue. In: INNIS. EL AL. (Eds.). PCR Protocols. San Diego, California: Academic Press Inc., 1990. p. 153-8.        [ Links ]

 

 

Endereço para correspondência
José Veríssimo Fernandes
Universidade Federal do Rio Grande do Norte
Centro de Biociências
Departamento de Microbiologia e Parasitologia
Campus Universitário – Lagoa Nova
CEP 59072-970 – Natal-RN
Tel.: (84) 215-3437
Fax: (84) 211-9210
e-mail: veris@cb.ufrn.br

Primeira submissão em 02/01/04
Última submissão em 06/03/04
Aceito para publicação em 30/03/04
Publicado em 20/06/04
Apoio financeiro do CNPq.

 

 

Trabalho realizado no Departamento de Microbiologia e Parasitologia da UFRN.

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License