Oral mucositis and microbial status in acute lymphoblastic leukemia subjects undergoing high-dose chemotherapy

Abstract

Aim

To assess oral microbial status in patients with acute lymphoblastic leukemia (ALL) undergoing high-dose chemotherapy and to unravel possible associations between nosocomial pathogens and the establishment of chemotherapy-induced oral mucositis (CIOM).

Methods

Oral mucosa, saliva, and peripheral blood samples were collected from 46 ALL subjects one day prior to chemotherapy (D0) and 2 weeks after treatment initiation (D14). Clinical intraoral inspection was performed by a single practitioner, with mucositis classification performed according to the WHO oral toxicity scale. Blood components were quantified by automatic flow cytometry, while oral Staphylococcus aureus and Pseudomonas aeruginosa were detected by Polymerase Chain Reaction with species-specific primers. Associations among bacteria and clinical findings were determined by Fisher’s Exact test, longitudinal bacterial changes by paired Macnemar, and correlations among blood parameters and mucositis status or bacteria via Mann-Whitney.

Results

S. aureus displayed higher detection rates at D14 (p < 0.05) and was positively associated with mucositis, adoption of a non-solid diet (all p < 0.001), nausea and fever (all p < 0.05). Conversely, P. aeruginosa did not correlate to CIOM clinical parameters. At the systemic standpoint, lower hemoglobin levels associated with CIOM and fever events (all p < 0.01).

Conclusion

The study evidences S. aureus as a potential pathogen in ALL-CIOM, reaffirming microbial control as an important preventive measure during high-dose immunosuppressive therapy. The weight of non-white-blood-cell parameters should be validated as novel CIOM biomarkers in prospective research.

Oral mucositis; Acute Lymphoblastic Leukemia; Antineoplastic agents; Polymerase chain reaction; Bacteria

Introduction

Acute lymphoblastic leukemia (ALL) is the most prevalent cancer in childhood and the second most common leukemia variant in adults¹ , ² . For decades, the administration of chemotherapeutic agents (chemotherapy) has been the gold standard treatment approach for ALL, offering high success rates that may vary according to patient age, disease subtype, clinical profile and country of origin² - ⁴ . Although immunosuppressive therapy represents a pillar strategy in cancer, it frequently engenders a serious side-effect known as mucositis, with prevalence ranging from 30% to 98% of patients⁵ - ⁸ . Indeed, oral mucositis (OM) is considered the most debilitating isolated condition during antineoplastic therapy⁹ , bearing significant impact on the patient’s quality of life, treatment adherence, and prognosis¹⁰ , ¹¹ . It is especially significant in cases requiring hematopoietic stem cell transplantation, where high-dose therapeutic regimens are more commonly required¹¹ . In this reality, a significant portion of leukemia patients is expected to develop at least some degree of OM in the first weeks of hospitalization⁸ and, therefore, caregivers must be prepared to be involved responsibly.

Despite its undeniable relevance for adherence and prognosis of cancer treatment, the pathobiological mechanisms that govern OM have not been fully disclosed, often leading caregivers to commit to multi-agent therapy in the hope of increasing favorable outcome¹² . OM is currently regarded as a cascade result of biologically complex host-related events¹⁰ , ¹³ with proinflammatory mediators harboring important predisposing effects¹⁰ , ¹¹ , ¹⁴ . At the cellular level, chemical toxicity to epithelial cells is believed to be the prevailing factor¹² , leading to cellular alterations, apoptosis and dose-dependent enlargement of the intercellular space¹⁵ . On the other hand, over the past two decades, research on the role of the oral microbiome in OM has yielded contrasting results. Although the reduction of anaerobic Gram-negatives and fungi by broad-spectrum antimicrobials has yielded positive impact on radiotherapy-induced oral mucositis (RIOM)¹⁶ , ¹⁷ , the taxonomic identity of bacteria at the species level has not yet reached clear consensus. More recently, oral dysbiosis has been highlighted as a key factor in the establishment and duration of both chemotherapy-induced oral mucositis (CIOM) and RIOM, with the potential involvement of periodontopathogen groups revealed by molecular-based methodologies¹⁸ , ¹⁹ . Moreover, upregulation of chemotherapy-induced mucosal inflammatory factors by specific bacterial species was observed in an in vitro model of CIOM, suggesting a mechanism of drug and microbe collusion¹⁵ . Nevertheless, the relevance of unconventional and non-oral bacterial consortia in the onset and severity of CIOM remains unattended⁷ , reaffirming the importance of complementary disease association initiatives²⁰ .

Considering the existing evidence and the prolonged period of hospitalization recommended by ALL treatment guidelines, the involvement of nosocomial pathogens in CIOM should not be ruled out. In this sense, we evaluated 14-day longitudinal changes in OM status, peripheral blood components, and presence of the opportunistic pathogens S. aureus and P. aeruginosa in ALL patients undergoing a high-dose canonical chemotherapy regimen, to shed additional light into the biological factors governing CIOM.

Materials and Methods

Ethical considerations: The study was approved by the Human Research Ethics Committee of the Amazonas State University (UEA, Manaus, Amazonas, Brazil, CAAE number 46295215.0.0000.5016) in compliance with the 196/96 Resolution of the National Health Council of the Brazilian Health Ministry and the 7th version of the Declaration of Helsinki (2013). Written informed consent was obtained from all the participants, parents, or legal guardians, prior to sample collection.

Patient selection: The study population consisted of acute lymphoblastic leukemia (ALL) patients regularly attended at the Hematology and Hemotherapy Hospital Foundation (FHEMOAM, Manaus, Amazonas, Brazil). Diagnosis was made by clinical and laboratorial analysis, including complete blood count, myelogram and immunophenotyping by flow cytometry, according to the guidelines of the Brazilian Cooperative Group for Treatment of Childhood ALL (GBTLI ALL-99)¹² . Volunteers were recruited from patients referred for chemotherapy, regardless of gender and age. Individuals previously submitted to antibiotic therapy in the 3-month period prior to sample collection, as well as those with systemic comorbidities, were not included. Samples were collected within the “remission induction phase” of the GBTLI ALL-99 protocol, in which low and high risk subjects were treated with a unified drug cocktail. The chemotherapy regimen consisted of a combination of prednisone (40 mg/m²/day), vincristine (1.5 mg/m²/week), L-asparaginase (5000 UI/m²/day), and daunorubicin (25 mg/m²/week) coupled with intrathecally delivered methotrexate, cytarabine and dexamethasone with doses adjusted by age group²¹ .

Whole blood collection and cell flow cytometry analysis: Peripheral blood samples were collected by venipuncture as part of the routine follow-up of ALL treatment. Samples were collected using 5.0 mL EDTA vacuum tubes at two distinct time points: 1 day prior to chemotherapy (D0) and 14 days after chemotherapy initiation (D14). Hemoglobin levels and platelet, leukocyte and neutrophil counts were quantified in a flow cell hematology analyzer (ADVIA 2120i, Siemens).

Intraoral examination and specimen collection: Clinical examination was performed by a single practitioner to ensure maximum consistency. Classification of mucositis was performed according to the World Health Organization (WHO) oral toxicity scale system: Grade I (mild: oral soreness, erythema), Grade II (moderate: oral erythema, ulcers, solid diet tolerated), Grade III (severe: oral ulcers, liquid diet only), Grade IV (life-threatening: oral feeding impossible). Oral pain was considered positive when the patient reported spontaneous oral discomfort or pain when speaking or swallowing. For maximum representation of the oral microbiota, samples were composed of a pool of saliva and mucosa swab samples, collected on D0 and D14. Samples were obtained by intraoral saliva accumulation for 1 minute, followed by displacement into 25 mL collection tubes containing Tris-EDTA buffer (TE) pH 8.0 as nucleic acid preserver. Mucosal swab samples were obtained by scratching the buccal mucosa, hard palate, buccal vestibule and mouth floor with a sterile cotton swab, followed by placement of the swab tip in the collection tubes.

Reference bacteria growth:Staphylococcus aureus and Pseudomonas aeruginosa reference strains were gently provided by the Oswaldo Cruz Foundation (Fiocruz, Manaus, Brazil). Bacterial cells were initially reactivated by streaking on trypticase soy agar plates at 37^oC under aerobic conditions. After initial bacterial growth, one colony per species was transferred to a tube containing trypticase soy broth, and incubated in an orbital shaker at 37^oC at 150 rpm for 24 hours, aiming for optimal cell growth.

PCR amplification of bacterial DNA: Samples and reference bacteria were vortexed for 1 min, sedimented by centrifugation at 10,000 x g, and the supernatant was discarded. DNA extraction was conducted with PureLink® Genomic DNA Mini Kit according to the manufacturer’s instructions, with addition of lysozyme and proteinase K to ensure lysis of Gram-negative and Gram-positive bacteria. Genomic DNA was quantified by Qubit 3.0 colorimetric assay (Invitrogen, Carlsbad, USA), and nucleic acid quality was assessed by the A260/A280 ratio, with accepted values ranging from 1.8 to 2.0. The polymerase chain reaction (PCR) was performed in 20 µL total volume in Veriti® thermocycler (ThermoFisher, Waltham, USA) with species-specific oligonucleotide primers ( Table 1 )²² , ²³ , according to the following conditions: 1 x PCR buffer, 1.5 mM MgCl₂ (1,5 mM), 0.2 mM dNTPs, 0.2 µM each primer, 1.0 U Platinum® Taq DNA Polymerase (Invitrogen, Carlsbad, USA) and 5.0 ng sample DNA. The thermocycling profile for P. aeruginosa was: initial denaturation at a 94^oC for 2 min, followed by 25 cycles of DNA denaturation at 94^oC for 1 min, primer annealing at 60^oC for 40 sec, DNA extension at 72^oC for 30 sec, and a final extension step at 72^oC for 2 min. The thermocycling profile for S. aureus was: initial denaturation at a 94^oC for 2 min, followed by 25 cycles of DNA denaturation at 94^oC for 1 min, primer annealing at 55^oC for 30 sec, DNA extension at 72^oC for 30 sec, and a final extension step at 72^oC for 2 min. PCR amplicons from reference bacteria (positive controls) and clinical samples were subjected to agarose gel electrophoresis. For this purpose, 3.0 µL of the amplified DNA was loaded into a 1.5 % agarose gel prepared with 1x TBE buffer (0.002 M EDTA, 0.089 M Tris, 0.089 M Boric acid) and Gelred stain (Biotium). Samples were electrophoretically shifted under 700 mA for 60 min, using 1 Kb Plus DNA Ladder (Invitrogen) as the amplicon size reference. The DNA was then visualized under UV for validation of PCR efficiency and specificity, and digitally registered via transilluminator (L-PIX, Loccus Biotecnologia).

Table 1
Species-specific oligonucleotide PCR primers used in the study.

Target species	gene	Oligonucleotide sequence	Amplicon size
Pseudomonas aeruginosa	oprL	Forward 5’–ATGGAAATGCTGAAATTCGGC–3’	504 bp
		Reverse 5’–CTTCTTCAGCTCGACGCGACG–3’
Staphylococcus aureus	nuc	Foward 5’–GCGATTGATGGTGATACGGTT–3’	447 bp
		Reverse 5’–AGCCAAGCCTTGACGAACTAAAGC–3’

Statistical analysis: The Shappiro-Wilk test was used as preliminary tool to verify data distribution. Associations among oral bacteria and clinical findings were assessed by Fisher’s Exact test, or by the Chi-square test with Yates correction when applicable. Associations among blood parameters and mucositis or oral bacteria were evaluated with the Mann-Whitney test. Differences in bacteria detection frequencies between timeframes were assessed using paired-sample McNemar test.

Results

Overall, 46 ALL patients, 27 males (58.7%) and 19 females (41.3%) ranging from 2 to 59 years-old (median 7.5 years-old) were analyzed. Patient clinical, hematological and dietary features are summarized in Table 2 . In terms of oral health status, 19 subjects (41.3%) developed at least some degree of OM after 14 days of chemotherapy initiation, with the majority of cases represented by grade 1. PCR detection of bacteria revealed P. aeruginosa in 5/46 (10.9%) and 9/46 (19.6%) subjects, and S. aureus in 11/46 (23.9%) and 20/46 (43.6%) subjects (D0 and D14 respectively), with a paired sample Mcnemar test indicating significantly increased detection rates at D14 for S. aureus (p = 0.035), but not for P. aeruginosa (p = 0.344). Moreover, S. aureus was significantly associated with mucositis, fever, nausea, and adoption of semi-solid or liquid diet, whereas P. aeruginosa did not correlate with clinical or dietary parameters ( Table 3 ). At the systemic standpoint, the application of the Mann-Whitney non-parametric test among blood component levels (hemoglobin, platelets, neutrophils and leucocytes), OM status and bacterial detection unveiled significant associations between lower hemoglobin levels (at D0 and D14) and OM onset, as well as between lower hemoglobin levels (at D14) and P. aeruginosa, as described in Figure 1 .

Table 2
Clinical, dietary, and blood parameters of 46 ALL subjects submitted to high-dose chemotherapy regimen.

Clinical features (n)	D0	D14
Systemic features
Fever	17 (37.0%)	16 (34.8%)
Nausea	12 (26.1%)	12 (26.1%)
Diarrhea	8 (17.4%)	3 (6.5%)
Oral mucositis
Grade 0 (no mucositis)	46 (100%)	27 (58.7%)
Grade 1 (mild)	0	12 (26.1%)
Grade 2 (moderate)	0	3 (6.6%)
Grade 3 (severe)	0	2 (4.3%)
Grade 4 (life-threatening)	0	2 (4.3%)
Diet type and administration (n)
Free diet, oral	46 (100%)	27 (58.7%)
Semi-solid, oral	0	14 (30.4%)
Liquid, oral	0	5 (10.9%)
Liquid, nasogastric tube	0	0
Liquid, parenteral	0	0
Blood parameters (median, IQR)	D0	D14
Leukocyte (cells/mL)	10,965 (19,617)	9,003 (19,022)
Neutrophil (cells/mL)	4,008 (7,494)	3,143 (7,393)
Platelets (per mL)	85,156 (67,593)	84,451 (64,509)
Hemoglobin (g/dL)	8.55 (3.48)	7.70 (3.41)

Table 3
PCR detection of P. aeruginosa and S. aureus in 46 acute lymphoblastic leukemia patients 14 days after high-dose chemotherapy initiation (D14), according to clinical and dietary parameters.

Parameter	Parameter status/type	Positive for P. aeruginosa	Positive for S. aureus
Mucositis	observed	26.3% (5/19) †	78.9% (15/19) † **
	not observed	14.8% (4/27)	18.5% (5/27)
Oral pain	observed	40.0% (2/5) †	80.0% (4/5) †
	not observed	17.1% (7/41)	22.0% (9/41)
Fever	observed	31.3% (5/16) †	68.8% (11/16) † *
	not observed	13.3% (4/30)	30.0% (9/30)
Nausea	observed	16.7% (2/12) †	75.0% (9/12) † *
	not observed	58.8% (20/34)	29.4% (10/34)
Diet	type I	14.8% (4/27) †	18.5% (5/27) † **
	type II	26.3% (5/19)	78.9% (15/19)

• † Chi-square Test with Yates correction; † Fisher Exact Test (* p < 0.05; ** p < 0.001). Diet type I = free consistency; Diet type II = liquid or semi-solid

Figure 1
Hemoglobin (A) levels and platelet (B), leucocyte (C) and neutrophil (D) counts according to presence of mucositis and oral bacteria in 46 acute lymphoblastic leukemia patients, at baseline (D0) and 14 days after high-dose chemotherapy initiation (D14). Mann-Whitney test (* p < 0.05, ** p < 0.01).

Discussion

This study was conducted to assess the influence of high dose immunosuppressive chemotherapy on oral mucositis and bacterial status, and to investigate potential relationships among the detected bacteria, oral health and systemic parameters. We chose a 14-day timeframe based on a previous report, according to which OM clinical signs peak at around 7 and 14 days after chemotherapy installment, with spontaneous resolution around a week after¹⁰ . Overall, the prevalence of chemotherapy-induced OM fell within the expected 30%-75% range reported by earlier studies²⁴ , ²⁵ , but lower than those disclosed by recent research on various cancer types⁵ , ⁷ , ⁸ . In respect to OM severity, most cases belonged to the mild grade 1 OM WHO type, with few occurrences of grade 2, and very rare cases of grades 3 and 4. As the severity-based subcategorization resulted in excess of data stratification, OM was considered binomially, with statistical analysis performed regardless of clinical levels, also considering the fact that bacterial abundances are generally comparable among different OM grades²⁰ .

The weight imposed by oral bacteria on OM establishment and progression has been a long-lasting concern in hematology, and the preventive effect of oral hygiene on cancer patients brings incisive clues to a pathological role in CIOM⁸ . Although the advent of 16S rDNA-based methodologies has revealed higher relative abundances of Gram-negative anaerobic bacilli and periodontopathic bacteria in CIOM and head-and-neck cancer RIOM¹⁸ , ²⁰ , the influence of non-indigenous oral species on OM rests undetermined. In this study, S. aureus and P. aeruginosa were chosen as target species due to their well-established virulence arsenal and nosocomial transmission patterns. Truthfully, both species have been described as opportunistic pathogens of the skin, open wounds, lungs and the bloodstream²⁶ , ^{2 7} , with S. aureus contributing to higher cancer mortality rates²⁸ , and P. aeruginosa to antibiotic-resistance related deaths in acute leukemia²⁹ , leading to the assumption of a potential role in OM.

Overall, our results revealed S. aureus as a putative pathogen in CIOM, presenting significant correlation with mucositis, nausea, and adoption of non-solid diet (all p < 0.05). In accordance, S. aureus lays among the most prevalent genera in saliva, buccal mucosa and lateral tongue of radio and chemotheray-treated subjects²⁰ , ³⁰ and has been previously detected in intra and extra-oral complications, including apical periodontitis and panstomatitis³⁰ - ³³ . Here, oral microbiome disruption promoted by chemotherapeutic agents³⁴ could be the prevailing determinant for S. aureu s higher proliferation rates at D14, but prospective research based on broad microbial detection techniques should be conducted to validate such hypothesis. Furthermore, the association between blood stream detection of S. aureus and severe cases of CIOM has already been pointed out previously ³³ , partially accrediting our observations and, at the same time, suggesting the oral-to-bloodstream route as a potential pathway to bacteremia. On the other hand, although an increase in the number of subjects harboring P. aeruginosa was detected at D14 when compared to D0, we could not disclose relevant associations between this species and the establishment of OM, bestowing the results of a 16S rDNA-based study on CIOM in various cancer types³⁴ . Taken together, the results, along with the evident ubiquity of S. aureus in chemo and radiotherapy-treated cancer patients²⁰ , ³⁰ , stress the need for thorough oral microbial characterization in ALL prior to chemotherapy installment as CIOM risk-assessment measure. We also believe that judicious administration of antimicrobials is an important preventive step towards mitigation of OM, as previously illustrated by the positive outcomes obtained with broad-spectrum antibiotics such as tobramycin¹⁶ , ¹⁷ . This holds greater importance for neutropenic subjects, whom are susceptible to bacteremia by S. aureus , thus prone to life-threatening risk ³⁰ . It is worth noting that, even though our results indicate S. aureus as a putative pathogen in CIOM, dysbiosis could still be playing a relevant role¹⁸ , ²⁷ and, in this reality, efforts should be taken in assessing the ecological interactions that, together, could boost the cytotoxic effects elicited by chemotherapy³⁴ .

Finally, the results also revealed a positive correlation between S. aureus and fever in ALL (D14) (p < 0.05). Nonetheless, since the presence of S. aureus was not directly assessed in peripheral blood, a systemic culprit could not be defined. In addition, as lower peripheral hemoglobin and platelet levels (both at D0 and D14) related to pyrexia (at D14) (Mann-Whitney, p < 0.01 and p < 0.05, respectively) ( figure 1 ), the results point to underlying host-related mechanisms that may deserve further consideration. At the systemic standpoint, our results revealed that curtailed hemoglobin levels (at D0 and D14) are predictive of OM onset at D14 (Mann Whitney, p < 0.01) ( figure 1 ) and are generally in line with the recent observations obtained in severe OM associated with head and neck cancer radiotherapy³⁵ , suggesting non-white-blood-cell (non-WBC) parameters as promising variables for future investigations. On the other hand, we did not detect significant associations among neutrophil and leukocyte counts with systemic or intraoral clinical parameters, partially contrasting the findings of the same study. Regarding the association of peripheral blood components and bacteria, an inverse correlation was observed between hemoglobin levels and PCR detection of P. aeruginosa in saliva and mucosal samples. All other blood parameters had no relevant influence on either P. aeruginosa or S. aureus detection rates.

In conclusion, this study suggests S. aureus as a putative pathogen in ALL-CIOM and emphasizes the importance of preventive measures during the early stages of high-dose immunosuppressive therapy, including the adoption of higher oral hygiene standards and intrahospital professional oral assistance. Finally, the predictive power of non-WBC peripheral blood components in ALL-CIOM should be appraised in prospective research, aiming for more precise diagnosis and risk-directed case management.

Acknowledgements

We would like to thank the Brazilian funding agencies Fundação de Amparo à Pesquisa do Estado do Amazonas - FAPEAM (024/2014) and Conselho Nacional de Desenvolvimento Científico e Tecnológico - CNPq (485568/2012) for financial support, and the FHEMOAM staff for clinical and technical assistance.

References

• ¹
  Mohseni M, Uludag H, Brandwein JM. Advances in biology of acute lymphoblastic leukemia (ALL) and therapeutic implications. Am J Blood Res. 2018 Dec 10;8(4):29-56.
• ²
  Terwilliger T, Abdul-Hay M. Acute lymphoblastic leukemia: a comprehensive review and 2017 update. Blood Cancer J. 2017 Jun;7(6):e577. doi: 10.1038/bcj.2017.53.
• ³
  Pui C-H, Yang JJ, Bhakta N, Rodriguez-Galindo C. Global efforts toward the cure of childhood acute lymphoblastic leukemia. Lancet Child Adolesc Health. 2018 Jun;2(6):440-54. doi: 10.1016/S2352-4642(18)30066-X.
• ⁴
  Kato M, Manabe A. Treatment and biology of pediatric acute lymphoblastic leukemia. Pediatr Int. 2018 Jan;60(1):4-12. doi: 10.1111/ped.13457.
• ⁵
  He M, Zhang B, Shen N, Wu N, Sun J. A systematic review and meta-analysis of the effect of low-level laser therapy (LLLT) on chemotherapy-induced oral mucositis in pediatric and young patients. Eur J Pediatr. 2018 Jan;177(1):7-17. doi: 10.1007/s00431-017-3043-4.
• ⁶
  Spielberger R, Stiff P, Bensinger W, Gentile T, Weisdorf D, Kewalramani T, et al. Palifermin for oral mucositis after intensive therapy for hematologic cancers. N Engl J Med. 2004 Dec;351(25):2590-8. doi: 10.1056/NEJMoa040125.
• ⁷
  Vozza I, Caldarazzo V, Ottolenghi L. Changes in microflora in dental plaque from cancer patients undergoing chemotherapy and the relationship of these changes with mucositis: a pilot study. Med Oral Patol Oral Cir Bucal. 2015 May;20(3):e259-66. doi: 10.4317/medoral.19934.
• ⁸
  Legert KG, Remberger M, Ringdén O, Heimdahl A, Dahllöf G. Reduced intensity conditioning and oral care measures prevent oral mucositis and reduces days of hospitalization in allogeneic stem cell transplantation recipients. Support Care Cancer. 2014 Aug;22(8):2133-40. doi: 10.1007/s00520-014-2190-7.
• ⁹
  Bellm LA, Epstein JB, Rose-Ped A, Martin P, Fuchs HJ. Patient reports of complications of bone marrow transplantation. Support Care Cancer. 2000 Jan;8(1):33-9. doi: 10.1007/s005209900095.
• ¹⁰
  Villa A, Sonis ST. Mucositis: pathobiology and management. Curr Opin Oncol. 2015 May;27(3):159-64. doi: 10.1097/CCO.0000000000000180.
• ¹¹
  Lalla RV, Sonis ST, Peterson DE. Management of oral mucositis in patients with cancer. Dent Clin North Am. 2008 Jan;52(1):61-77, viii. doi: 10.1016/j.cden.2007.10.002.
• ¹²
  Hong CHL, Gueiros LA, Fulton JS, Cheng KKF, Kandwal A, Galiti D, et al. Systematic review of basic oral care for the management of oral mucositis in cancer patients and clinical practice guidelines. Support Care Cancer. 2019 Oct;27(10):3949-67. doi: 10.1007/s00520-019-04848-4.
• ¹³
  Sonis ST. Mucositis: The impact, biology and therapeutic opportunities of oral mucositis. Oral Oncology. 2009 Dec;45(12):1015-20. doi: 10.1016/j.oraloncology.2009.08.006.
• ¹⁴
  Ye Y, Carlsson G, Agholme MB, Karlsson-Sjöberg J, Yucel-Lindberg T, Pütsep K, et al. Pretherapeutic plasma pro- and anti- inflammatory mediators are related to high risk of oral mucositis in pediatric patients with acute leukemia: a prospective cohort study. PLoS One. 2013 May;8(5):e64918. doi: 10.1371/journal.pone.0064918.
• ¹⁵
  Sobue T, Bertolini M, Thompson A, Peterson DE, Diaz PI, Dongari-Bagtzoglou A. Chemotherapy-induced oral mucositis and associated infections in a novel organotypic model. Mol Oral Microbiol. 2018 Jun;33(3):212-23. doi: 10.1111/omi.12214.
• ¹⁶
  Symonds RP, McIlroy P, Khorrami J, Paul J, Pyper E, Alcock SR, et al. The reduction of radiation mucositis by selective decontamination antibiotic pastilles: a placebo-controlled double-blind trial. Br J Cancer. 1996 Jul;74(2):312-7. doi: 10.1038/bjc.1996.359.
• ¹⁷
  Spijkervet FK, Van Saene HK, Van Saene JJ, Panders AK, Vermey A, Mehta DM, et al. Effect of selective elimination of the oral flora on mucositis in irradiated head and neck cancer patients. J Surg Oncol. 1991 Mar;46(3):167-73. doi: 10.1002/jso.2930460309.
• ¹⁸
  Hou J, Zheng H, Li P, Liu H, Zhou H, Yang X. Distinct shifts in the oral microbiota are associated with the progression and aggravation of mucositis during radiotherapy. Radiother Oncol. 2018 Oct;129(1):44-51. doi: 10.1016/j.radonc.2018.04.023.
• ¹⁹
  Vanlancker E, Vanhoecke B, Sieprath T, Bourgeois J, Beterams A, De Moerloose B, et al. Oral microbiota reduce wound healing capacity of epithelial monolayers, irrespective of the presence of 5-fluorouracil. Exp Biol Med (Maywood). 2018 Feb;243(4):350-60. doi: 10.1177/1535370217753842.
• ²⁰
  Vesty A, Gear K, Biswas K, Mackenzie BW, Taylor MW, Douglas RG. Oral microbial influences on oral mucositis during radiotherapy treatment of head and neck cancer. Support Care Cancer. 2020 Jun;28(6):2683-91. doi: 10.1007/s00520-019-05084-6.
• ²¹
  Cazé MO, Bueno D, dos Santos MEF. [Referential study of a chemotherapy protocol for acute lymphocytic leukemia in childhood]. Rev HCPA. 2010;30(1):5-12. Portuguese.
• ²²
  De Vos D, Lim A, Pirnay JP, Struelens M, Vandenvelde C, Duinslaeger L, et al. Direct detection and identification of Pseudomonas aeruginosa in clinical samples such as skin biopsy specimens and expectorations by multiplex PCR based on two outer membrane lipoprotein genes, oprI and oprL. J Clin Microbiol. 1997 Jun;35(6):1295-9. doi: 10.1128/jcm.35.6.1295-1299.1997.
• ²³
  Brakstad OG, Aasbakk K, Maeland JA. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J Clin Microbiol. 1992 Jul;30(7):1654-60. doi: 10.1128/jcm.30.7.1654-1660.1992.
• ²⁴
  Dodd MJ, Facione NC, Dibble SL, MacPhail L. Comparison of methods to determine the prevalence and nature of oral mucositis. Cancer Pract. 1996 Dec;4(6):312-8.
• ²⁵
  Epstein JB, Schubert MM. Oropharyngeal mucositis in cancer therapy. Review of pathogenesis, diagnosis, and management. Oncology (Williston Park). 2003 Dec;17(12):1767-79; discussion 1779-1782, 1791-2.
• ²⁶
  Dayan GH, Mohamed N, Scully IL, Cooper D, Begier E, Eiden J, et al. Staphylococcus aureus: the current state of disease, pathophysiology and strategies for prevention. Expert Rev Vaccines. 2016 Nov;15(11):1373-92. doi: 10.1080/14760584.2016.1179583.
• ²⁷
  Wu DC, Chan WW, Metelitsa AI, Fiorillo L, Lin AN. Pseudomonas skin infection: clinical features, epidemiology, and management. Am J Clin Dermatol. 2011 Jun;12(3):157-69. doi: 10.2165/11539770-000000000-00000.
• ²⁸
  Kang C-I, Song J-H, Chung DR, Peck KR, Yeom J-S, Son JS, et al. Bloodstream infections in adult patients with cancer: clinical features and pathogenic significance of Staphylococcus aureus bacteremia. Support Care Cancer. 2012 Oct;20(10):2371-8. doi: 10.1007/s00520-011-1353-z.
• ²⁹
  Zhao Y, Lin Q, Liu L, Ma R, Chen J, Shen Y, et al. Risk Factors and Outcomes of Antibiotic-resistant Pseudomonas aeruginosa Bloodstream Infection in Adult Patients With Acute Leukemia. Clin Infect Dis. 2020 Dec 23;71(Suppl 4):S386-93. doi: 10.1093/cid/ciaa1522.
• ³⁰
  Mathews J, Patel M. Bacterial endotoxins and microorganisms in the oral cavities of patients on cancer therapy. Microb Pathog. 2018 Oct;123:190-5. doi: 10.1016/j.micpath.2018.07.014.
• ³¹
  Sunde PT, Olsen I, Debelian GJ, Tronstad L. Microbiota of periapical lesions refractory to endodontic therapy. J Endod. 2002 Apr;28(4):304-10. doi: 10.1097/00004770-200204000-00011.
• ³²
  Gibson J, Wray D, Bagg J. Oral staphylococcal mucositis: A new clinical entity in orofacial granulomatosis and Crohn’s disease. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2000 Feb;89(2):171-6. doi: 10.1067/moe.2000.101810.
• ³³
  González-Barca E, Carratalà J, Mykietiuk A, Fernández-Sevilla A, Gudiol F. Predisposing factors and outcome of Staphylococcus aureus bacteremia in neutropenic patients with cancer. Eur J Clin Microbiol Infect Dis. 2001 Feb;20(2):117-9. doi: 10.1007/pl00011241.
• ³⁴
  Ye Y, Carlsson G, Agholme MB, Wilson J a. L, Roos A, Henriques-Normark B, et al. Oral bacterial community dynamics in paediatric patients with malignancies in relation to chemotherapy-related oral mucositis: a prospective study. Clin Microbiol Infect. 2013 Dec;19(12):E559-67. doi: 10.1111/1469-0691.12287.
• ³⁵
  Nishii M, Soutome S, Kawakita A, Yutori H, Iwata E, Akashi M, et al. Factors associated with severe oral mucositis and candidiasis in patients undergoing radiotherapy for oral and oropharyngeal carcinomas: a retrospective multicenter study of 326 patients. Support Care Cancer. 2020 Mar;28(3):1069-75. doi: 10.1007/s00520-019-04885-z.

Edited by

Editor: Dr. Altair A. Del Bel Cury

Publication Dates

• Publication in this collection
  08 May 2023
• Date of issue
  2023

History

• Received
  28 Nov 2021
• Accepted
  10 June 2022