Expressão diferencial dos genes VuUCP1a e VuUCP1b em caupi sob estresse salino

Differential expression of VuUCP1a and VuUCP1b in caupi under salt stress

FITOTECNIA

Expressão diferencial dos genes VuUCP1a e VuUCP1b em caupi sob estresse salino

Differential expression of VuUCP1a and VuUCP1b in caupi under salt stress

Francisco Edson Alves Garantizado^I,*; José Hélio Costa^I; Ivan de Godoy Maia^II; Dirce Fernandes de Melo^I

^IPrograma de Pós-Graduação em Bioquímica, Departamento de Bioquímica e Biologia Molecular, Centro de Ciências/UFC, Av. Eng. Humberto Monte, Bloco 907, Campus do Pici, Fortaleza-CE, Brasil, 60.451-970, [e-mail], [e-mail], [e-mail]

^IIPrograma de Pós-Graduação em Genética, Departamento de Genética, Instituto de Biociências, Universidade Estadual Paulista-Unesp, São Paulo-SP, Brasil, [e-mail]

RESUMO

O estresse salino afeta o crescimento e o desenvolvimento das plantas, induzindo respostas bioquímicas e fisiológicas como mecanismo de adaptação para sua sobrevivência. As proteínas desacopladoras de planta (pUCPs) dissipam o gradiente eletroquímico mitocondrial de prótons como calor e são codificadas por famílias multigênicas. Elas atuam como sistema de defesa evitando a formação de espécies reativas de oxigênio geradas em resposta a estresses ambientais. O objetivo do trabalho foi estudar a expressão de genes das pUCPs (VuUCP1a e VuUCP1b ) em raízes e folhas de plântulas de Vigna unguiculata submetidas ao estresse salino (NaCl 100 mM). Sementes foram germinadas no escuro e após 3 dias, as plântulas foram transferidas para solução de Hoagland, permanecendo 3 dias antes da aplicação do estresse. As raízes e folhas foram coletadas com 0; 6; 12 e 24 horas, após adição de NaCl, para avaliar o perfil de expressão dos genes da pUCP por RT- PCR. A análise de transcritos mostrou que VuUCP1a é expresso em raízes e folhas revelando um perfil constitutivo enquanto que VuUCP1b é dependente do tecido, isto é, expresso nas folhas, sem alteração em resposta ao estresse e induzido pelo estresse salino nas raízes. A peculiaridade da duplicação gênica de pUCP1 em caupi com perfil diferencial de expressão, sugere tanto um papel dessa enzima nos mecanismos de ajustamento ao estresse salino quanto promove essa espécie como um modelo atrativo para compreensão do papel da família multigênica da pUCP em plantas.

Palavras-chaves: Estresse salino. pUCP. Vigna unguiculata.

ABSTRACT

Salt stress affects growth and development of plants, inducing a variety of physiological and biochemical responses as an adaptation mechanism for survival. The plant uncoupling mitochondrial proteins (pUCPs) are able to dissipate the proton electrochemical gradient as heat and are encoded by a multigene family. They works as defence systems avoiding the formation of reactive oxygen species promoted by environmental stress. The aim of this work was to study gene expression of pUCPs (VuUCP1a and VuUCP1b) in roots and leaves from Vigna unguiculata seedlings under salt stress (100 mM NaCl). Seeds were germinated in the dark and after 3 days, the seedlings were transferred to Hoagland's medium and grown for 3 additional days before being submitted to the stress condition. Roots and leaves were harvested at 0; 6; 12 and 24 hours after addition of NaCl for total RNA isolation and RT-PCR assays. Expression analysis by RT-PCR showed that VuUCP1a is constitutive in leaves and roots while VuUCP1b is expressed as tissue-dependent presenting a constitutive profile in leaves and a differential one in roots from seedlings under salt stress. The uniqueness of pUCP1 gene duplication in cowpea with differential expression suggest a role of this enzyme in the adjustment of salt stress as well as promotes this species as an attractive model to understand the role of pUCP gene members in plants.

Key word: Salt stress. pUCP. Vigna unguiculata.

Introduction

Salinity is a major abiotic stress limiting the productivity of many plant species and consequently affects plant survival, biomass, plant height and the capacity of plants to collect water and nutrients (MANIVANNAN et al., 2008; ZUSHI et al, 2009). These damages are especially revealed pronounced in arid and semi-arid regions as Brazilian Northeast, where cowpea (Vigna unguiculata) is a widely cultivated species (CAVALCANTI et al., 2007). In fact, the salinity imposes two stresses on plant tissue: a water-deficit that results from the relatively high solute concentrations in the soil, and ion toxicity due altered K/Na rations and Na⁺ and Cl^- concentrations that are harmful to plants (ALVES et al., 2008; CHEN et al., 2008). Salt stress affects almost every aspect of the physiology and biochemistry of plants, promoting ionic, osmotic, nutritional and hormonal imbalances, leading to a decrease in metabolic efficiency and even to injurious secondary effects such as oxidative stress promoted by reactive oxygen species (ROS) (MUNNS; TESTER, 2008; PANG; WANG, 2008; PARIDA; DAS, 2005). ROS are produced predominantly in chloroplasts, mitochondria, and peroxisomes causing oxidative damage to membrane lipids, proteins, and nucleic acids (ASHRAF, 2009; BANU et al., 2009; JEZEK; HLAVATÁ, 2005) and can induce responses such as new gene expression (GILL; TUTEJA, 2010). However, in response to the salinity deleterious effects, plants can suffer metabolic changes as a mechanism of adjustment to adverse conditions, ensuring its survival (MUNNS, 2002; SILVA et al., 2009). Under steady state conditions, the ROS molecules are scavenged by various antioxidative defense mechanisms (FOYER; NOCTOR, 2005).

Plant mitochondria shows besides the enzymes involved in a classical electron transport chain, coupled to oxidative phosphorylation, another non-phosphorilating electron transport pathway mediated by alternative oxidase (AOX). Indeed, plant mitochondria possess another uncoupling enzyme named plant uncoupling protein (pUCP) (BORECKÝ et al., 2006). The pUCPs are integral membrane proteins that are present in the inner mitochondrial membrane and are able to dissipate the proton electrochemical gradient as heat (ITO-INABA et al., 2009; VERCESI et al., 2006). AOX and pUCP function are not fully understood, but it seems involved in protecting oxidative damage by ROS (BLOKHINA; FAGERSTEDT, 2010). Both of them can be considered as a tool for ROS level regulation/elimination (GRABEL'NYKH et al., 2009; PASTORE et al., 2007).

It is well known that AOX expression is regulated by salt stress (COSTA et al., 2007; JACOBY et al., 2010; SMITH et al., 2009), but little is known for pUCP expression (DLASKOVÁ et al., 2006; PASTORE et al., 2007; TRONO et al., 2006). Up to date, apparently, there is no study with cowpea pUCPs in response to salt stress. These proteins are encoded by a multigene family and are related to plant adjustment mechanisms under environmental stresses (BORECKÝ et al., 2006; CHEONG et al., 2002; NANTES et al., 1999; NOGUEIRA et al., 2003; SEKI et al., 2002; SWIDZINSKI et al., 2002). Two pUCP genes were identified in cowpea: VuUCP1a and VuUCP1b (GARANTIZADO, 2007). Therefore, the aim of this work was to study roots and leaves pUCPs expression from cowpea seedlings submitted to salt stress.

Materials and methods

Plant material and stress conditions

Vita 5 cowpea seeds (V. unguiculata (L.) Walp) were obtained from the seed bank of the Departamento de Fitotecnia, Universidade Federal do Ceará, Fortaleza, Ceará, Brasil. Seeds were surface sterilised for 5 min in 0.5% (w/v) CaOCl, rinsed with water, and germinated in the dark, at 25 ºC, on filter paper soaked with distilled water. After 3 days, the seedlings were transferred to hydroponics systems, containing Hoagland solution (HOAGLAND; ARNON, 1950) in a greenhouse, staying three days before the application of salt stress. After six days of germination, seedlings were separated into two groups: control and salt stress. The salt stress group was induced by adding to 100 mM NaCl in the nutrient solution and the control group submitted only Hoagland solution. Leaves and roots were harvested at 0; 6; 12 and 24 hours after addition of 100 mM NaCl, immediately frozen in liquid nitrogen and stored at -80 ºC before extraction of total RNA.

Extraction of total RNA and semi-quantitative RT-PCR

Two hundred milligrams of roots were powdered with liquid nitrogen in a mortar with a pestle. Total RNA was then extracted using the RNeasy Plant Mini Kit according to the manufacturer protocol (Qiagen, Hilden, Germany). Total RNA (1.5 mg) from each sample was heated to 75 ºC in a water bath for 10 min, cooled 2 min on ice and used for reverse transcription. Semi-quantitative RT-PCR was performed using the Ready To Go RT-PCR beads kit (Pharmacia) with specific primers for each pUCP gene and it was concomitantly controlled by amplification of V. unguiculata actin cDNA. Specific actin primers were obtained according COSTA et al. (2004). The VuUCP1a and VuUCP1b primers were obtained from both gene sequences retrieved from genespace sequence (GSS) database of Cowpea Genomics Initiative (CHEN et al., 2007). The PCR parameters for a semi-quantitative estimation were according COSTA et al., 2010).

PCR assays were carried out to establish the optimal annealing temperature of primers at 55 ºC for actin, VuUCP1a and VuUCP1b. Preliminary experiments with various PCR cycle numbers indicated that in the RT-PCR conditions of this study, amplifications were not in the plateau phase, and therefore allowed for semi-quantitative estimations of transcript levels. The cycle number used for each gene was 27 for Actin, VuUCP1a and VuUCP1b.

The primer sequences were: VuUCP1a sense: 5′ GTGTGTACTATTCCGTTG 3′ and antisense: 5′ TGCTATATTGGGGCCAAG 3′; VuUCP1b sense: 5′ GTGTGTACTATTCCTCTC 3′ and antisense: 5′ GTTATGTTGGGTCCAATC 3′; Actin sense: 5′ GCGTGATCTCACTGATGCC 3′ and antisense: 5′ TCGCAATCCACATCTGTTGG 3′. The RT-PCR products were analyzed by electrophoresis in a 1.5% (w/v) agarose gel, stained with ethidium bromide and photographed with a gel imaging system (itf labortechnik-Germany).

Results and discussion

Salinity, as several others biotic and abiotic stresses, alters the equilibrium between the production and the scavenging of ROS (GILL; TUTEJA, 2010; MUNNS; TESTER, 2008; PANG; WANG, 2008; PARIDA; DAS, 2005). ROS are produced continuously in different cellular compartments such as chloroplast, mitochondria and peroxisomes and their imbalance cause oxidative damage to membrane lipids, proteins, and nucleic acids (ASHRAF, 2009; BANU et al., 2009; JEZEK; HLAVATÁ, 2005). Plant mitochondria possess two uncoupling systems mediated by alternative oxidase (AOX) and plant uncoupling protein (pUCP) that have been linked to systems involved in the prevention of the ROS formation (BLOKHINA; FAGERSTEDT, 2010; GRABEL'NYKH et al., 2009; PASTORE et al., 2007).

Since the UCP was found for the first time in plants (VERCESI et al., 1995), several groups have asked why plant mitochondria have another energy-dissipating system in addition to alternative pathway mediated by alternative oxidase (AOX). Similar to AOX the pUCP is encoded by a multigene family, however, in spite of the great progress in the plant genome sequencing in the recent years only pUCP gene families of two plants have been well characterized, sugarcane and Arabidopsis thaliana (BORECKÝ et al., 2006) with five (SsUCP1-5) and six (AtUCP1-6) gene members, respectively. The physiological role of pUCP gene members in plants have been focused on their gene regulation (BORECKÝ et al., 2006; VERCESI et al., 2006). Concerning salt stress response AtPUMP1 (AtUCP1) in Arabidopsis is induced by salinity (VERCESI et al., 2006).

Two pUCP genes were previously identified in cowpea (VuUCP1a and VuUCP1b) presenting at least 83% of identity between deduced amino acid sequences. These genes are orthologous to GmUCP1a and GmUCP1b from soybean, a leguminous as it is the case of cowpea (GARANTIZADO, 2007). Considering the apparent importance of Arabidopsis pUCP1 in response to salinity became curious to study the expression of these duplicated UCP1 in cowpea.

Plant uncoupling proteins (pUCPs) gene expression in roots (FIG. 1) and leaves (FIG. 2) from cowpea seedlings submitted to saline stress (100 mM NaCl) were carried out at 0; 6; 12 and 24 h after stress submission. Figure 1 shows the VuUCP1a and VuUCP1b expression profile in roots from cowpea seedlings in control and stress conditions. In addition, Actin cDNA was used as constitutive gene to control the semi-quantitative measure. It can be seen that VuUCP1a revealed the same profile expression in both conditions as a constitutive gene. On the other hand, VuUCP1b was differentially expressed revealing an increase in the transcript level mainly observed at 12 and 24 h.

In order to investigate if the differential expression of both genes is tissue-dependent an expression analysis was performed in leaves collected simultaneously with roots. As observed in Figure 2, there was no change in VuUCP1a and VuUCP1b expression profile in leaves.

There are few studies of gene expression in response to salt stress and there are controversial results. Transcript levels of two distinct pUCP-related genes in durum wheat seedlings grown under control and salt stress conditions were not enhanced (TRONO et al., 2006). In fact, it has been characterized two pUCP1 genes in wheat i.e., WhUCP1a and WhUCP1b but there is no date related to stress condition (VERCESI et al., 2006). Contrarily, an increase in mRNA for ZmpUCP1 was found in maize shoots and roots after 24h treatment with 250 mM NaCl (DLASKOVÁ et al., 2006). In the case of Arabidopsis, a dicot model, it was revealed a down-regulated expression pattern promoted by high-salinity stress for AtUCP4 and AtUCP5 (SEKI et al., 2002). However, other abiotic stresses as low and high temperatures (NANTES et al., 1999; NOGUEIRA et al., 2003; SWIDZINSKI et al., 2002) drought, wound (CHEONG et al., 2002) induced up-regulation in AtUCP genes. These results are puzzling but it could be suggested a differential regulation at cell or tissue/organ level among different species. Our data contributed to put in evidence cowpea as an interesting model since it presented gene duplication of UCP1 (VuUCP1a and VuUCP1b) showing a tissue and gene-dependent expression under salt stress. These results are promisors concerning biotechnological application since this knowledge could be useful to produce plants more tolerant to salt and oxidative stresses promoting enhancement of productivity of many plant species.

Conclusion

The results suggest a tissue and gene-dependent pUCP1 (VuUCP1a and VuUCP1b) expression under salt stress in cowpea, with a constitutive expression of VuUCP1a in roots and leaves and induction of VuUCP1b in roots.

Acknowledgements

This research was supported by CAPES, CNPq, FUNCAP and NTCSal.

Recebido para publicação em 31/08/2010; aprovado em 31/01/2011

• ALVES, F. A. L. et al Clones de cajueiro-anão precoce expostos ao estresse salino e ao acúmulo de potássio e sódio. Revista Ciência Agronômica, v. 39, n. 03, p. 422-428, 2008.
• ASHRAF, M. Biotechnological approach of improving plant salt tolerance using antioxidants as markers. Biotechnology Advances, v. 27, n. 01 p. 84-93, 2009.
• BANU, M. N. A. et al Proline and glycinebetaine induce antioxidant N defense gene expression and suppress cell death in cultured tobacco cells under salt stress. Journal of Plant Physiology, v. 166, n. 02 p. 146-156, 2009.
• BLOKHINA, O.; FAGERSTEDT, K. V. Reactive oxygen species and nitric oxide in plant mitochondria: origin and redundant regulatory systems. Physiologia Plantarum, v. 138, n. 04, p. 447-462, 2010.
• BORECKÝ, J. et al The plant energy-dissipating mitochondrial systems: depicting the genomic structure and the expression profiles of the genes families of uncoupling protein and alternative oxidase in monocots and dicots. Journal of Experimental Botany, v. 57, n. 04, p. 849-64. 2006.
• CAVALCANTI, F. R. et al. Roots and leaves display contrasting oxidative response during salt stress and recovery in cowpea. Journal of Plant Physiology, v. 164, n. 05 p. 591-600, 2007.
• CHEN, X. et al, CGKB: an annotation knowledge base for cowpea (Vigna unguiculata L.) methylation filtered genomic genespace sequences. BMC Bioinformatics, v. 8, p. 129, 2007.
• CHEN, L. H. et al Salt tolerance conferred by overexpression of Arabidopsis vacuolar Na (⁺) H (⁺) antiporter gene AtNHX1 in common buckwheat (Fagopyrum esculentum). Transgenic Research, v. 17, n. 01, p. 121-132, 2008.
• CHEONG, Y. H. et alTranscriptional profiling reveals novel interactions between wounding, pathogen, abiotic stress, and hormonal responses in Arabidopsis Plant Physioogy, v. 129, n. 02, p. 661-677, 2002.
• COSTA J. H. et al Identification in Vigna unguiculata (L.) Walp. of two cDNAs encoding mitochondrial alternative oxidase orthologous to soybean alternative oxidase genes 2a and 2b. Plant Science, v. 167, n. 02, p. 233-239, 2004.
• COSTA, J. H. et al Alternative oxidase regulation in roots of Vigna unguiculata cultivars differing in drought/salt tolerance. Journal of Plant Physiology, v. 164, n. 02, p. 718-727, 2007.
• COSTA J. H. et al. Stress-induced co-expression of two alternative oxidase (VuAox1 and 2b) genes in Vigna unguiculata. Journal of Plant Physiology, v. 167, n. 07, p. 561-570, 2010.
• DLASKOVÁ, A. et al. Certain aspects of uncoupling due to mitochondrial uncoupling protein in vitro and in vivo. Biochimica Et Biophysica Acta, v. 1757, n. 05, p. 467-473, 2006.
• FOYER, C. H.; NOCTOR, G. Redox homeostis and antioxidant signaling: a metabolic interface between stress perception and physiological responses, Plant Cell, v. 17, n. 07, p. 1866 - 1875, 2005.
• GARANTIZADO, F. E. A. Estudo bioquimico e molecular de proteinas desacopladas mitocondriais em plântulas de Vigna unguiculata submetidas ao estresse salino. 2007. 98 f. Dissertação (Mestrado em Bioquímica) - Universidade Federal do Ceará, Fortaleza.
• GILL, S. S.; TUTEJA, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiology and Biochemistry, v. 48, n. 12, p. 909-930, 2010.
• GRABEL'NYKH, O. et al The role of free fatty acids in mitochondrial energetic metabolism in winter wheat seedlings. Russ Journal Plant Physiology, v. 56, n. 03, p. 332342, 2009.
• HOAGLAND, D. R.; ARNON, D. I. The water culture method for growing plants without soil Berkeley: University of California/The College of Agriculture. 1950. 32 p. (Circular 347).
• ITO-INABA,Y. et al. Characterization of the plant uncoupling protein, SrUCPA, expressed in spadix mitochondria of the thermogenic skunk cabbage. Journal of Experimental Botany, v. 59, n. 04 p. 995-1005, 2009.
• JACOBY, R. et al Wheat mitochondrial proteomes provide new links between antioxidant defense and plant salinity tolerance. Journal of Proteome Research, v. 9, n. 12, p. 6595-6604, 2010.
• JEZEK, P.; HLAVATÁ, L., Mitochondria in homeostasis of reactive oxygen species in cell, tissues, and organism, The International Journal of Biochemistry & Cell Biology, v. 37, n.12, p. 2478-2503, 2005.
• MANIVANNAN, P. et al Protection of Vigna unguiculata (L.) Walp. plants from salt stress by paclobutrazol. Colloids and Surfaces B: Biointerfaces, v. 61, n. 02 p. 315-318, 2008.
• MUNNS, R. Comparative Physiology of Salt and Water Stress. Plant, Cell and Environment, v. 25, n. 02, p. 239 - 250, 2002.
• MUNNS, R.; TESTER, M. Mechanisms of salinity tolerance. Annual Review of Plant Biology, v.59, p. 651-681, 2008.
• NANTES, I. L. et al Low temperature and aging-promoted expression of PUMP in potato tuber mitochondria FEBS Letters, v. 457, n. 01, p. 103-106, 1999.
• NOGUEIRA, F. T. et al RNA expression profiles and data mining of sugarcane response to low temperature. Plant Physiology, v. 132, n. 04, p. 18111824, 2003.
• PANG, C. H.; WANG, B. S. Oxidative Stress and Salt Tolerance in Plants. Progress in Botany, v. 69, n. 03, p. 231-245, 2008.
• PARIDA, A. K.; DAS, A.B. Salt tolerance and salinity effects on plants: a review, Ecotoxicology and Environmental Safety, v. 60, n. 03 p. 324-349, 2005.
• PASTORE, D. et al Possible plant mitochondria involvement in cell adaptation to drought stress. A case study: durum wheat mitochondria. Journal of Experimental Botany, v.58, n. 02 p.195-210, 2007.
• SEKI, M. et al Monitoring the expression profiles of 7000 Arabidopsis genes under drought, cold and high-salinity stresses using a full-length cDNA microarray. The Plant Journal, v. 31, n. 03, p. 279-292, 2002.
• SILVA, E. N. da et al. Acúmulo de íons e crescimento de pinhão-manso sob diferentes níveis de salinidade. Revista Ciência Agronômica, v. 40, n. 02, p. 240-246, 2009.
• SMITH, C. A. et al Manipulation of alternative oxidase can influence salt tolerance in Arabidopsis thaliana. Physiologia Plantarum, v. 137, n. 04, p. 459- 472, 2009.
• SWIDZINSKI, J. A.; SWEETLOVE, L. J.; LEAVER, C. J. A custom microarray analysis of gene expression during programmed cell death in Arabidopsis thaliana Plant Journal, v.30, n. 04 p. 431-46, 2002.
• TRONO, D. et al The transcript levels of two plant mitochondrial uncoupling protein (pUCP)-related genes are not affected by hyperosmotic stress in durum wheat seedlings showing an increased level of pUCP activity , Bioncience Report, v. 26, n. 03, p. 351-361, 2006.
• VERCESI, A. E. et al. PUMPing Plants. Nature, v. 375, n. 626, p. 24-25, 1995.
• VERCESI, A. E. et al. Plant Uncoupling Mitochondrial Protein. Annual Review of Plant Physiology, v. 57, p. 383-404, 2006.
• ZUSHI, K. et al Developmental and tissue-specific changes in oxidative parameters and antioxidant systems in tomato fruits grown under salt stress. Scientia Horticulturae, v. 122, n. 01 p. 362-368, 2009.

*

Autor para correspondência

Trabalho submetido e selecionado no primeiro Simpósio Brasileiro de Salinidade realizado de 12-15/10/2010 em Fortaleza, Ceará, Brasil; Projeto financiado pelo CNPq; parte da Tese de Doutorado apresentada pelo primeiro autor ao Programa de Pós-Graduação em Bioquímica e Biologia Molecular/UFC

Datas de Publicação

• Publicação nesta coleção
  20 Maio 2011
• Data do Fascículo
  Jun 2011

Histórico

• Aceito
  31 Jan 2011
• Recebido
  31 Ago 2010