A serological and molecular survey of Babesia vogeli, Ehrlichia canis and Rickettsia spp. among dogs in the state of Maranhão, northeastern Brazil

Detecção sorológica e molecular de Babesia vogeli, Ehrlichia canis e Rickettsia spp. em cães do Estado do Maranhão, Nordeste do Brasil

Abstracts

This study evaluated exposure and infection by tick-borne agents (Babesia vogeli, Ehrlichia canis and Rickettsia spp.) in 172 dogs in rural areas and 150 dogs in urban areas of the municipality of Chapadinha, state of Maranhão, northeastern Brazil, using molecular and serological methods. Overall, 16.1% of the sampled dogs (52/322) were seroreactive to B. vogeli, with endpoint titers ranging from 40 to 640. For E. canis, 14.6% of the dogs (47/322) were seroreactive, with endpoint titers from 80 to 163,840. Antibodies reactive to at least one of the five species of Rickettsia were detected in 18.9% of the dogs (61/322), with endpoint titers ranging from 64 to 4,096. High endpoint titers were observed for Rickettsia amblyommii. Three (0.9%) and nine (2.8%) canine blood samples were PCR-positive for Babesia spp. and E. canis. The ticks collected from urban dogs were all Rhipicephalus sanguineus sensu lato, whereas the rural dogs were infested by R. sanguineus s.l, Amblyomma cajennense sensu lato and Amblyomma ovale. One A. ovale tick was found to be infected by Rickettsia bellii. This study provides an epidemiological background for controlling and preventing canine tick-borne diseases in a neglected region of Brazil.

Ticks; tick-borne pathogens; hemoparasites

Este estudo avaliou por métodos sorológicos e moleculares a exposição e infecção por agentes transmitidos por carrapatos (Babesia vogeli, Ehrlichia canis, and Rickettsia spp.) em 172 cães de áreas rurais e 150 cães de áreas urbanas do município de Chapadinha, Estado do Maranhão, Nordeste do Brasil. No geral, 16,1% dos cães amostrados (52/322) apresentaram soros reagentes para B. vogeli, com títulos finais variando de 40 a 640. Para E. canis, 14,6% cães (47/322) apresentaram soros reagentes com títulos finais de 80 a 163,840. Anticorpos reativos para pelo menos uma das cinco espécies de Rickettsia foram detectados em 18,9% dos cães (61/322), com os títulos que variam de 64 a 4096. Foram observados altos títulos para Rickettsia amblyommii. Três amostras de sangue canino (0,9%) e 9 (2,8%) foram PCR positivas para Babesia spp e E. canis. Os carrapatos coletados de cães urbanos eram todos Rhipicephalus sanguineus sensulato, e os cães rurais estavam infestados por R. sanguineus s.l , Amblyomma cajennense sensu lato e Amblyomma ovale. Um carrapato A. ovale foi encontrado infectado por Rickettsia bellii. Este estudo fornece um conhecimento epidemiológico para o controle e prevenção de doenças transmitidas por carrapatos de cães em uma região negligenciada do Brasil.

Carrapatos; agentes transmitidos por carrapatos; hemoparasitas

Introduction

The emergence and reemergence of arthropod-borne diseases have been a challenge for veterinary and human medicine. Arthropods and the infections transmitted by them are expanding their zoogeographic boundaries due to climate changes and increased accessibility to certain environmental niches (SHAW et al., 2001). Vector-borne pathogens such as Babesia vogeli, Ehrlichia canis and spotted fever group Rickettsia cause diseases in dogs in many parts of the world. Dogs infected with these organisms may develop either subclinical infection or clinical signs of pyrexia, lethargy, pallor, hemorrhagic diatheses, icterus and vasculitis. Infection may be fatal in some dogs (HII et al., 2012).

Babesia vogeli, which is transmitted by the tick Rhipicephalus sanguineus sensu lato, has been detected in dogs in tropical or subtropical areas of northern, eastern and southern Africa (UILENBERG et al., 1989; LEWIS et al., 1996; OYAMADA et al., 2005), Europe (CRIADO-FORNELIO et al., 2003), Asia (INOKUMA et al., 2006), Australia (HII et al., 2012) and North and South America (BIRKENHEUER et al., 2003; PASSOS et al., 2005). It is considered to be a mildly virulent species, commonly inducing moderate clinical signs in dogs (BECK et al., 2009). Canine infection by B. vogeli seems to be widespread in Brazil (COSTA-JÚNIOR et al., 2009; O'DWYER et al., 2009; RAMOS et al., 2010), in accordance with the wide distribution of its vector, R. sanguineus s.l., especially in urban and peripheral urban areas (LABRUNA & PEREIRA, 2001).

Ehrlichia canis is a Gram-negative, pleomorphic, obligate intracellular coccus that infects canine monocytes and is also transmitted by R. sanguineus (IRWIN, 2001). E. canis is more prevalent in tropical and subtropical areas in India, Asia, Central and South America and Africa (SINGLA et al., 2011; BABA et al., 2012; RODRIGUEZ-VIVAS et al., 2005; AGUIAR et al., 2007a; MATJILA et al., 2008). In South America, it has been reported in Brazil (VIEIRA et al., 2011), Venezuela (UNVER et al., 2001), Chile (LÓPEZ et al., 2012) and Peru (VINASCO et al., 2007). In Brazil, canine infection by E. canis is widespread, also in accordance with its primary vector, R. sanguineus s.l. (VIEIRA et al., 2011).

The genus Rickettsia comprises a number of distinct serotypes that have been classified into separate species. Some of them are pathogenic and others are apparently nonpathogenic for humans (YU & WALKER, 2003). They are typically transmitted by arthropod vectors, which include ticks, mites, fleas or lice (BURGDORFER, 1988). The most pathogenic species, Rickettsia rickettsii, is the agent of Brazilian spotted fever in southeastern Brazil, where it is transmitted by Amblyomma ticks (LABRUNA, 2009). The other tick-associated Rickettsia species reported in Brazil are Rickettsia parkeri, Rickettsia amblyommii, Rickettsia rhipicephali, Rickettsia monteiroi and Rickettsia bellii. Among these, only R. parkeri has unquestionably been associated with human illness (LABRUNA et al. 2011). While several recent studies have revealed circulation of different Rickettsia species in some areas of Brazil, no study has been conducted in the state of Maranhão.

Taking into account that dogs are frequently infested by ticks, are companion animals and, depending on their lifestyle, may have access to different environments, they are able to exchange ectoparasites with other animals species and introduce pathogens into certain places, many of which causes zoonoses (SZABÓ et al., 2010). In this context, the present study (cross-sectional) evaluated exposure and infection by B. vogeli, E. canis and Rickettsia spp. in dogs in rural and urban areas in the state of Maranhão, northeastern Brazil, where information on tick-borne diseases is very scarce.

Materials and Methods

Ethics committee. The present study was approved by the Bioethics Committee for Animal Experimentation of the State University of Maranhão, Brazil.

Study area. During March 2010, domestic dogs were sampled in rural and urban areas of three municipalities, Anapurus (03°40'S and 43°06'W), Chapadinha (03°44' S and 43°21'W) and Mata-Roma (03°37'S and 43°06'W), within the Chapadinha region, state of Maranhão, northeastern Brazil. The Chapadinha region is characterized by a humid tropical climate, in which the rainy season predominates from December to May, while the dry season extends from July to November. The annual average temperature is higher than 27°C, with a maximum of 37°C and minimum of 21°C; the mean annual rainfall ranges from 1,200 to 1,400 mm. The area is within the Cerrado biome, with a flora composed of two diverse types of vegetation: deciduous and seasonal forests (SELBACH & LEITE, 2008).

Sampling procedure. Blood samples were collected from 150 dogs living in urban areas, and from 172 dogs living in rural areas of the Chapadinha region. Of these, 123 (50 urban and 73 rural) were in the municipality of Chapadinha, 100 (50 urban and 50 rural) in Anapurus, and 99 (50 urban and 49 rural) in Mata Roma. Owned and apparently healthy dogs were sampled by convenience directly from their residences, according to accessibility of the place. All the blood samples were collected from the cephalic or jugular vein. The whole blood and blood serum from each dog were stored separately in microtubes at –20°C until the laboratory analyses were performed. At the time of the blood collection, all the dogs had a healthy appearance. A questionnaire focusing on potential risk factors for tick-borne diseases [age, gender, living place (urban or rural) and hunting practices] was given to each dog owner. At the time of blood collection, the dogs were examined for presence of ticks. Any ticks present were collected and taken to the laboratory for taxonomic identification. The results regarding the ticks that were infesting the dogs of the present study have been reported elsewhere (COSTA et al., 2013).

Serological analyses. Canine serum samples were tested individually by means of the indirect immunofluorescence assay (IFA), using B. vogeli-infected canine erythrocytes as the antigen. The Jaboticabal strain of B. vogeli was used for this in accordance with the method described by IICA (1987). Serum samples were also tested by means of IFA using E. canis-infected DH82 cells as the antigen. The São Paulo strain of E. canis was used for this, as previously described (AGUIAR et al., 2007b, 2008). Reactions were performed using fluorescein-conjugated anti-dog IgG (Sigma-Aldrich, St. Louis, MO, USA). Serum was considered to contain antibodies reactive to each agent if it displayed a reaction at the dilution 1:40. Samples that reacted at the screening dilution (1:40) were then titrated using serial two-fold dilutions to determine endpoint titers.

Antibodies reactive to Rickettsia spp. were assayed by simultaneously using five Rickettsia isolates from Brazil: R. bellii strain Mogi, R. amblyommii strain Ac37, R. rhipicephali strain HJ5, R. rickettsii strain Taiaçu and R. parkeri strain At24, as previously described (LABRUNA et al., 2007). Samples that reacted at the screening dilution (1:64) were then titrated using serial two-fold dilutions to determine endpoint titers. Serum showing a Rickettsia species titer at least four times higher than those observed for the other Rickettsia species was considered to be homologous to the first Rickettsia species or to a very closely related genotype (LABRUNA et al., 2007; PIRANDA et al., 2008).

For all reactions, a nonreactive canine serum specimen (negative control) and a known reactive canine serum specimen (positive control) were included on each slide. These sera were obtained from serum bank of the Laboratory of Parasitic Diseases in the Department of Preventive Veterinary Medicine and Animal Health (VPS) at the Faculty of Veterinary Medicine and Zootechny (FMVZ), University of São Paulo (USP).

Molecular analyses. DNA was extracted from 300 µL of whole blood from each dog using the Wizard^® genomic DNA purification kit (Promega corporation, Madison / USA), in accordance with the manufacturer's instructions. DNA samples were tested by means of the polymerase chain reaction (PCR) using the sets of primers described in Table 1. For Babesia spp., a single PCR was used (DUARTE et al., 2008); for Ehrlichia canis, a nested PCR was performed, with the second reaction specific for E. canis (DAWSON et al., 1996; MURPHY et al., 1998). Reactions were performed in a final volume of 25 μl, containing 10 mM of Tris–HCl (pH 8.3), 50 μM of KCl, 1.5 mM of MgCl₂, 0.2 mM of each deoxynucleoside triphosphate, 1.5 U of Taq DNA polymerase (Invitrogen), 11 pmol of each primer and approximately 100 ηg of canine genomic DNA. The thermocycling conditions for the reactions were 94°C for 3 min, followed by 30 cycles at 94°C for 1 min, with annealing at 56°C (Babesia spp.) or 60ºC (first nested reaction) or 55°C (second nested reaction) for 30 s, and extension at 72°C for 1 min; a final extension step at 72°C for 3 min was used. The amplified products were viewed under ultraviolet light after electrophoresis on agarose gel stained with SyBr gold (Invitrogen).

Table 1
Primer pairs used in the present study for detecting tick-borne agents.

Primer pairs	Target agents (gene)	Primers	Primer sequences (5'-3')	Product size (bp)	Reference
1	Babesia spp. (18S rRNA)	BAB1	GTGAACCTTATCACTTAAAGG	590	Duarte et al. (2008)
		BAB4	CAACTCCTCCACGCAATCG
2	Ehrlichia spp. (16S rRNA)	ECC	AGAACGAACGCTGGCGGCAAGC	478	Dawson et al. (1996)
		ECB	CGTATTACCGCGGCTGCTGGCA
3	Ehrlichia canis (16S rRNA)	ECAN5	CAATTATTTATAGCCTCTGGCTATAGGA	398	Murphy et al. (1998)
		HE3	TATAGGTACCGTCATTATCTTCCCTAT
4	Rickettsia spp. (gltA)	CS-78	GCAAGTATCGGTGAGGATGTAAT	401	Labruna et al. (2004a)
		CS-323	GCTTCCTTAAAATTCAATAAATCAGGAT

The ticks collected from the dogs were individually subjected to DNA extraction by means of the guanidine isothiocyanate-phenol technique (SANGIONI et al., 2005). They were then tested by means of PCR using the primers CS-78 and CS-323 (Table 1), targeting the citrate synthase gene (gltA) of Rickettsia spp. (LABRUNA et al., 2004a). The PCR products from the ticks were purified using ExoSap (USB) and were sequenced in an automatic sequencer (Applied Biosystems/Perkin Elmer, model ABI Prism 310 Genetic, California, USA), in accordance with the manufacturer's protocol. The partial sequences obtained were subjected to BLAST analyses (ALTSCHUL et al., 1990) to infer the closest similarities to samples in GenBank.

Statistical analysis. The minimum number of sampled dogs in each urban or rural area was statistically calculated considering each canine population, representing one fifth of the human population. Statistical associations of seropositivity to tick-borne pathogens with potential risk factors (independent variables) were tested by means of the chi-square or Fischer`s exact test, when it necessary. The odds ratio (OR) was calculated with 95% confidence limits. All analyses were performed using the Epi Info software, version 6.04d (CDC, Atlanta, GA, USA).

Results

A total of 322 dogs were sampled, comprising 148 males and 122 females; 86 dogs were < 1 year old, 187 dogs were 1-3 years old, and 49 dogs were > 3 years old. In order to increase the robustness of the statistical analyses, canine seroreactivity to B. vogeli, E. canis or Rickettsia spp. among the three municipalities (Anapurus, Chapadinha, and Mata Roma) were grouped, as presented below.

The serological results from the dogs according to whether they lived in urban and rural areas are shown in Table 2. Significantly, more dogs were seroreactive to B. vogeli in the urban areas than in the rural areas (P = 0.0119). The chances of dogs becoming seroreactive to B. vogeli in urban areas were about twice (OR: 2.27) their chances in rural areas. Regarding to E. canis, there was no significant association between urban and rural dogs (P = 0.4486). On the other hand, significantly more dogs were seroreactive to Rickettsia spp in rural areas, where the chances of dogs becoming seroreactive to Rickettsia spp were 18.09 times the chances shown by dogs living in urban areas.

Table 2
Results from indirect immunofluorescence assays (IFA) for Babesia vogeli, Ehrlichiacanis and Rickettsia spp. among dogs in urban and rural areas of the Chapadinha region, state of Maranhão, northeastern Brazil.

Antigen	Dogs		Statistical analysis*
	Locality	N reactive/N tested (%)	OR	CI	P value
B. vogeli	Urban	33/150 (22.0)	2.27	1.18-4.39	0.0119
	Rural	19/172 (11.0)
	Total	52/322 (16.1)
E. canis	Urban	19/150 (12.7)	0.75	0.38-1.46	0.4486
	Rural	28/172 (16.3)
	Total	47/322 (14.6)
Rickettsia spp.	Urban	4/150 (2.7)	18.09	6.07-60.50	<0.000001
	Rural	57/172 (33.1)
	Total	61/322 (18.9)

• ^*
  The proportions of seroreactive dogs for each antigen were compared between dogs in urban and rural areas by means of the chi-square test;
CI: confidence interval; OR: odds ratio; N: number.

Overall, 16.1% of the sampled dogs (52/322) were seroreactive to B. vogeli, with endpoint titers ranging from 40 to 640. For E. canis, 14.6% of the dogs (47/322) were seroreactive, with endpoint titers from 80 to 163,840. Antibodies reactive to at least one of the five Rickettsia species were detected in 18.9% of the dogs (61/322), with endpoint titers ranging from 64 to 4,096. All 61 dogs that were seroreactive to Rickettsia spp. presented reactions with R. amblyommii, for which at least 12 dogs presented endpoint titers that were four times higher than the endpoint titers showed for the other four Rickettsia species. These 12 dogs were considered to have been infected by R. amblyommii or a very closely related genotype (Table 3). Among the 61 dogs that were reactive to R. amblyommii, 54 were reactive to R. rhipicephali (highest endpoint titer: 2,048), 30 to R. parkeri (highest endpoint titer: 512), 28 to R. rickettsii (highest endpoint titer: 1,024) and 19 to R. bellii (highest endpoint titer: 512). Ten dogs (3.1%) were seropositive to both E. canis and Rickettsia sp., while seven dogs (2.2%) were seropositive to both E. canis and B. vogeli. No dog was seropositive for the three agents or for both B. vogeli and Rickettsia spp.

Table 3
Results from indirect immunofluorescence assays (IFA) for five Rickettsia species among dogs in rural areas of the Chapadinha region, state of Maranhão, northeastern Brazil.

Dog serum	Municipality	Endpoint titers for the following rickettsial antigens:					PAIHR*
		R. rickettsii	R. parkeri	R. amblyommii	R. rhipicephali	R. bellii
53	Chapadinha	-	-	128	-	-	R. amblyommii
54	Chapadinha	-	-	128	-	-	R. amblyommii
55	Chapadinha	-	-	4096	1024	-	R. amblyommii
56	Chapadinha	256	128	4096	1024	-	R. amblyommii
62	Chapadinha	-	-	512	64	-	R. amblyommii
79	Chapadinha	-	-	128	-	-	R. amblyommii
84	Chapadinha	-	-	4096	1024	-	R. amblyommii
87	Chapadinha	-	-	256	-	-	R. amblyommii
88	Chapadinha	-	-	128	-	-	R. amblyommii
202	Mata Roma	-	-	128	-	-	R. amblyommii
216	Mata Roma	64	128	512	128	64	R. amblyommii
225	Mata Roma	256	256	4096	1024	256	R. amblyommii

-: not reactive at a serum dilution of 1:64;
• ^*
  It was determined that the reaction was homologous when the endpoint titer for one Rickettsia species was at least four times higher than the titers observed for the other Rickettsia species. The Rickettsia species involved in the highest endpoint titer was considered to be the possible antigen involved in a homologous reaction (PAIHR).

The proportions of dogs that were seroreactive to B. vogeli and E. canis were statistically similar (P > 0.05) for dogs of both genders and for different age groups. For Rickettsia spp, dogs of different age groups had similar seroreactivity (P > 0.05); on the other hand, significantly more female dogs were seroreactive to Rickettsia spp. than were male dogs (P < 0.05). Hunting practice, reported for 26.4% of the dogs (85/322), was not statistically associated (P > 0.05) with seroreactivity to B. vogeli or E. canis; however, it was significantly associated (P = 0.00674) with seroreactivity to Rickettsia spp. The chances of hunting dogs becoming seroreactive to Rickettsia spp was 2.33 times greater than the chances of dogs with no hunting practice.

Among the 322 blood samples subjected to molecular analyses, three (0.9%) were positive in Babesia PCR, comprising two urban dogs in the municipality of Chapadinha and one rural dog in Anapurus. E. canis-specific nested PCR was positive in nine dogs (2.8%): four in urban areas and five in rural areas. Because of logistic problems during the study, DNA sequences of these PCR products neither were nor determined.

Parasitism by ticks was found in 59.9% of the dogs (193/322), among which 40.9% (79/193) were urban and 59.1% (114/193) were rural. A total of 929 specimens were collected and identified as Rhipicephalus sanguineus sensu lato (866 specimens), Amblyomma cajennense sensu lato (39) and Amblyomma ovale (24). Further details on tick infestations have been reported elsewhere (Costa et al. 2013). A total of 217 R. sanguineus s.l., 16 A. cajennense s.l., and 20 A. ovale specimens were processed by means of PCR. Only one A. ovale specimen was positive for the rickettsial gltA gene, which generated a DNA sequence 100% equal to R. bellii in GenBank (CP000087).

Discussion

This study showed that 16.1%, 14.6% and 18.9% of the dogs in the Chapadinha region were exposed to infection by B. vogeli, E. canis and Rickettsia spp., respectively, when analyzed by serologic tests. While these agents had been repeatedly reported infecting dogs in other parts of Brazil at a wide range of prevalence values (TRAPP et al., 2006; LABRUNA et al., 2007; MAIA et al., 2007; PINTER et al., 2008; SAITO et al., 2008; FURUTA et al., 2009; GUIMARÃES et al., 2009; SILVA et al., 2010a, b; VIEIRA et al., 2011), data for the state of Maranhão were very scarce or absent. Recently, B. vogeli was reported infecting dogs and R. sanguineus ticks in another region of Maranhão (SILVA et al., 2012). Conversely, but there had not been any previous reports of Ehrlichia spp or Rickettsia spp on dogs in this state. On the other hand, infection by Ehrlichia sp. on domestic cats was recently reported in in São Luís Island, Maranhão (Braga et al., 2012).

R. sanguineus ticks are the only known vector of B. vogeli and E. canis (Dantas-Torres, 2008). Costa et al. (2013) reported that infestations by R. sanguineus occurred at similar prevalence rates among urban and rural dogs in the present study. This explains the statistically similar prevalence rates for seroreactivity to E. canis among urban and rural dogs. On the other hand, the presence of anti-Babesia canis antibodies was likely to be more frequent in urban areas than in rural areas in the present study, even though up to 11% of the rural dogs were seroreactive. The relatively higher B. vogeli seroprevalence in urban dogs than in rural dogs could be correlated with possibly higher density of R. sanguineus ticks in urban areas, where these ticks would find more suitable areas for development of their nidicolous off-host stages (LABRUNA & PEREIRA, 2001; SZABÓ et al., 2001; PASSOS et al., 2005). This density might have less effect on E. canis infection because this agent tends to induce lifelong infection (MCCLURE et al., 2010).

Serological results for Rickettsia spp. were much higher among rural dogs than among urban dogs, with higher endpoint titers for R. amblyommii, which was considered to be the agent possibly infecting these dogs in rural areas. R. amblyommii has been reported infecting several Amblyomma species in Brazil, including A. cajennense s.l. (LABRUNA et al., 2004b, c; OGRZEWALSKA et al., 2008, 2011). The dogs in the present study were found to be infested by Amblyomma ticks only in rural areas (COSTA et al., 2013). Therefore, their serological status was possibly due to their infestation by Amblyomma ticks (mainly A. cajennense s.l.) in rural areas. Similarly, the statistical association of hunting practices with seroreactivity to Rickettsia spp. was possibly associated with higher exposure to Amblyomma ticks while hunting, since these ticks are primarily associated with wildlife in Brazil (LABRUNA & PEREIRA, 2001).

No Rickettsia-infected ticks were found among the 217 R. sanguineus s.l. and 16 A. cajennense s.l. specimens collected from the dogs. The absence of rickettsial infection among the R. sanguineus ticks was corroborated through serological analysis, since this tick was the only species on the urban dogs, which were almost all seronegative for Rickettsia spp. Because canine seroreactivity to R. amblyommii was strongly associated with rural areas or hunting practices, it is reasonable to speculate that our limited sample of only 16 A. cajennense s.l. ticks was too small, thus precluding findings of R. amblyommii-infected ticks, given that R. amblyommii had already been reported infecting A. cajennense s.l. ticks in Brazil, Costa Rica and Panama (LABRUNA et al., 2004b; BERMÚDEZ et al., 2011; HUN et al., 2011). Conversely, one out of the 26 A. ovale ticks was shown to be infected by R. bellii. Indeed, R. bellii is the most common rickettsial agent infecting Amblyomma ticks in Brazil, including A. ovale (LABRUNA et al., 2011). None of the dogs of our study presented any serological evidence of R. bellii infection. It is possible that R. bellii is not infective to dogs, since a previous study also found no serological evidence of rickettsial infection among dogs that had been infested specifically by R. bellii-infected Amblyomma ticks (PINTER et al., 2008).

Regarding the two distinct habitat types (urban and rural areas) sampled in the state of Maranhão, it was shown that canine seroreactivity to E. canis was similar in urban and rural areas, whereas seroreactivity to B. vogeli was higher among urban dogs, and seroreactivity to R. amblyommii was higher among rural dogs. Interestingly, a very similar scenario was recently reported in the state of Pará (a state neighboring Maranhão), where Spolidorio et al. (2013) found anti-B. vogeli antibodies in 59.6% of the urban dogs, and in 29.1% of the rural dogs (P < 0.05). For E. canis, the seroprevalence was similar among urban dogs (15.7%) and rural dogs (16.6%); for Rickettsia spp, rural dogs presented significantly higher (P < 0.05) prevalence (40.3%) than urban dogs (21.1%), with highest endpoint titers for R. amblyommii. Similarly, in the state of Mato Grosso, in the central-western region of Brazil, Melo et al. (2011) reported similar seroreactivity to E. canis among urban dogs (74.3%) and rural dogs (67.5%) (P > 0.05), whereas seroreactivity to Rickettsia spp. was significantly higher among rural dogs (75.6%) than urban dogs (19.3%) (P < 0.05), also with highest endpoint titers for R. amblyommii. Indeed, this common scenario reported for dogs in three different Brazilian states is primarily related to the tick species found on the dogs, with predominance of R. sanguineus in urban areas and presence of Amblyomma species in rural areas. This scenario should be considered to be the epidemiological background for controlling and preventing canine tick-borne diseases in these neglected regions of Brazil.

Acknowledgements

We acknowledge the Coordination Office for Advancement of Higher-Education Personnel (Coordenação de Aperfeiçoamento de Pessoal de Nível Superior, CAPES) for a scholarship and the Research and Scientific and Technological Development Support Foundation of Maranhão (Fundação de Amparo à Pesquisa e ao Desenvolvimento Científico e Tecnológico do Maranhão, FAPEMA) for financial support. The cooperation of the dog owners in offering their valuable time and their animals for sampling is highly appreciated.

References

• Aguiar DM, Cavalcante GT, Pinter A, Gennari SM, Camargo LM, Labruna MB. Prevalence of (Rickettsiales: Anaplasmataceae) in dogs and . Ehrlichia canisRhipicephalus sanguineus (Acari: Ixodidae) ticks from BrazilJ Med Entomol 2007a; 44(1): 126-132. http://dx.doi.org/10.1093/jmedent/41.5.126. PMid:17294930
  » http://dx.doi.org/10.1093/jmedent/41.5.126
• Aguiar DM, Saito TB, Hagiwara MK, Machado RZ, Labruna MB. Diagnóstico sorológico de erliquiose canina com antígeno brasileiro de Ehrlichia canis.Cienc Rural 2007b; 37(3): 796-802. http://dx.doi.org/10.1590/S0103-84782007000300030.
  » http://dx.doi.org/10.1590/S0103-84782007000300030
• Aguiar DM, Hagiwara MK, Labruna MB. In vitro isolation and molecular characterization of an Ehrlichia canis strain from São Paulo, Brazil. Braz J Microbiol 2008; 39(3): 489-493. http://dx.doi.org/10.1590/S1517-83822008000300014. PMid:24031251
  » http://dx.doi.org/10.1590/S1517-83822008000300014
• Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990; 215(3): 403-410. http://dx.doi.org/10.1016/S0022-2836(05)80360-2. PMid:2231712
  » http://dx.doi.org/10.1016/S0022-2836(05)80360-2
• Baba K, Itamoto K, Amimoto A, Kitagawa K, Hiraoka H, Mizuno T, et al. Ehrlichia canis infection in two dogs that emigrated from endemic areas. J Vet Med Sci 2012; 74(6): 775-778. http://dx.doi.org/10.1292/jvms.11-0401. PMid:22214859
  » http://dx.doi.org/10.1292/jvms.11-0401
• Beck R, Vojta L, Mrljak V, Marinculić A, Beck A, Zivicnjak T, et al. Diversity of and species in symptomatic and asymptomatic dogs in Croatia. BabesiaTheileriaInt J Parasitol 2009; 39(7): 843-848. http://dx.doi.org/10.1016/j.ijpara.2008.12.005. PMid:19367832
  » http://dx.doi.org/10.1016/j.ijpara.2008.12.005
• Bermúdez CS, Zaldívar AY, Spolidorio MG, Moraes-Filho J, Miranda RJ, Caballero CM, et al. Rickettsial infection in domestic mammals and their ectoparasites in El Valle de Antón, Coclé, Panamá. Vet Parasitol 2011; 177(1-2): 134-138. http://dx.doi.org/10.1016/j.vetpar.2010.11.020. PMid:21144663
  » http://dx.doi.org/10.1016/j.vetpar.2010.11.020
• Birkenheuer AJ, Levy MG, Breitschwerdt EB. Development and evaluation of a seminested PCR for detection and differentiation of Babesia gibsoni (Asian genotype) and B. canis DNA in canine blood samples. J Clin Microbiol 2003; 41(9): 4172-4177. http://dx.doi.org/10.1128/JCM.41.9.4172-4177.2003. PMid:12958243
  » http://dx.doi.org/10.1128/JCM.41.9.4172-4177.2003
• Braga MS, André MR, Freschi CR, Teixeira MCA, Machado RZ. Molecular and serological detection of spp. in cats on São Luís Island, Maranhão, Brazil. EhrlichiaRev Bras Parasitol Vet 2012; 21(1): 37-41. http://dx.doi.org/10.1590/S1984-29612012000100008. PMid:22534943
  » http://dx.doi.org/10.1590/S1984-29612012000100008
• Burgdorfer W. Ecological and epidemiological considerations of Rocky Mountain spotted fever and scrub typhus. In: Walker DH. Biological of Rickettsial Diseases. Boca Raton: CRC Press; 1988. p. 33-50. vol. II.
• Costa AP, Silva AB, Costa FB, Xavier GS, Martins TF, Labruna MB, et al. A survey of ectoparasites infesting urban and rural dogs of Maranhão state, Brazil. J Med Entomol 2013; 50(3): 674-678. http://dx.doi.org/10.1603/ME12243. PMid:23802466
  » http://dx.doi.org/10.1603/ME12243
• Costa-Júnior LM, Ribeiro MFB, Rembeck K, Rabelo EML, Zahler-Rinder M, Hirzmann J, et al. Canine babesiosis caused by in rural areas of the State of Minas Gerais, Brazil and factors associated with its seroprevalence. Babesia canis vogeliRes Vet Sci 2009; 86(2): 257-260. http://dx.doi.org/10.1016/j.rvsc.2008.07.002. PMid:18723199
  » http://dx.doi.org/10.1016/j.rvsc.2008.07.002
• Criado-Fornelio A, Martinez-Marcos A, Buling-Saraña A, Barba-Carretero JC. Molecular studies on and in southern Europe: Part I. Epizootiological aspects. Babesia, TheileriaHepatozoonVet Parasitol 2003; 113(3-4): 189-201. http://dx.doi.org/10.1016/S0304-4017(03)00078-5. PMid:12719133
  » http://dx.doi.org/10.1016/S0304-4017(03)00078-5
• Dantas-Torres F. Canine vector-borne diseases in Brazil. Parasit Vectors 2008; 1(1): 25. http://dx.doi.org/10.1186/1756-3305-1-25. PMid:18691408
  » http://dx.doi.org/10.1186/1756-3305-1-25
• Dawson JE, Biggie KL, Warner CK, Cookson K, Jenkins S, Levine JF, et al. Polymerase chain reaction evidence of , an etiologic agent of human ehrlichiosis, in dogs from southeast Virginia. Ehrlichia chaffeensisAm J Vet Res 1996; 57(8): 1175-1179. PMid:8836370.
• Duarte SC, Linhares GFC, Romanowsky TN, Silveira OJ No, Borges LMF. Assessment of primers designed for the subspecies-specific discrimination among Babesia canis canis, Babesia canis vogeli and . Babesia canis rossi by PCR assayVet Parasitol 2008; 152(1-2): 16-20. http://dx.doi.org/10.1016/j.vetpar.2007.12.013. PMid:18242863
  » http://dx.doi.org/10.1016/j.vetpar.2007.12.013
• Furuta PI, Oliveira TMFS, Teixeira MC, Rocha AG, Machado RZ, Tinucci-Costa MG. Comparison between a soluble antigen-based ELISA and IFAT in detecting antibodies against Babesia canis in dogs. Rev Bras Parasitol Vet 2009; 18(3): 41-45. http://dx.doi.org/10.4322/rbpv.01803007. PMid:19772774
  » http://dx.doi.org/10.4322/rbpv.01803007
• Guimarães AM, Rocha CMBM, Oliveira TMFS, Rosado IR, Morais LG, Santos RRD. Fatores associados à soropositividade para , Toxoplasma, e . BabesiaNeosporaLeishmania em cães atendidos em nove clínicas veterinárias do município de Lavras, MGRev Bras Parasitol Vet 2009;18(Suppl 1): 49-53. http://dx.doi.org/10.4322/rbpv.018e1009. PMid:20040191
  » http://dx.doi.org/10.4322/rbpv.018e1009
• Hii SF, Kopp SR, Thompson MF, O'Leary CA, Rees RL, Traub RJ. Canine vector-borne disease pathogens in dogs from south-east Queensland and north-east Northern Territory. Aust Vet J 2012; 90(4): 130-135. http://dx.doi.org/10.1111/j.1751-0813.2012.00898.x. PMid:22443327
  » http://dx.doi.org/10.1111/j.1751-0813.2012.00898.x
• Hun L, Troyo A, Taylor L, Barbieri AM, Labruna MB. First report of the isolation and molecular characterization of Rickettsia amblyommii and in Central America. Rickettsia felisVector Borne Zoonotic Dis 2011; 11(10): 1395-1397. http://dx.doi.org/10.1089/vbz.2011.0641. PMid:21612539
  » http://dx.doi.org/10.1089/vbz.2011.0641
• Inokuma H, Oyamada M, Davoust B, Boni M, Dereure J, Bucheton B, et al. Epidemiological survey of and related species infection in dogs in eastern Sudan. Ehrlichia canisAnn N Y Acad Sci 2006; 1078(1): 461-463. http://dx.doi.org/10.1196/annals.1374.085. PMid:17114754
  » http://dx.doi.org/10.1196/annals.1374.085
• Instituto Interamericano de Cooperacion para la Agricultura – IICA. Tecnicas para El diagnostico de babesiosis y anaplasmosis bovinas. San José; 1987.
• Irwin PJ. The first report of canine ehrlichiosis in Australia. Aust Vet J 2001; 79(8): 552-553. http://dx.doi.org/10.1111/j.1751-0813.2001.tb10746.x. PMid:11599816
  » http://dx.doi.org/10.1111/j.1751-0813.2001.tb10746.x
• Labruna MB, Pereira MC. Carrapato em cães no Brasil. Clin Vet (Milano) 2001; 30: 24-31.
• Labruna MB, Whitworth T, Horta MC, Bouyer DH, McBride JW, Pinter A, et al. Rickettsia species infecting ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic. Amblyomma cooperiJ Clin Microbiol 2004a; 42(1): 90-98. http://dx.doi.org/10.1128/JCM.42.1.90-98.2004. PMid:14715737
  » http://dx.doi.org/10.1128/JCM.42.1.90-98.2004
• Labruna MB, Whitworth T, Bouyer DH, McBride J, Camargo LMA, Camargo EP, et al. and . Rickettsia belliiRickettsia amblyommii in Amblyomma ticks from the state of Rondônia, western Amazon, BrazilJ Med Entomol 2004b; 41(6): 1073-1081. http://dx.doi.org/10.1603/0022-2585-41.6.1073. PMid:15605647
  » http://dx.doi.org/10.1603/0022-2585-41.6.1073
• Labruna MB, McBride JW, Bouyer DH, Camargo LMA, Camargo EP, Walker DH. Molecular evidence for a spotted fever group species in the tick . RickettsiaAmblyomma longirostre in BrazilJ Med Entomol 2004c; 41(3): 533-537. http://dx.doi.org/10.1603/0022-2585-41.3.533. PMid:15185961
  » http://dx.doi.org/10.1603/0022-2585-41.3.533
• Labruna MB, Horta MC, Aguiar DM, Cavalcante GT, Pinter A, Gennari SM, et al. Prevalence of infection in dogs from the urban and rural areas of Monte Negro municipality, western Amazon, Brazil. RickettsiaVector Borne Zoonotic Dis 2007; 7(2): 249-255. http://dx.doi.org/10.1089/vbz.2006.0621. PMid:17627445
  » http://dx.doi.org/10.1089/vbz.2006.0621
• Labruna MB. Ecology of R in South America. ickettsiaAnn N Y Acad Sci 2009; 1166(1): 156-166. http://dx.doi.org/10.1111/j.1749-6632.2009.04516.x. PMid:19538276
  » http://dx.doi.org/10.1111/j.1749-6632.2009.04516.x
• Labruna MB, Mattar S, Nava S, Bermudez S, Venzal JM, Dolz G, et al. Rickettsioses in Latin America, Caribbean, Spain and Portugal. Rev MVZ Córdoba 2011; 16(2): 2435-2457.
• Lewis BD, Penzhorn BL, Lopez-Rebollar LM, De Waal DT. Isolation of a South African vector-specific strain of . Babesia canisVet Parasitol 1996; 63(1-2): 9-16. http://dx.doi.org/10.1016/0304-4017(95)00881-0. PMid:8792576
  » http://dx.doi.org/10.1016/0304-4017(95)00881-0
• López J, Abarca K, Mundaca MI, Caballero C, Valiente-Echeverría F. Identificación molecular de en un canino de la ciudad de Arica, Chile. Ehrlichia canisRev Chilena Infectol 2012; 29(5): 527-530. http://dx.doi.org/10.4067/S0716-10182012000600008. PMid:23282495
  » http://dx.doi.org/10.4067/S0716-10182012000600008
• Maia MG, Costa RT, Haddad JP, Passos LMF, Ribeiro MFB. Epidemiological aspects of canine babesiosis in the semiarid area of the state of Minas Gerais, Brazil. Prev Vet Med 2007; 79(2-4): 155-162. http://dx.doi.org/10.1016/j.prevetmed.2006.11.013. PMid:17210194
  » http://dx.doi.org/10.1016/j.prevetmed.2006.11.013
• Matjila PT, Leisewitz AL, Jongejan F, Penzhorn BL. Molecular detection of tick-borne protozoal and ehrlichial infections in domestic dogs in South Africa. Vet Parasitol 2008; 155(1-2): 152-157. http://dx.doi.org/10.1016/j.vetpar.2008.04.012. PMid:18502588
  » http://dx.doi.org/10.1016/j.vetpar.2008.04.012
• McClure JC, Crothers ML, Schaefer JJ, Stanley PD, Needham GR, Ewing SA, et al. Efficacy of a doxycycline treatment regimen initiated during three different phases of experimental ehrlichiosis. Antimicrob Agents Chemother 2010; 54(12): 5012-5020. http://dx.doi.org/10.1128/AAC.01622-09. PMid:20921310
  » http://dx.doi.org/10.1128/AAC.01622-09
• Melo AL, Martins TF, Horta MC, Moraes-Filho J, Pacheco RC, Labruna MB, et al. Seroprevalence and risk factors to spp. and spp. in dogs from the Pantanal Region of Mato Grosso State, Brazil. EhrlichiaRickettsiaTicks Tick Borne Dis 2011; 2(4): 213-218. http://dx.doi.org/10.1016/j.ttbdis.2011.09.007. PMid:22108015
  » http://dx.doi.org/10.1016/j.ttbdis.2011.09.007
• Murphy GL, Ewing SA, Whitworth LC, Fox JC, Kocan AA. A molecular and serologic survey of , . Ehrlichia canisE. chaffeensis, and E. ewingii in dogs and ticks from OklahomaVet Parasitol 1998; 79(4): 325-339. http://dx.doi.org/10.1016/S0304-4017(98)00179-4. PMid:9831955
  » http://dx.doi.org/10.1016/S0304-4017(98)00179-4
• O'Dwyer LH, Lopes VV, Rubini AS, Paduan KS, Ribolla PE. Babesia spp. infection in dogs from rural areas of São Paulo State, Brazil. Rev Bras Parasitol Vet 2009; 18(2): 23-26. http://dx.doi.org/10.4322/rbpv.01802005. PMid:19602312
  » http://dx.doi.org/10.4322/rbpv.01802005
• Ogrzewalska M, Pacheco RC, Uezu A, Ferreira F, Labruna MB. Ticks (Acari: Ixodidae) infesting wild birds in an Atlantic forest area in the state of São Paulo, Brazil, with isolation of R from the tick . ickettsiaAmblyomma longirostreJ Med Entomol 2008; 45(4): 770-774. PMid:18714882.
• Ogrzewalska M, Uezu A, Labruna MB. Ticks (Acari: Ixodidae) infesting wild birds in the Atlantic Forest in northeastern Brazil, with notes on rickettsial infection in ticks. Parasitol Res 2011; 108(3): 665-670. http://dx.doi.org/10.1007/s00436-010-2111-8. PMid:20953629
  » http://dx.doi.org/10.1007/s00436-010-2111-8
• Oyamada M, Davoust B, Boni M, Dereure J, Bucheton B, Hammad A, et al. Detection of Babesia canis rossi, B. canis vogeli, and in dogs in a village of eastern Sudan by using a screening PCR and sequencing methodologies. Hepatozoon canisClin Diagn Lab Immunol 2005; 12(11): 1343-1346. PMid:16275954.
• Passos LMF, Geiger SM, Ribeiro MFB, Pfister K, Zahler-Rinder M. First molecular detection of in dogs from Brazil. Babesia vogeliVet Parasitol 2005; 127(1): 81-85. http://dx.doi.org/10.1016/j.vetpar.2004.07.028. PMid:15619377
  » http://dx.doi.org/10.1016/j.vetpar.2004.07.028
• Pinter A, Horta MC, Pacheco RC, Moraes-Filho J, Labruna MB. Serosurvey of spp. in dogs and humans from an endemic area for Brazilian spotted fever in the State of São Paulo, Brazil. RickettsiaCad Saude Publica 2008; 24(2): 247-252. http://dx.doi.org/10.1590/S0102-311X2008000200003. PMid:18278271
  » http://dx.doi.org/10.1590/S0102-311X2008000200003
• Piranda EM, Faccini JL, Pinter A, Saito TB, Pacheco RC, Hagiwara MK, et al. Experimental infection of dogs with a Brazilian strain of : clinical and laboratory findings. Rickettsia rickettsiiMem Inst Oswaldo Cruz 2008; 103(7): 696-701. http://dx.doi.org/10.1590/S0074-02762008000700012. PMid:19057821
  » http://dx.doi.org/10.1590/S0074-02762008000700012
• Ramos R, Ramos C, Araújo F, Oliveira R, Souza I, Pimentel D, et al. Molecular survey and genetic characterization of tick-borne pathogens in dogs in metropolitan Recife (north-eastern Brazil). Parasitol Res 2010; 107(5): 1115-1120. http://dx.doi.org/10.1007/s00436-010-1979-7. PMid:20680344
  » http://dx.doi.org/10.1007/s00436-010-1979-7
• Rodriguez-Vivas RI, Albornoz RE, Bolio GM. in dogs in Yucatan, Mexico: seroprevalence, prevalence of infection and associated factors. Ehrlichia canisVet Parasitol 2005; 127(1): 75-79. http://dx.doi.org/10.1016/j.vetpar.2004.08.022. PMid:15619376
  » http://dx.doi.org/10.1016/j.vetpar.2004.08.022
• Saito TB, Cunha-Filho NA, Pacheco RC, Ferreira F, Pappen FG, Farias NA, et al. Canine infection by rickettsiae and ehrlichiae in southern Brazil. Am J Trop Med Hyg 2008; 79(1): 102-108. PMid:18606772.
• Sangioni LA, Horta MC, Vianna MC, Gennari SM, Soares RM, Galvão MA, et al. Rickettsial infection in animals and Brazilian spotted fever endemicity. Emerg Infect Dis 2005; 11(2): 265-270. http://dx.doi.org/10.3201/eid1102.040656. PMid:15752445
  » http://dx.doi.org/10.3201/eid1102.040656
• Selbach JF, Leite JRSA. Meio ambiente no Baixo Parnaíba: olhos no mundo, pés na região. São Luis: EDUFMA; 2008.
• Shaw SE, Day MJ, Birtles RJ, Breitschwerdt EB. Tick-borne infectious diseases of dogs. Trends Parasitol 2001; 17(2): 74-80. http://dx.doi.org/10.1016/S1471-4922(00)01856-0. PMid:11228013
  » http://dx.doi.org/10.1016/S1471-4922(00)01856-0
• Silva AB, Costa AP, Sá JC, Costa FB, Santos ACG, Guerra RMSNC. Detecção molecular de em cães e em na mesorregião do oeste maranhense, nordeste brasileiro. Babesia canis vogeliRhipicephalus sanguineusCienc Anim Bras 2012; 13(3): 388-395.
• Silva JN, Almeida AB, Boa Sorte EC, Freitas AG, Santos LGF, Aguiar DM, et al. Soroprevalência de anticorpos anti-Ehrlichia canis em cães de Cuiabá, Mato Grosso. Rev Bras Parasitol Vet 2010a; 19(2): 108-111. http://dx.doi.org/10.4322/rbpv.01902008. PMid:20624348
  » http://dx.doi.org/10.4322/rbpv.01902008
• Silva ME, Ribeiro RR, Costa JO, Moraes-Filho J, Pacheco RC, Labruna MB. Prevalência de anticorpos anti-Rickettsia spp. em cães da cidade de Belo Horizonte, MG. Arq Bras Med Vet Zootec 2010b; 62(4): 1007-1010. http://dx.doi.org/10.1590/S0102-09352010000400036.
  » http://dx.doi.org/10.1590/S0102-09352010000400036
• Singla LD, Singh H, Kaur P, Singh ND, Singh NK, Juyal PD. Serodetection of Ehrlichia canis infection in dogs from Ludhiana district of Punjab, India. J Parasit Dis 2011; 35(2): 195-198. http://dx.doi.org/10.1007/s12639-011-0055-2. PMid:23024503
  » http://dx.doi.org/10.1007/s12639-011-0055-2
• Spolidorio MG, Minervino AH, Valadas SY, Soares HS, Neves KA, Labruna MB, et al. Serosurvey for tick-borne diseases in dogs from the Eastern Amazon, Brazil. Rev Bras Parasitol Vet 2013; 22(2): 214-219. http://dx.doi.org/10.1590/S1984-29612013005000023. PMid:23802236
  » http://dx.doi.org/10.1590/S1984-29612013005000023
• Szabó MP, Cunha TM, Pinter A, Vicentini F. Ticks (Acari: Ixodidae) associated with domestic dogs in Franca region, São Paulo, Brazil. Exp Appl Acarol 2001; 25(10-11): 909-916. http://dx.doi.org/10.1023/A:1020433003028. PMid:12455880
  » http://dx.doi.org/10.1023/A:1020433003028
• Szabó MP, de Souza LG, Olegário MM, Ferreira FA, Pajuaba AA No. Ticks (Acari: Ixodidae) on dogs from Uberlândia, Minas Gerais, Brazil. Transbound Emerg Dis 2010; 57(1-2): 72-74. http://dx.doi.org/10.1111/j.1865-1682.2010.01111.x. PMid:20537111
  » http://dx.doi.org/10.1111/j.1865-1682.2010.01111.x
• Trapp SM, Dagnone AS, Vidotto O, Freire RL, Amude AM, Morais HS. Seroepidemiology of canine babesiosis and ehrlichiosis in a hospital population. Vet Parasitol 2006; 140(3-4): 223-230. http://dx.doi.org/10.1016/j.vetpar.2006.03.030. PMid:16647817
  » http://dx.doi.org/10.1016/j.vetpar.2006.03.030
• Uilenberg G, Franssen FF, Perié NM, Spanjer AA. Three groups of distinguished and a proposal for nomenclature. Babesia canisVet Q 1989; 11(1): 33-40. http://dx.doi.org/10.1080/01652176.1989.9694194. PMid:2655263
  » http://dx.doi.org/10.1080/01652176.1989.9694194
• Unver A, Perez M, Orellana N, Huang H, Rikihisa Y. Molecular and antigenic comparison of isolates from dogs, ticks, and a human in Venezuela. Ehrlichia canisJ Clin Microbiol 2001; 39(8): 2788-2793. http://dx.doi.org/10.1128/JCM.39.8.2788-2793.2001. PMid:11473993
  » http://dx.doi.org/10.1128/JCM.39.8.2788-2793.2001
• Vieira RF, Biondo AW, Guimarães AM, Santos AP, Santos RP, Dutra LH, et al. Ehrlichiosis in Brazil. Rev Bras Parasitol Vet 2011; 20(1): 1-12. http://dx.doi.org/10.1590/S1984-29612011000100002. PMid:21439224
  » http://dx.doi.org/10.1590/S1984-29612011000100002
• Vinasco J, Li O, Alvarado A, Diaz D, Hoyos L, Tabachi L, et al. Molecular evidence of a new strain of from South America. Ehrlichia canisJ Clin Microbiol 2007; 45(8): 2716-2719. http://dx.doi.org/10.1128/JCM.01102-07. PMid:17596368
  » http://dx.doi.org/10.1128/JCM.01102-07
• Yu XJ, Walker DH. The Order Rickettsiales. In: Dworkin M. The Prokaryotes: an evolving electronic resource for the microbiology community. 3rd ed. New York: Springer-Velag; 2003. [cited 2013 Jan 20]. Available from: http://link.springer.ny.com/link/service/books/10125.

Publication Dates

• Publication in this collection
  Jan-Mar 2015

History

• Received
  09 Sept 2014
• Accepted
  12 Jan 2015