Abstracts
This study assessed the occurrence of Ehrlichia spp., Babesia spp. and Hepatozoon spp. infections in 100 tick-harboring dogs from a semiarid region of the State of Paraíba, Northeastern Brazil. Blood samples and ticks were collected from the animals, and a questionnaire was submitted to dog owners to obtain general data. Blood samples were used to perform hemogram, direct blood smear and immunological and molecular hemoparasite detection. The 1,151 ticks collected were identified as Rhipicephalus sanguineus; direct smears revealed E. canis-like morulae in the monocytes of 4% (4/100) of the non-vaccinated female dogs, and 34% and 25% of the dogs tested positive for Ehrlichia canis by indirect immunofluorescence assay (IFA) and polymerase chain reaction (PCR), respectively. Blood smear examination revealed Babesia-suggestive merozoites in the erythrocytes of 2% (2/100) of the animals. Babesia vogeli was detected by PCR in ten animals (10%) and was correlated with young age (p = 0.007) and thrombocytopenia (p = 0.01). None of the animals showed Hepatozoon spp. positivity. These results indicate that E. canis is the main tick-borne canine pathogen in the study area and provide the first report of B. vogeli infection in dogs from Paraiba State.
Ehrlichia; Babesia; Hepatozoon; dogs; Northeastern Brazil
O presente estudo avaliou a ocorrência de infecção por Ehrlichia spp., Babesia spp. e Hepatozoon spp. em 100 cães, infestados por carrapatos, oriundos de uma região semiárida do Estado da Paraíba, Nordeste do Brasil. Amostras de sangue e de carrapatos foram coletadas dos animais, e um questionário foi submetido aos proprietários dos cães para obter dados gerais. As amostras de sangue foram utilizadas para realização de hemograma, esfregaço sanguíneo e detecção molecular dos hemoparasitos. Os 1.151 carrapatos coletados foram identificados como Rhipicephalus sanguineus; os esfregaços sanguíneos revelaram mórulas sugestivas de E. canis em 4% (4/100) de cães fêmeas não vacinadas, e 34% e 25% dos cães foram positivos para Ehrlichia canis pela imunofluorescência indireta (IFI) e reação em cadeia pela polimerase (PCR), respectivamente. Os esfregaços sanguíneos revelaram merozoítas sugestivas de Babesia em eritrócitos de 2% (2/100) dos animais. Babesia vogeli foi detectada por PCR em dez animais (10%) e foi correlacionada com a idade jovem (p=0,007) e trombocitopenia (p=0,01). Nenhum dos animais apresentou positividade para Hepatozoon spp. Esses resultados indicam que E. canis é o principal patógeno canino transmitido por carrapato, na área estudada, e fornece o primeiro relato de infecção por B. vogeli em cães do Estado da Paraíba.
Ehrlichia; Babesia; Hepatozoon; cães; Nordeste do Brasil
Introduction
Tick-borne diseases are important cause of morbidity and mortality in dogs worldwide, and the brown dog tick Rhipicephalus sanguineus has been implicated as vector of several pathogens (DANTAS-TORRES, 2008Dantas-Torres F. The brown dog tick, (Latreille, 1806) (Acari: Ixodidae): from taxonomy to control. Rhipicephalus sanguineusVet Parasitol 2008; 152(3-4): 173-185. http://dx.doi.org/10.1016/j.vetpar.2007.12.030. PMid:18280045
http://dx.doi.org/10.1016/j.vetpar.2007....
). In Brazil, the main tick-borne pathogens that have been described for dogs are Babesia vogeli, Ehrlichia canis, Anaplasma platys, Hepatozoon canis, and Mycoplasma haemocanis (RAMOS et al., 2010Ramos R, Ramos C, Araújo F, Oliveira R, Souza I, Pimentel D, et al. Molecular survey and genetic characterization of tick-borne pathogens in dogs in metropolitan Recife (north-eastern Brazil). Parasitol Res 2010; 107(5): 1115-1120. http://dx.doi.org/10.1007/s00436-010-1979-7. PMid:20680344
http://dx.doi.org/10.1007/s00436-010-197...
; SANTOS et al., 2009Santos F, Coppede JS, Pereira AL, Oliveira LP, Roberto PG, Benedetti RB, et al. Molecular evaluation of the incidence of Ehrlichia canis, Anaplasma platys and spp. in dogs from Ribeirão Preto, Brazil. BabesiaVet J 2009; 179(1): 145-148. http://dx.doi.org/10.1016/j.tvjl.2007.08.017. PMid:17920967
http://dx.doi.org/10.1016/j.tvjl.2007.08...
; SPOLIDORIO et al., 2009Spolidorio MG, Labruna MB, Zago AM, Donatele DM, Caliari KM, Yoshinari NH. infecting dogs in the State of Espírito Santo, southeastern Brazil. Hepatozoon canisVet Parasitol 2009; 163(4): 357-361. http://dx.doi.org/10.1016/j.vetpar.2009.05.002. PMid:19482427
http://dx.doi.org/10.1016/j.vetpar.2009....
, 2011Spolidorio MG, Torres MM, Campos WN, Melo AL, Igarashi M, Amude AM, et al. Molecular detection of and in domestic dogs from Cuiabá, Brazil. Hepatozoon canisBabesia canis vogeliRev Bras Parasitol Vet 2011; 20(3): 253-255. http://dx.doi.org/10.1590/S1984-29612011000300015. PMid:21961759
http://dx.doi.org/10.1590/S1984-29612011...
).
E. canis is the primary etiologic agent of canine monocytic ehrlichiosis (CME), which is a multisystemic disease manifesting in acute, subclinical or chronic forms, according to the virulence level of the E. canis strain and the presence of co-infection with other arthropod-borne pathogens, such as Babesia spp. and H. canis (GAL et al., 2008Gal A, Loeb E, Yisaschar-Mekuzas Y, Baneth G. Detection of by PCR in different tissues obtained during necropsy from dogs surveyed for naturally occurring canine monocytic ehrlichiosis. Ehrlichia canisVet J 2008; 175(2): 212-217. http://dx.doi.org/10.1016/j.tvjl.2007.01.013. PMid:17368942
http://dx.doi.org/10.1016/j.tvjl.2007.01...
).
Babesiosis is an emerging tick-borne disease affecting animals and humans, caused by intraerythrocytic protozoa of the genus Babesia (IRWIN, 2009Irwin PJ. Canine babesiosis: from molecular taxonomy to control. Parasit Vectors 2009;2(Suppl 1): S4. http://dx.doi.org/10.1186/1756-3305-2-S1-S4. PMid:19426443
http://dx.doi.org/10.1186/1756-3305-2-S1...
). In Brazil, two Babesia species infecting dogs have been reported, B. vogeli (PASSOS et al., 2005Passos LM, Geiger SM, Ribeiro MF, Pfister K, Zahler-Rinder M. First molecular detection of in dogs from Brazil. Babesia vogeliVet Parasitol 2005; 127(1): 81-85. http://dx.doi.org/10.1016/j.vetpar.2004.07.028. PMid:15619377
http://dx.doi.org/10.1016/j.vetpar.2004....
) and B. gibsoni (TRAPP et al., 2006Trapp SM, Dagnone AS, Vidotto O, Freire RL, Amude AM, de Morais HS. Seroepidemiology of canine babesiosis and ehrlichiosis in a hospital population. Vet Parasitol 2006; 140(3-4): 223-230. http://dx.doi.org/10.1016/j.vetpar.2006.03.030. PMid:16647817
http://dx.doi.org/10.1016/j.vetpar.2006....
). B. vogeli is the most widespread canine piroplasm due to the cosmopolitan nature of its invertebrate host, the brown dog tick R. sanguineus. All Babesia species may cause pyrexia, anorexia, splenomegaly, anemia and severe thrombocytopenia (IRWIN, 2009Irwin PJ. Canine babesiosis: from molecular taxonomy to control. Parasit Vectors 2009;2(Suppl 1): S4. http://dx.doi.org/10.1186/1756-3305-2-S1-S4. PMid:19426443
http://dx.doi.org/10.1186/1756-3305-2-S1...
).
The Hepatozoon species known to infect dogs are protozoans transmitted through the ingestion of infected ticks (SPOLIDORIO et al., 2009Spolidorio MG, Labruna MB, Zago AM, Donatele DM, Caliari KM, Yoshinari NH. infecting dogs in the State of Espírito Santo, southeastern Brazil. Hepatozoon canisVet Parasitol 2009; 163(4): 357-361. http://dx.doi.org/10.1016/j.vetpar.2009.05.002. PMid:19482427
http://dx.doi.org/10.1016/j.vetpar.2009....
, 2011Spolidorio MG, Torres MM, Campos WN, Melo AL, Igarashi M, Amude AM, et al. Molecular detection of and in domestic dogs from Cuiabá, Brazil. Hepatozoon canisBabesia canis vogeliRev Bras Parasitol Vet 2011; 20(3): 253-255. http://dx.doi.org/10.1590/S1984-29612011000300015. PMid:21961759
http://dx.doi.org/10.1590/S1984-29612011...
). Veterinarians usually misdiagnose the infection because the general symptoms are similar to those of other tick-borne diseases, such as ehrlichiosis and babesiosis (MURATA et al., 1991Murata T, Shiramizu K, Hara Y, Inoue M, Shimoda K, Nakama S. First case of Hepatozoon canis infection of a dog in Japan. J Vet Med Sci 1991; 53(6): 1097-1099. http://dx.doi.org/10.1292/jvms.53.1097. PMid:1790224
http://dx.doi.org/10.1292/jvms.53.1097...
). Two Hepatozoon species have been described in dogs, including H. canis and H. americanum (BANETH et al., 2000Baneth G, Barta JR, Shkap V, Martin DS, Macintire DK, Vincent-Johnson N. Genetic and antigenic evidence supports the separation of Hepatozoon canis and at the species level. Hepatozoon americanumJ Clin Microbiol 2000; 38(3): 1298-1301. PMid:10699047., 2007Baneth G, Samish M, Shkap V. Life cycle of Hepatozoon canis (Apicomplexa: Adeleorina: Hepatozoidae) in the tick Rhipicephalus sanguineus and domestic dog (). Canis familiarisJ Parasitol 2007; 93(2): 283-299. http://dx.doi.org/10.1645/GE-494R.1. PMid:17539411
http://dx.doi.org/10.1645/GE-494R.1...
); the former is responsible for all Brazilian cases reported in domestic dogs (SPOLIDORIO et al., 2011Spolidorio MG, Torres MM, Campos WN, Melo AL, Igarashi M, Amude AM, et al. Molecular detection of and in domestic dogs from Cuiabá, Brazil. Hepatozoon canisBabesia canis vogeliRev Bras Parasitol Vet 2011; 20(3): 253-255. http://dx.doi.org/10.1590/S1984-29612011000300015. PMid:21961759
http://dx.doi.org/10.1590/S1984-29612011...
).
This study aimed to assess the occurrences of E. canis, Babesia spp. and Hepatozoon spp. infections in dogs from the semiarid region of the State of Paraíba, Northeastern Brazil, using direct examination, serology and molecular detection methods and to identify factors associated with these infections.
Materials and Methods
Study area and dog sampling
This study was carried out in the municipality of Patos (7°1'S, 37°19'W) located in the State of Paraíba in the semiarid region of Northeastern Brazil. This locality has an average temperature of 32°C, relative humidity of 55% and annual rainfall of 700 mm. One hundred tick-harboring dogs attended at the Veterinary Hospital of the Federal University of Campina Grande from April to September of 2012 were selected for this study. A questionnaire was submitted to dog owners to obtain general information, such as the education and income of the owner (minimum wage), the sex and age of the dog, breed, management, food intake, vaccination and deworming statuses, contact with other animals (other dogs, cats, horses, pigs, and wild animals), the condition of the floor of the dog's premises, the cleaning of the dog's premises, and the frequency of cleaning.
Tick collection and identification
Ticks were randomly collected from the animals during a five-minute examination of each animal, and they were then submerged into 70% ethyl alcohol in polypropylene tubes and stored at room temperature until identification. Tick taxonomic identifications were performed according to Barros-Battesti et al. (2006)Barros-Battesti DM, Arzua M, Bechara GH. Carrapatos de Importância Médico-Veterinária da Região Neotropical: um guia ilustrado para identificação de espécies. São Paulo: Instituto Butatan; 2006..
Blood sample collection
Blood samples were collected by cephalic or jugular venipuncture into Vacutainer tubes containing sodium citrate. Direct examinations of the hemogram and smear were carried out immediately after blood collection. Reference values (RV) according to Jain (1993)Jain NC. Essentials of veterinary hematology. Philadelphia: Lea & Febiger; 1993. were as follows: leukocytes (RV: 6-17×103/µl), erythrocytes (RV: 5.5-8.5×106/µl), and platelets (RV: 2-5×105/µl). Aliquots of plasma and whole blood were stored at –20°C for subsequent use.
Indirect immunofluorescence assay (IFA)
The presence of anti-E. canis antibodies in the plasma was assessed by an Indirect immunofluorescence assay IFA using glass slides coated with crude antigens of E. canis (São Paulo strain) as previously described (AGUIAR et al., 2007Aguiar DM, Saito TB, Hagiwara MK, Machado RZ, Labruna MB. Serological diagnosis of canine monocytic ehrlichiosis with Brazilian antigen of Ehrlichia canis.Ciênc Rural 2007; 37(3): 796-802. http://dx.doi.org/10.1590/S0103-84782007000300030.
http://dx.doi.org/10.1590/S0103-84782007...
). Plasma samples were initially tested at a screening dilution (1:80) (KRAWCZAK et al., 2012Krawczak FS, Labruna MB, Sangioni LA, Vogel FSF, Soares JF, Lopes STDA. Serological survey on Ehrlichia sp. among dogs in the central region of Rio Grande do Sul. Rev Bras Parasitol Vet 2012; 21(4): 415-417. http://dx.doi.org/10.1590/S1984-29612012005000001. PMid:23184320
http://dx.doi.org/10.1590/S1984-29612012...
) and then re-tested with serial two-fold dilutions of up to 1:1280. A commercial fluorescein-labeled rabbit anti-canine IgG (Sigma-Aldrich, 3050 Spruce St. Louis, MO 63103, USA) was used as the secondary antibody.
Molecular analyses
Total DNA was extracted from canine whole blood using a commercial DNA extraction kit (Wizard Kit for DNA Extraction®) according to the manufacturer's instructions (Promega) and eluted in 50 μL of the elution buffer accompanying the extraction kit.
Assays to detect E. canis DNA were performed using a TaqMan real-time PCR (qPCR) system targeting a portion of the Ehrlichia disulfide bond formation protein-encoding gene (dsb) with the primers dsb-321 (5'-TTGCAAAATGATGTCTGAAGATATGAAACA-3') and dsb-671 (5'- GCTGCTCAACCAAGAAATGTATCCCCTA–3') and the E. canis-specific probe (5'-FAM AGCTAGTGCTGCTTGGGCAACTTTGAGTGAA-BHQ-1–3') at a concentration of 25 µmol/L as previously described (DOYLE et al., 2005Doyle CK, Labruna MB, Breitschwerdt EB, Tang YW, Corstvet RE, Hegarty BC, et al. Detection of medically important by quantitative multicolor TaqMan real-time polymerase chain reaction of the gene. EhrlichiadsbJ Mol Diagn 2005; 7(4): 504-510. http://dx.doi.org/10.1016/S1525-1578(10)60581-8. PMid:16237220
http://dx.doi.org/10.1016/S1525-1578(10)...
). Positive (DNA from E. canis-cultured DH82 cells) and negative (DH82 cells only) controls were included for all PCR assays. Samples with negative results, as shown by the E. canis-specific qPCR, were evaluated using conventional PCR with the primers dsb-330 (5'-GATGATGTCTGAAGATATGAAACAAAT-3') and dsb-728 (5'-CTGCTCGTCTATTTTACTTCTTAAAGT-3'), which were designed to amplify a 409-base pair (bp) fragment of the dsb gene of Ehrlichia spp. (LABRUNA et al., 2007Labruna MB, McBride JW, Camargo LM, Aguiar DM, Yabsley MJ, Davidson WR, et al. A preliminary investigation of species in ticks, humans, dogs, and capybaras from Brazil. EhrlichiaVet Parasitol 2007; 143(2): 189-195. http://dx.doi.org/10.1016/j.vetpar.2006.08.005. PMid:16962245
http://dx.doi.org/10.1016/j.vetpar.2006....
).
For the detection of Hepatozoon spp. and Babesia spp. DNA, five μL of extracted DNA were used for conventional PCR with the primers HEP144‑169 (5'-GGTAATTCTAGAGCTAATACATGAGC-3') and HEP743‑718 (5'-ACAATAAAGTAAAAAACAYTTCAAAG-3'), which amplify a 574‑bp fragment of the 18S rRNA gene of Hepatozoon spp., and the primers BAB143-167 (5'-CCGTGCTAATTGTAGGGCTAATACA-3') and BAB694-667(5'-GCTTGAAACACTCTARTTTTCTCAAAG-3'), which amplify a 551-bp fragment of the 18S rRNA gene of Babesia spp., as previously described (ALMEIDA et al., 2012Almeida AP, Marcili A, Leite RC, Nieri-Bastos FA, Domingues LN, Martins JR, et al. Coxiella symbiont in the tick (Acari: Argasidae). Ornithodoros rostratusTicks Tick Borne Dis 2012; 3(4): 203-206. http://dx.doi.org/10.1016/j.ttbdis.2012.02.003. PMid:22480930
http://dx.doi.org/10.1016/j.ttbdis.2012....
).
PCR products were electrophoresed on 1.5% agarose gel (Invitrogen, Carlsbad, CA), stained with ethidium bromide (AMRESCO, Solon, OH), and examined under UV illumination. Amplicons of the expected sizes were purified with ExoSap (GE Healthcare, Pittsburgh, PA) and sequenced with an automatic sequencer (Applied Biosystems, model ABI 3500 Genetic Analyzer) according to the manufacturer's protocol. The partial sequences obtained were subjected to BLAST analysis (ALTSCHUL et al., 1990Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990; 215(3): 403-410. http://dx.doi.org/10.1016/S0022-2836(05)80360-2. PMid:2231712
http://dx.doi.org/10.1016/S0022-2836(05)...
) to determine the presence of any similarities to corresponding sequences.
Statistical analysis
Risk factor analyses were performed considering the serological or molecular detection of E. canis, Babesia spp. and Hepatozoon spp. as the dependent variables and the data obtained from the questionnaire and hemogram as independent variables. The association between the dependent and independent variables was assessed in 2 steps with univariate and multivariable analyses. The variables presenting P ≤ 0.20 as determined by the chi-square test in the univariate analysis were selected and subjected to multivariate analysis using the logistic regression stepwise forward method with a 5% significance level (HOSMER & LEMESHOW, 1989Hosmer DW, Lemeshow S. Applied Logistic Regression. New York: Wiley; 1989.). The serological results were analyzed using the following dichotomic variable: (i) dogs serologically negative or with a titer <80 (0), and (ii) dogs with a titer ≥80 (1) for E. canis. The kappa index (THURSFIELD, 2007Thursfield M. Veterinary Epidemiology. Oxford: Wiley Blackwell; 2007.) was used to compare the IFA with the PCR and direct blood smear results for E. canis. Mean tick infestations among dogs positive and negative for E. canis or Babesia spp. were compared by the t-Student test. All analyses were performed with SPSS 13.0 for Windows.
Ethical considerations
The present study was submitted to and approved by the Research Ethics Committee of the Universidade Federal de Campina Grande, protocol number 07/2012, prior to initiation.
Results
Hemogram analysis revealed that 52% (52/100) of the dogs were anemic, 12% (12/100) were leukopenic, and 37% (37/100) exhibited decreased platelets. Direct blood smear examination revealed E. canis-like morulae within the monocytes of 4% (4/100) of the dogs and Babesia-suggestive merozoites in the erythrocytes of 2% (2/100) of the animals.
E. canis antibodies were detected in 34% (34/100) of the tested dogs, with titers ranging from 80 to ≥ 1280. Among the 100 tested dogs, 9, 6, 6, 3, and 10 had endpoint titers of 80, 160, 320, 640, and ≥ 1280, respectively. E. canis DNA was detected by qPCR in 25% (25/100) of the dogs. None of the qPCR-negative samples were positive according to the Ehrlichia genus-specific PCR, indicating the exclusive occurrence of E. canis in the studied population.
From the 100 canine samples examined, 10 yielded PCR amplicons for Babesia spp., which were confirmed by DNA sequencing. By BLAST analysis, the sequences obtained from the Babesia-specific PCR were shown to be 100% identical to available sequences from B. vogeli (JF825145.1, AY371196.1, EF052627.1, AY371195.1, and DQ297390.1). A partial sequence (18S rRNA) generated from one of the dogs was deposited into GenBank under the accession number KJ494656. None of the canine blood samples yielded amplicons in the Hepatozoon-specific PCR.
Age was revealed to be a risk factor for babesiosis (p = 0.007; odds ratio [OR] = 0.197; confidence interval [CI] 95% = 0.061-0.640; standard error [SE] = 0.601), with a higher frequency observed in the younger dogs (6-12 months, Table 1). A significant correlation was found between decreased platelets and B. vogeli occurrence (p = 0.01). Based on the serological results, the act of not vaccinating dogs was associated with an increased risk of ehrlichiosis (p = 0.007; OR = 3.921; 95% CI = 1.462–10.512; SE = 0.503). Based on the qPCR results, the females were 2,705 more likely to develop ehrlichiosis than the males (p = 0.041; 95% CI = 1.040-7.036; SE = 0.488).
Selected variables in univariate analysis associated with the Babesia spp.-specific PCR results for the dogs attended at the Veterinary Hospital of the Federal University of Campina Grande, Patos, Paraíba, Brazil.
The kappa index revealed fair agreement between the qPCR and IFA results in terms of E. canis diagnosis (p = 0.0037), i.e., 55% (55/100) of the dogs were negative according to qPCR and IFA, and 14% were positive according to both tests. The kappa value for both tests was 0.2619. Poor agreement was observed between the IFA and PCR (k = 0.03) and between the IFA and blood smears (k = 0.0741). The hematological disorders of anemia, leukopenia and thrombocytopenia showed statistically significant associations (p ≤ 0.05) with the qPCR results for E. canis.
From the 100 tick-harboring dogs, 1,151 ticks were collected, giving an overall mean infestation of 11.5 ticks/dog (range 1 – 34). Mean tick infestations were statistically similar (P >0.05) among positive and negative dogs for E. canis or B. vogeli, with mean values of 10.2 and 12.2 ticks/dog for E. canis serologically positive and negative dogs, respectively; 10.0 and 12.0 ticks/dog for E. canis-PCR positive and negative dogs, respectively; and 14.6 and 11.2 ticks/dog for B. canis-PCR positive and negative dogs, respectively.
Discussion
R. sanguineus was the only tick species found on the dogs evaluated in this study. According to Tanikawa et al. (2013)Tanikawa A, Labruna MB, Costa A, Aguiar DM, Justiniano SV, Mendes RS, et al. Ehrlichia canis in dogs in a semiarid region of Northeastern Brazil: serology, molecular detection and associated factors. Res Vet Sci 2013; 94(3): 474-477. http://dx.doi.org/10.1016/j.rvsc.2012.10.007. PMid:23141416
http://dx.doi.org/10.1016/j.rvsc.2012.10...
, the warm weather that occurs in the city of Patos, Paraiba State, which is located in the semiarid region of Northeastern Brazil, is an important factor contributing to the dissemination of this tick species, while at the same time precluding the establishment of many other tick species, which usually require higher moisture during their off-host developmental stages. R. sanguineus ticks are considered less dependent for survival upon moisture-rich habitats, allowing for their establishment in regions with unfavorable water balances (YODER et al., 2006Yoder JA, Benoit JB, Rellinger EJ, Tank JL. Developmental profiles in tick water balance with a focus on the new Rocky Mountain spotted fever vector, . Rhipicephalus sanguineusMed Vet Entomol 2006; 20(4): 365-372. http://dx.doi.org/10.1111/j.1365-2915.2006.00642.x. PMid:17199747
http://dx.doi.org/10.1111/j.1365-2915.20...
). This characteristic contributes to the establishment of these ticks in semi-arid regions, such as that of the present study.
IFA antibody titers for E. canis ranging from 80 to ≥ 1280 were found in 34% of the animals. A similar seroprevalence has been previously observed by Carlos et al. (2007)Carlos RSA, Muniz ES Na, Spagnol FH, Oliveira LLS, Brito RLL, Albuquerque GR, et al. Frequency of antibodies anti-Ehrlichia canis, and . Borrelia burgdorferiDirofilaria immitis antigens in dogs from microrregion Ilhéus-Itabuna, State of Bahia, BrazilRev Bras Parasitol Vet 2007; 16(3): 117-120. http://dx.doi.org/10.1590/S1984-29612007000300001. PMid:18078596
http://dx.doi.org/10.1590/S1984-29612007...
and Souza et al. (2010)Souza BMPS, Leal DC, Barboza DCPM, Uzêda RS, De Alcântara AC, Ferreira F, et al. Prevalence of ehrlichial infection among dogs and ticks in Northeastern Brazil. Rev Bras Parasitol Vet 2010; 19(2): 89-93. http://dx.doi.org/10.4322/rbpv.01902004. PMid:20624344
http://dx.doi.org/10.4322/rbpv.01902004...
in Northeastern Brazil. These high titers are consistent with prolonged infection and chronic antigenic stimulation (BARTSCH & GREENE, 1996Bartsch RC, Greene RT. Post-therapy antibody titers in dogs with ehrlichiosis: follow-up study on 68 patients treated primarily with tetracycline and/or doxycycline. J Vet Intern Med 1996; 10(4): 271-274. http://dx.doi.org/10.1111/j.1939-1676.1996.tb02061.x. PMid:8819054
http://dx.doi.org/10.1111/j.1939-1676.19...
).
E. canis DNA was detected by qPCR in 25% of the dogs. This prevalence is higher than those previously observed by Carvalho et al. (2008)Carvalho FS, Wenceslau AA, Carlos RSA, Albuquerque GR. Epidemiological and molecular study of in dogs in Bahia, Brazil. Ehrlichia canisGenet Mol Res 2008; 7(3): 657-662. http://dx.doi.org/10.4238/vol7-3gmr468. PMid:18752193
http://dx.doi.org/10.4238/vol7-3gmr468...
and Tanikawa et al. (2013)Tanikawa A, Labruna MB, Costa A, Aguiar DM, Justiniano SV, Mendes RS, et al. Ehrlichia canis in dogs in a semiarid region of Northeastern Brazil: serology, molecular detection and associated factors. Res Vet Sci 2013; 94(3): 474-477. http://dx.doi.org/10.1016/j.rvsc.2012.10.007. PMid:23141416
http://dx.doi.org/10.1016/j.rvsc.2012.10...
. The high sensitivity of qPCR (DOYLE et al., 2005Doyle CK, Labruna MB, Breitschwerdt EB, Tang YW, Corstvet RE, Hegarty BC, et al. Detection of medically important by quantitative multicolor TaqMan real-time polymerase chain reaction of the gene. EhrlichiadsbJ Mol Diagn 2005; 7(4): 504-510. http://dx.doi.org/10.1016/S1525-1578(10)60581-8. PMid:16237220
http://dx.doi.org/10.1016/S1525-1578(10)...
; HARRUS & WANER, 2011Harrus S, Waner T. Diagnosis of canine monocytotropic ehrlichiosis (): an overview. Ehrlichia canisVet J 2011; 187(3): 292-296. http://dx.doi.org/10.1016/j.tvjl.2010.02.001. PMid:20226700
http://dx.doi.org/10.1016/j.tvjl.2010.02...
) may explain this difference in comparing the present results with previous results based on conventional PCR. Furthermore, the selection of tick-harboring dogs may have contributed to the higher E. canis detection in our study.
According to Solano-Gallego et al. (2006)Solano-Gallego L, Llull J, Osso M, Hegarty B, Breitschwerdt E. A serological study of exposure to arthropod-borne pathogens in dogs from northeastern Spain. Vet Res 2006; 37(2): 231-244. http://dx.doi.org/10.1051/vetres:2005054. PMid:16472522
http://dx.doi.org/10.1051/vetres:2005054...
, epidemiological factors related to climatic conditions, vector distribution, population, animal behavior and habitat as well as the investigation methods used can affect the calculation of the prevalence of canine ehrlichiosis in Brazil. None of samples that were negative according to qPCR were positive according to the Ehrlichia genus-specific PCR, indicating the sole existence of E. canis in the studied population. At least four Ehrlichia species have been reported in Brazil: E. canis, infecting mainly dogs (VIEIRA et al., 2011Vieira RFC, Biondo AW, Guimarães AMS, Santos AP, Santos RP, Dutra LH, et al. Ehrlichiosis in Brazil. Rev Bras Parasitol Vet 2011; 20(1): 1-12. http://dx.doi.org/10.1590/S1984-29612011000100002. PMid:21439224
http://dx.doi.org/10.1590/S1984-29612011...
); E. ewingii infecting dogs (OLIVEIRA et al., 2009Oliveira LS, Oliveira KA, Mourão LC, Pescatore AM, Almeida MR, Conceição LG, et al. First report of detected by molecular investigation in dogs from Brazil. Ehrlichia ewingiiClin Microbiol Infect 2009;15(Suppl 2): 55-56. http://dx.doi.org/10.1111/j.1469-0691.2008.02635.x. PMid:19416280
http://dx.doi.org/10.1111/j.1469-0691.20...
), E. chaffeensis infecting deer (MACHADO et al., 2006Machado RZ, Duarte JM, Dagnone AS, Szabó MP. Detection of in Brazilian marsh deer (). Ehrlichia chaffeensisBlastocerus dichotomusVet Parasitol 2006; 139(1-3): 262-266. http://dx.doi.org/10.1016/j.vetpar.2006.02.038. PMid:16621285
http://dx.doi.org/10.1016/j.vetpar.2006....
), and E. mineirensis infecting cattle (CRUZ et al., 2012Cruz AC, Zweygarth E, Ribeiro MF, da Silveira JA, de la Fuente J, Grubhoffer L, et al. New species of Ehrlichia isolated from Rhipicephalus () shows an ortholog of the major immunogenic glycoprotein gp36 with a new sequence of tandem repeats. BoophilusmicroplusE. canisParasit Vectors 2012; 5(1): 291. http://dx.doi.org/10.1186/1756-3305-5-291. PMid:23231731
http://dx.doi.org/10.1186/1756-3305-5-29...
; AGUIAR et al., 2014Aguiar DM, Ziliani TF, Zhang X, Melo AL, Braga IA, Witter R, et al. A novel genotype strain distinguished by the TRP36 gene naturally infects cattle in Brazil and causes clinical manifestations associated with ehrlichiosis. EhrlichiaTicks Tick Borne Dis 2014; 5(5): 537-544. http://dx.doi.org/10.1016/j.ttbdis.2014.03.010. PMid:24915874
http://dx.doi.org/10.1016/j.ttbdis.2014....
); however, only E. canis has been reported in the Northeast region (SOUZA et al., 2010Souza BMPS, Leal DC, Barboza DCPM, Uzêda RS, De Alcântara AC, Ferreira F, et al. Prevalence of ehrlichial infection among dogs and ticks in Northeastern Brazil. Rev Bras Parasitol Vet 2010; 19(2): 89-93. http://dx.doi.org/10.4322/rbpv.01902004. PMid:20624344
http://dx.doi.org/10.4322/rbpv.01902004...
, VIEIRA et al., 2011Vieira RFC, Biondo AW, Guimarães AMS, Santos AP, Santos RP, Dutra LH, et al. Ehrlichiosis in Brazil. Rev Bras Parasitol Vet 2011; 20(1): 1-12. http://dx.doi.org/10.1590/S1984-29612011000100002. PMid:21439224
http://dx.doi.org/10.1590/S1984-29612011...
), which is likely related to the higher occurrence of the tick R. sanguineus in this region.
In 20% (20/100) of the samples, E. canis antibodies were detected by the IFA test in the absence of DNA amplification by qPCR. The IFA test as an additional serological method can generate false-positive results; furthermore, it does not differentiate active infection from previous exposure to an organism (VIEIRA et al., 2011Vieira RFC, Biondo AW, Guimarães AMS, Santos AP, Santos RP, Dutra LH, et al. Ehrlichiosis in Brazil. Rev Bras Parasitol Vet 2011; 20(1): 1-12. http://dx.doi.org/10.1590/S1984-29612011000100002. PMid:21439224
http://dx.doi.org/10.1590/S1984-29612011...
). In addition, anti-E. canis antibodies can persist and be detected after healing. On the other hand, the ability of conventional PCR to detect Ehrlichia DNA in seropositive dogs depends on the sample source and target gene (HARRUS et al., 2004Harrus S, Kenny M, Miara L, Aizenberg I, Waner T, Shaw S. Comparison of simultaneous splenic sample PCR with blood sample PCR for diagnosis and treatment of experimental Ehrlichia canis infection. Antimicrob Agents Chemother 2004; 48(11): 4488-4490. http://dx.doi.org/10.1128/AAC.48.11.4488-4490.2004. PMid:15504892
http://dx.doi.org/10.1128/AAC.48.11.4488...
). The ability of qPCR to detect ehrlichial DNA, indicating active infection, rather than detecting an anti-E. canis antibody, which is suggestive of exposure, constitutes an advantage that allows for clinicians to better monitor treatment progress (HARRUS & WANER, 2011Harrus S, Waner T. Diagnosis of canine monocytotropic ehrlichiosis (): an overview. Ehrlichia canisVet J 2011; 187(3): 292-296. http://dx.doi.org/10.1016/j.tvjl.2010.02.001. PMid:20226700
http://dx.doi.org/10.1016/j.tvjl.2010.02...
).
These results demonstrate that CME is endemic in the city of Patos, suggesting either previous exposure to the agent or the presence of active infection. Hence, this disease must be included as a part of the differential diagnosis in routine veterinary care in this locality and considered as a public health issue. Some E. canis strains are capable of infecting humans (PEREZ et al., 2006Perez M, Bodor M, Zhang C, Xiong Q, Rikihisa Y. Human infection with accompanied by clinical signs in Venezuela. Ehrlichia canisAnn N Y Acad Sci 2006; 1078(1): 110-117. http://dx.doi.org/10.1196/annals.1374.016. PMid:17114689
http://dx.doi.org/10.1196/annals.1374.01...
), and although it is unusual, the parasitism of humans by R. sanguineus has been described (DANTAS-TORRES, et al., 2006Dantas-Torres F, Figueredo LA, Brandão-Filho SP. (Acari: Ixodidae), the brown dog tick, parasitizing humans in Brazil. Rhipicephalus sanguineusRev Soc Bras Med Trop 2006; 39(1): 64-67. http://dx.doi.org/10.1590/S0037-86822006000100012. PMid:16501769
http://dx.doi.org/10.1590/S0037-86822006...
).
Out of the samples analyzed for E. canis, 55% (55/100) were qPCR and IFA negative, and 14% were positive by both tests. The kappa value (k = 0.2619) showed fair agreement between these two tests, with a significant p-value (p = 0.0037), indicating the lack of a significant difference between the two techniques. Poor agreement was observed between the IFA and PCR and blood smear tests (k = 0.03 and k = 0.0741, respectively). This can be attributed to the poor sensitivity of the cytology test, which was successful in only 4% of the cases and has been shown to be more sensitive during the acute phase of infection (WOODY & HOSKINS, 1991Woody BJ, Hoskins JD. Ehrlichial diseases of dogs. Vet Clin North Am Small Anim Pract 1991; 21(1): 75-98. http://dx.doi.org/10.1016/S0195-5616(91)50009-7. PMid:2014630
http://dx.doi.org/10.1016/S0195-5616(91)...
). Furthermore, false positives can occur if morulae are misidentified as platelets, lymphocytic azurophilic granules or nuclear phagocytosed material (BREITSCHWERDT et al., 1998Breitschwerdt EB, Hegarty BC, Hancock SI. Sequential evaluation of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeensis, , , or . Ehrlichia equiEhrlichia ewingiiBartonella vinsoniiJ Clin Microbiol 1998; 36(9): 2645-2651. PMid:9705408.).
Based on the serological results, the non-vaccination of dogs was considered a risk factor for ehrlichiosis (Table 2). Although commercial canine vaccines for different bacterial and viral diseases do not specifically protect dogs against E. canis, in general, immunization against the main dog diseases promotes good health and prevents the immune decline that increases vulnerability to ehrlichiosis. Furthermore, the simple act of vaccinating is reflective of a careful owner who is attentive to their dog's well-being, likely resulting in the less frequent exposure of the animal to ticks, and consequently, to ehrlichial infection.
Selected variables in univariate analysis associated with the Ehrlichia canis-specific IFA and PCR results for the dogs attended at the Veterinary Hospital of the Federal University of Campina Grande, Patos, Paraíba, Brazil.
The qPCR results revealed that the females were 2.705 more likely to develop the disease than the males (p = 0.041). No correlation has been found between the gender of the dog and disease occurrence by Carvalho et al. (2008)Carvalho FS, Wenceslau AA, Carlos RSA, Albuquerque GR. Epidemiological and molecular study of in dogs in Bahia, Brazil. Ehrlichia canisGenet Mol Res 2008; 7(3): 657-662. http://dx.doi.org/10.4238/vol7-3gmr468. PMid:18752193
http://dx.doi.org/10.4238/vol7-3gmr468...
and Santos et al. (2013)Santos LGF, Melo ALT, Moraes-Filho J, Witter R, Labruna MB, Aguiar DM. Molecular detection of Ehrlichia in dogs from the Pantanal of Mato Grosso State, Brazil. canisRev Bras Parasitol Vet 2013; 22(1): 114-118. http://dx.doi.org/10.1590/S1984-29612013005000013. PMid:23538496
http://dx.doi.org/10.1590/S1984-29612013...
. The processes of estrus and parturition that occur in females lead to immune system depression. This could explain the vulnerability of this gender to ehrlichiosis. The hematological disorders of anemia, leukopenia and thrombocytopenia showed statistically significant associations (p ≤ 0.05) to E. canis-positive qPCR results. Bulla et al. (2004)Bulla C, Takahira RK, Araújo JP Jr, Trinca LA, Lopes RS, Wiedmeyer CE. The relationship between the degree of thrombocytopenia and infection with in an endemic area. Ehrlichia canisVet Res 2004; 35(1): 141-146. http://dx.doi.org/10.1051/vetres:2003038. PMid:15099511
http://dx.doi.org/10.1051/vetres:2003038...
and Dagnone et al. (2003)Dagnone AS, de Morais HS, Vidotto MC, Jojima FS, Vidotto O. Ehrlichiosis in anemic, thrombocytopenic, or tick-infested dogs from a hospital population in South Brazil. Vet Parasitol 2003; 117(4): 285-290. http://dx.doi.org/10.1016/j.vetpar.2003.10.001. PMid:14637030
http://dx.doi.org/10.1016/j.vetpar.2003....
have recommended that ehrlichiosis should be included in the differential diagnosis of anemic and thrombocytopenic dogs.
Out of the 100 canine samples examined, 10 yielded PCR amplicons for Babesia spp., which were confirmed as B. vogeli by DNA sequencing. This is the first report of B. vogeli in dogs from Paraiba State, and the frequency of positive animals obtained (10%, 10/100) is higher than that reported by Ramos et al. (2010)Ramos R, Ramos C, Araújo F, Oliveira R, Souza I, Pimentel D, et al. Molecular survey and genetic characterization of tick-borne pathogens in dogs in metropolitan Recife (north-eastern Brazil). Parasitol Res 2010; 107(5): 1115-1120. http://dx.doi.org/10.1007/s00436-010-1979-7. PMid:20680344
http://dx.doi.org/10.1007/s00436-010-197...
in another area of Northeastern Brazil. This higher frequency could be related to the fact that all sampled dogs were from areas where they had probably been exposed to R. sanguineus, since all of them were infested by this tick species when they were sampled for this study.
Age was considered a risk factor for babesiosis (p = 0.007), with a higher frequency observed in the younger dogs. According to Brown et al. (2006)Brown GK, Canfield PJ, Dunstan RH, Roberts TK, Martin AR, Brown CS, et al. Detection of and and their impact on platelet numbers in free-roaming dogs associated with remote Aboriginal communities in Australia. Anaplasma platysBabesia canis vogeliAust Vet J 2006; 84(9): 321-325. http://dx.doi.org/10.1111/j.1751-0813.2006.00029.x. PMid:16958629
http://dx.doi.org/10.1111/j.1751-0813.20...
, young dogs that have been weaned are particularly likely to be exposed to concomitant diseases because malnourishment due to a scavenging lifestyle greatly predisposes these animals to infection. A significant correlation was observed between a decrease in platelets and B. vogeli (p = 0.01) occurrence, which has been previously reported by Santos et al. (2009)Santos F, Coppede JS, Pereira AL, Oliveira LP, Roberto PG, Benedetti RB, et al. Molecular evaluation of the incidence of Ehrlichia canis, Anaplasma platys and spp. in dogs from Ribeirão Preto, Brazil. BabesiaVet J 2009; 179(1): 145-148. http://dx.doi.org/10.1016/j.tvjl.2007.08.017. PMid:17920967
http://dx.doi.org/10.1016/j.tvjl.2007.08...
and Brown et al. (2006)Brown GK, Canfield PJ, Dunstan RH, Roberts TK, Martin AR, Brown CS, et al. Detection of and and their impact on platelet numbers in free-roaming dogs associated with remote Aboriginal communities in Australia. Anaplasma platysBabesia canis vogeliAust Vet J 2006; 84(9): 321-325. http://dx.doi.org/10.1111/j.1751-0813.2006.00029.x. PMid:16958629
http://dx.doi.org/10.1111/j.1751-0813.20...
. The mechanism of platelet damage by B. vogeli is poorly understood. In human chronic babesial infections, it has been suggested that spleen enlargement results in an increase in the pooling of platelets, diminishing circulating thrombocytes (PANTANOWITZ, 2002Pantanowitz L. Mechanisms of thrombocytopenia in tick-borne diseases. IJID 2002; 2(2): 291-298.).
None of tested samples was positive for Hepatozoon spp., as determined by PCR. This could be attributed to the fact that R. sanguineus was the sole tick found on the studied animals. R. sanguineus is considered to be the main H. canis vector in the Old World (BANETH et al., 2007Baneth G, Samish M, Shkap V. Life cycle of Hepatozoon canis (Apicomplexa: Adeleorina: Hepatozoidae) in the tick Rhipicephalus sanguineus and domestic dog (). Canis familiarisJ Parasitol 2007; 93(2): 283-299. http://dx.doi.org/10.1645/GE-494R.1. PMid:17539411
http://dx.doi.org/10.1645/GE-494R.1...
), and its presence on dogs has been associated with pathogen infection (SPOLIDORIO et al., 2009Spolidorio MG, Labruna MB, Zago AM, Donatele DM, Caliari KM, Yoshinari NH. infecting dogs in the State of Espírito Santo, southeastern Brazil. Hepatozoon canisVet Parasitol 2009; 163(4): 357-361. http://dx.doi.org/10.1016/j.vetpar.2009.05.002. PMid:19482427
http://dx.doi.org/10.1016/j.vetpar.2009....
). However, until now, there is no report of R. sanguineus naturally or experimentally infected with H. canis in Brazil (FORLANO et al., 2005Forlano M, Scofield A, Elisei C, Fernandes KR, Ewing SA, Massard CL. Diagnosis of Hepatozoon spp. in and its experimental transmission in domestic dogs in Brazil. Amblyomma ovaleVet Parasitol 2005; 134(1-2): 1-7. http://dx.doi.org/10.1016/j.vetpar.2005.05.066. PMid:16081219
http://dx.doi.org/10.1016/j.vetpar.2005....
; SPOLIDORIO et al., 2009Spolidorio MG, Labruna MB, Zago AM, Donatele DM, Caliari KM, Yoshinari NH. infecting dogs in the State of Espírito Santo, southeastern Brazil. Hepatozoon canisVet Parasitol 2009; 163(4): 357-361. http://dx.doi.org/10.1016/j.vetpar.2009.05.002. PMid:19482427
http://dx.doi.org/10.1016/j.vetpar.2009....
; DEMONER et al., 2013Demoner LC, Rubini AS, Paduan KS, Metzger B, Antunes JMP, Martins TF, et al. Investigation of tick vectors of in Brazil. Hepatozoon canisTicks Tick Borne Dis 2013; 4(6): 542-546. http://dx.doi.org/10.1016/j.ttbdis.2013.07.006. PMid:24209494
http://dx.doi.org/10.1016/j.ttbdis.2013....
). These negative results could be related to the different susceptibilities of R. sanguineus populations to H. canis because it has been shown that the taxon R. sanguineus is represented by at least two different species in Latin America (MORAES-FILHO et al., 2011Moraes-Filho J, Marcili A, Nieri-Bastos FA, Richtzenhain LJ, Labruna MB. Genetic analysis of ticks belonging to the group in Latin America. Rhipicephalus sanguineusActa Trop 2011; 117(1): 51-55. http://dx.doi.org/10.1016/j.actatropica.2010.09.006. PMid:20858451
http://dx.doi.org/10.1016/j.actatropica....
).
PCR revealed that three animals possessed co-infection with E. canis and B. vogeli. This co-infection, which has been reported elsewhere (SANTOS et. al., 2009Santos F, Coppede JS, Pereira AL, Oliveira LP, Roberto PG, Benedetti RB, et al. Molecular evaluation of the incidence of Ehrlichia canis, Anaplasma platys and spp. in dogs from Ribeirão Preto, Brazil. BabesiaVet J 2009; 179(1): 145-148. http://dx.doi.org/10.1016/j.tvjl.2007.08.017. PMid:17920967
http://dx.doi.org/10.1016/j.tvjl.2007.08...
; RAMOS et al., 2010Ramos R, Ramos C, Araújo F, Oliveira R, Souza I, Pimentel D, et al. Molecular survey and genetic characterization of tick-borne pathogens in dogs in metropolitan Recife (north-eastern Brazil). Parasitol Res 2010; 107(5): 1115-1120. http://dx.doi.org/10.1007/s00436-010-1979-7. PMid:20680344
http://dx.doi.org/10.1007/s00436-010-197...
), occurs because these pathogens share the same vector, the brown dog tick R. sanguineus, which was predominant in the animals evaluated in this study.
Conclusions
The results from the present study revealed that E. canis was the main tick-borne pathogen of dogs in Patos and showed that B. vogeli is an important hemoparasite that should be included in the differential diagnosis performed by veterinary medical professionals. These findings are very important for the understanding of the epidemiology of tick-borne pathogens of domestic dogs in this semiarid region of Brazil.
Acknowledgments
This study was supported by the National Council for Scientific and Technological Development (CNPq).
References
- Aguiar DM, Saito TB, Hagiwara MK, Machado RZ, Labruna MB. Serological diagnosis of canine monocytic ehrlichiosis with Brazilian antigen of Ehrlichia canis.Ciênc Rural 2007; 37(3): 796-802. http://dx.doi.org/10.1590/S0103-84782007000300030.
» http://dx.doi.org/10.1590/S0103-84782007000300030 - Aguiar DM, Ziliani TF, Zhang X, Melo AL, Braga IA, Witter R, et al. A novel genotype strain distinguished by the TRP36 gene naturally infects cattle in Brazil and causes clinical manifestations associated with ehrlichiosis. EhrlichiaTicks Tick Borne Dis 2014; 5(5): 537-544. http://dx.doi.org/10.1016/j.ttbdis.2014.03.010. PMid:24915874
» http://dx.doi.org/10.1016/j.ttbdis.2014.03.010 - Almeida AP, Marcili A, Leite RC, Nieri-Bastos FA, Domingues LN, Martins JR, et al. Coxiella symbiont in the tick (Acari: Argasidae). Ornithodoros rostratusTicks Tick Borne Dis 2012; 3(4): 203-206. http://dx.doi.org/10.1016/j.ttbdis.2012.02.003. PMid:22480930
» http://dx.doi.org/10.1016/j.ttbdis.2012.02.003 - Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990; 215(3): 403-410. http://dx.doi.org/10.1016/S0022-2836(05)80360-2. PMid:2231712
» http://dx.doi.org/10.1016/S0022-2836(05)80360-2 - Baneth G, Barta JR, Shkap V, Martin DS, Macintire DK, Vincent-Johnson N. Genetic and antigenic evidence supports the separation of Hepatozoon canis and at the species level. Hepatozoon americanumJ Clin Microbiol 2000; 38(3): 1298-1301. PMid:10699047.
- Baneth G, Samish M, Shkap V. Life cycle of Hepatozoon canis (Apicomplexa: Adeleorina: Hepatozoidae) in the tick Rhipicephalus sanguineus and domestic dog (). Canis familiarisJ Parasitol 2007; 93(2): 283-299. http://dx.doi.org/10.1645/GE-494R.1. PMid:17539411
» http://dx.doi.org/10.1645/GE-494R.1 - Barros-Battesti DM, Arzua M, Bechara GH. Carrapatos de Importância Médico-Veterinária da Região Neotropical: um guia ilustrado para identificação de espécies. São Paulo: Instituto Butatan; 2006.
- Bartsch RC, Greene RT. Post-therapy antibody titers in dogs with ehrlichiosis: follow-up study on 68 patients treated primarily with tetracycline and/or doxycycline. J Vet Intern Med 1996; 10(4): 271-274. http://dx.doi.org/10.1111/j.1939-1676.1996.tb02061.x. PMid:8819054
» http://dx.doi.org/10.1111/j.1939-1676.1996.tb02061.x - Breitschwerdt EB, Hegarty BC, Hancock SI. Sequential evaluation of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeensis, , , or . Ehrlichia equiEhrlichia ewingiiBartonella vinsoniiJ Clin Microbiol 1998; 36(9): 2645-2651. PMid:9705408.
- Brown GK, Canfield PJ, Dunstan RH, Roberts TK, Martin AR, Brown CS, et al. Detection of and and their impact on platelet numbers in free-roaming dogs associated with remote Aboriginal communities in Australia. Anaplasma platysBabesia canis vogeliAust Vet J 2006; 84(9): 321-325. http://dx.doi.org/10.1111/j.1751-0813.2006.00029.x. PMid:16958629
» http://dx.doi.org/10.1111/j.1751-0813.2006.00029.x - Bulla C, Takahira RK, Araújo JP Jr, Trinca LA, Lopes RS, Wiedmeyer CE. The relationship between the degree of thrombocytopenia and infection with in an endemic area. Ehrlichia canisVet Res 2004; 35(1): 141-146. http://dx.doi.org/10.1051/vetres:2003038. PMid:15099511
» http://dx.doi.org/10.1051/vetres:2003038 - Carlos RSA, Muniz ES Na, Spagnol FH, Oliveira LLS, Brito RLL, Albuquerque GR, et al. Frequency of antibodies anti-Ehrlichia canis, and . Borrelia burgdorferiDirofilaria immitis antigens in dogs from microrregion Ilhéus-Itabuna, State of Bahia, BrazilRev Bras Parasitol Vet 2007; 16(3): 117-120. http://dx.doi.org/10.1590/S1984-29612007000300001. PMid:18078596
» http://dx.doi.org/10.1590/S1984-29612007000300001 - Carvalho FS, Wenceslau AA, Carlos RSA, Albuquerque GR. Epidemiological and molecular study of in dogs in Bahia, Brazil. Ehrlichia canisGenet Mol Res 2008; 7(3): 657-662. http://dx.doi.org/10.4238/vol7-3gmr468. PMid:18752193
» http://dx.doi.org/10.4238/vol7-3gmr468 - Cruz AC, Zweygarth E, Ribeiro MF, da Silveira JA, de la Fuente J, Grubhoffer L, et al. New species of Ehrlichia isolated from Rhipicephalus () shows an ortholog of the major immunogenic glycoprotein gp36 with a new sequence of tandem repeats. BoophilusmicroplusE. canisParasit Vectors 2012; 5(1): 291. http://dx.doi.org/10.1186/1756-3305-5-291. PMid:23231731
» http://dx.doi.org/10.1186/1756-3305-5-291 - Dagnone AS, de Morais HS, Vidotto MC, Jojima FS, Vidotto O. Ehrlichiosis in anemic, thrombocytopenic, or tick-infested dogs from a hospital population in South Brazil. Vet Parasitol 2003; 117(4): 285-290. http://dx.doi.org/10.1016/j.vetpar.2003.10.001. PMid:14637030
» http://dx.doi.org/10.1016/j.vetpar.2003.10.001 - Dantas-Torres F, Figueredo LA, Brandão-Filho SP. (Acari: Ixodidae), the brown dog tick, parasitizing humans in Brazil. Rhipicephalus sanguineusRev Soc Bras Med Trop 2006; 39(1): 64-67. http://dx.doi.org/10.1590/S0037-86822006000100012. PMid:16501769
» http://dx.doi.org/10.1590/S0037-86822006000100012 - Dantas-Torres F. The brown dog tick, (Latreille, 1806) (Acari: Ixodidae): from taxonomy to control. Rhipicephalus sanguineusVet Parasitol 2008; 152(3-4): 173-185. http://dx.doi.org/10.1016/j.vetpar.2007.12.030. PMid:18280045
» http://dx.doi.org/10.1016/j.vetpar.2007.12.030 - Demoner LC, Rubini AS, Paduan KS, Metzger B, Antunes JMP, Martins TF, et al. Investigation of tick vectors of in Brazil. Hepatozoon canisTicks Tick Borne Dis 2013; 4(6): 542-546. http://dx.doi.org/10.1016/j.ttbdis.2013.07.006. PMid:24209494
» http://dx.doi.org/10.1016/j.ttbdis.2013.07.006 - Doyle CK, Labruna MB, Breitschwerdt EB, Tang YW, Corstvet RE, Hegarty BC, et al. Detection of medically important by quantitative multicolor TaqMan real-time polymerase chain reaction of the gene. EhrlichiadsbJ Mol Diagn 2005; 7(4): 504-510. http://dx.doi.org/10.1016/S1525-1578(10)60581-8. PMid:16237220
» http://dx.doi.org/10.1016/S1525-1578(10)60581-8 - Forlano M, Scofield A, Elisei C, Fernandes KR, Ewing SA, Massard CL. Diagnosis of Hepatozoon spp. in and its experimental transmission in domestic dogs in Brazil. Amblyomma ovaleVet Parasitol 2005; 134(1-2): 1-7. http://dx.doi.org/10.1016/j.vetpar.2005.05.066. PMid:16081219
» http://dx.doi.org/10.1016/j.vetpar.2005.05.066 - Gal A, Loeb E, Yisaschar-Mekuzas Y, Baneth G. Detection of by PCR in different tissues obtained during necropsy from dogs surveyed for naturally occurring canine monocytic ehrlichiosis. Ehrlichia canisVet J 2008; 175(2): 212-217. http://dx.doi.org/10.1016/j.tvjl.2007.01.013. PMid:17368942
» http://dx.doi.org/10.1016/j.tvjl.2007.01.013 - Harrus S, Kenny M, Miara L, Aizenberg I, Waner T, Shaw S. Comparison of simultaneous splenic sample PCR with blood sample PCR for diagnosis and treatment of experimental Ehrlichia canis infection. Antimicrob Agents Chemother 2004; 48(11): 4488-4490. http://dx.doi.org/10.1128/AAC.48.11.4488-4490.2004. PMid:15504892
» http://dx.doi.org/10.1128/AAC.48.11.4488-4490.2004 - Harrus S, Waner T. Diagnosis of canine monocytotropic ehrlichiosis (): an overview. Ehrlichia canisVet J 2011; 187(3): 292-296. http://dx.doi.org/10.1016/j.tvjl.2010.02.001. PMid:20226700
» http://dx.doi.org/10.1016/j.tvjl.2010.02.001 - Hosmer DW, Lemeshow S. Applied Logistic Regression. New York: Wiley; 1989.
- Irwin PJ. Canine babesiosis: from molecular taxonomy to control. Parasit Vectors 2009;2(Suppl 1): S4. http://dx.doi.org/10.1186/1756-3305-2-S1-S4. PMid:19426443
» http://dx.doi.org/10.1186/1756-3305-2-S1-S4 - Jain NC. Essentials of veterinary hematology. Philadelphia: Lea & Febiger; 1993.
- Krawczak FS, Labruna MB, Sangioni LA, Vogel FSF, Soares JF, Lopes STDA. Serological survey on Ehrlichia sp. among dogs in the central region of Rio Grande do Sul. Rev Bras Parasitol Vet 2012; 21(4): 415-417. http://dx.doi.org/10.1590/S1984-29612012005000001. PMid:23184320
» http://dx.doi.org/10.1590/S1984-29612012005000001 - Labruna MB, McBride JW, Camargo LM, Aguiar DM, Yabsley MJ, Davidson WR, et al. A preliminary investigation of species in ticks, humans, dogs, and capybaras from Brazil. EhrlichiaVet Parasitol 2007; 143(2): 189-195. http://dx.doi.org/10.1016/j.vetpar.2006.08.005. PMid:16962245
» http://dx.doi.org/10.1016/j.vetpar.2006.08.005 - Machado RZ, Duarte JM, Dagnone AS, Szabó MP. Detection of in Brazilian marsh deer (). Ehrlichia chaffeensisBlastocerus dichotomusVet Parasitol 2006; 139(1-3): 262-266. http://dx.doi.org/10.1016/j.vetpar.2006.02.038. PMid:16621285
» http://dx.doi.org/10.1016/j.vetpar.2006.02.038 - Moraes-Filho J, Marcili A, Nieri-Bastos FA, Richtzenhain LJ, Labruna MB. Genetic analysis of ticks belonging to the group in Latin America. Rhipicephalus sanguineusActa Trop 2011; 117(1): 51-55. http://dx.doi.org/10.1016/j.actatropica.2010.09.006. PMid:20858451
» http://dx.doi.org/10.1016/j.actatropica.2010.09.006 - Murata T, Shiramizu K, Hara Y, Inoue M, Shimoda K, Nakama S. First case of Hepatozoon canis infection of a dog in Japan. J Vet Med Sci 1991; 53(6): 1097-1099. http://dx.doi.org/10.1292/jvms.53.1097. PMid:1790224
» http://dx.doi.org/10.1292/jvms.53.1097 - Oliveira LS, Oliveira KA, Mourão LC, Pescatore AM, Almeida MR, Conceição LG, et al. First report of detected by molecular investigation in dogs from Brazil. Ehrlichia ewingiiClin Microbiol Infect 2009;15(Suppl 2): 55-56. http://dx.doi.org/10.1111/j.1469-0691.2008.02635.x. PMid:19416280
» http://dx.doi.org/10.1111/j.1469-0691.2008.02635.x - Pantanowitz L. Mechanisms of thrombocytopenia in tick-borne diseases. IJID 2002; 2(2): 291-298.
- Passos LM, Geiger SM, Ribeiro MF, Pfister K, Zahler-Rinder M. First molecular detection of in dogs from Brazil. Babesia vogeliVet Parasitol 2005; 127(1): 81-85. http://dx.doi.org/10.1016/j.vetpar.2004.07.028. PMid:15619377
» http://dx.doi.org/10.1016/j.vetpar.2004.07.028 - Perez M, Bodor M, Zhang C, Xiong Q, Rikihisa Y. Human infection with accompanied by clinical signs in Venezuela. Ehrlichia canisAnn N Y Acad Sci 2006; 1078(1): 110-117. http://dx.doi.org/10.1196/annals.1374.016. PMid:17114689
» http://dx.doi.org/10.1196/annals.1374.016 - Ramos R, Ramos C, Araújo F, Oliveira R, Souza I, Pimentel D, et al. Molecular survey and genetic characterization of tick-borne pathogens in dogs in metropolitan Recife (north-eastern Brazil). Parasitol Res 2010; 107(5): 1115-1120. http://dx.doi.org/10.1007/s00436-010-1979-7. PMid:20680344
» http://dx.doi.org/10.1007/s00436-010-1979-7 - Santos F, Coppede JS, Pereira AL, Oliveira LP, Roberto PG, Benedetti RB, et al. Molecular evaluation of the incidence of Ehrlichia canis, Anaplasma platys and spp. in dogs from Ribeirão Preto, Brazil. BabesiaVet J 2009; 179(1): 145-148. http://dx.doi.org/10.1016/j.tvjl.2007.08.017. PMid:17920967
» http://dx.doi.org/10.1016/j.tvjl.2007.08.017 - Santos LGF, Melo ALT, Moraes-Filho J, Witter R, Labruna MB, Aguiar DM. Molecular detection of Ehrlichia in dogs from the Pantanal of Mato Grosso State, Brazil. canisRev Bras Parasitol Vet 2013; 22(1): 114-118. http://dx.doi.org/10.1590/S1984-29612013005000013. PMid:23538496
» http://dx.doi.org/10.1590/S1984-29612013005000013 - Solano-Gallego L, Llull J, Osso M, Hegarty B, Breitschwerdt E. A serological study of exposure to arthropod-borne pathogens in dogs from northeastern Spain. Vet Res 2006; 37(2): 231-244. http://dx.doi.org/10.1051/vetres:2005054. PMid:16472522
» http://dx.doi.org/10.1051/vetres:2005054 - Souza BMPS, Leal DC, Barboza DCPM, Uzêda RS, De Alcântara AC, Ferreira F, et al. Prevalence of ehrlichial infection among dogs and ticks in Northeastern Brazil. Rev Bras Parasitol Vet 2010; 19(2): 89-93. http://dx.doi.org/10.4322/rbpv.01902004. PMid:20624344
» http://dx.doi.org/10.4322/rbpv.01902004 - Spolidorio MG, Labruna MB, Zago AM, Donatele DM, Caliari KM, Yoshinari NH. infecting dogs in the State of Espírito Santo, southeastern Brazil. Hepatozoon canisVet Parasitol 2009; 163(4): 357-361. http://dx.doi.org/10.1016/j.vetpar.2009.05.002. PMid:19482427
» http://dx.doi.org/10.1016/j.vetpar.2009.05.002 - Spolidorio MG, Torres MM, Campos WN, Melo AL, Igarashi M, Amude AM, et al. Molecular detection of and in domestic dogs from Cuiabá, Brazil. Hepatozoon canisBabesia canis vogeliRev Bras Parasitol Vet 2011; 20(3): 253-255. http://dx.doi.org/10.1590/S1984-29612011000300015. PMid:21961759
» http://dx.doi.org/10.1590/S1984-29612011000300015 - Tanikawa A, Labruna MB, Costa A, Aguiar DM, Justiniano SV, Mendes RS, et al. Ehrlichia canis in dogs in a semiarid region of Northeastern Brazil: serology, molecular detection and associated factors. Res Vet Sci 2013; 94(3): 474-477. http://dx.doi.org/10.1016/j.rvsc.2012.10.007. PMid:23141416
» http://dx.doi.org/10.1016/j.rvsc.2012.10.007 - Thursfield M. Veterinary Epidemiology. Oxford: Wiley Blackwell; 2007.
- Trapp SM, Dagnone AS, Vidotto O, Freire RL, Amude AM, de Morais HS. Seroepidemiology of canine babesiosis and ehrlichiosis in a hospital population. Vet Parasitol 2006; 140(3-4): 223-230. http://dx.doi.org/10.1016/j.vetpar.2006.03.030. PMid:16647817
» http://dx.doi.org/10.1016/j.vetpar.2006.03.030 - Vieira RFC, Biondo AW, Guimarães AMS, Santos AP, Santos RP, Dutra LH, et al. Ehrlichiosis in Brazil. Rev Bras Parasitol Vet 2011; 20(1): 1-12. http://dx.doi.org/10.1590/S1984-29612011000100002. PMid:21439224
» http://dx.doi.org/10.1590/S1984-29612011000100002 - Woody BJ, Hoskins JD. Ehrlichial diseases of dogs. Vet Clin North Am Small Anim Pract 1991; 21(1): 75-98. http://dx.doi.org/10.1016/S0195-5616(91)50009-7. PMid:2014630
» http://dx.doi.org/10.1016/S0195-5616(91)50009-7 - Yoder JA, Benoit JB, Rellinger EJ, Tank JL. Developmental profiles in tick water balance with a focus on the new Rocky Mountain spotted fever vector, . Rhipicephalus sanguineusMed Vet Entomol 2006; 20(4): 365-372. http://dx.doi.org/10.1111/j.1365-2915.2006.00642.x. PMid:17199747
» http://dx.doi.org/10.1111/j.1365-2915.2006.00642.x
Publication Dates
-
Publication in this collection
Jan-Mar 2015
History
-
Received
17 Oct 2014 -
Accepted
17 Nov 2014