Identification of Eimeria spp. in domestic chickens raised in alternative poultry production systems in the State of São Paulo, Brazil

Identificação de Eimeria spp. em galinhas domésticas criadas em sistemas de produção alternativos no estado de São Paulo, Brasil

Abstract

The objective of this study was to identify Eimeria spp. in alternative poultry production systems (APPS) in the State of São Paulo, Brazil. Fecal samples (168) and DNA extracted from fecal samples obtained in APPS located in different Municipalities in the State of São Paulo (93) were examined by microscopy or genera-specific PCR (ITS-1 locus). Samples positive for Eimeria spp. were examined using Eimeria lata, Eimeria nagambie, and Eimeria zaria species-specific PCR protocols (ITS-2 locus) and another E. lata-specific PCR (candidate IMP1 genomic locus) followed by molecular cloning (E. lata and E. zaria ITS-2 amplicons) and genetic sequencing. All positive DNA samples were also submitted to genera-specific nested PCR (18S rRNA gene) followed by next-generation sequencing to identify Eimeria spp. Eimeria nagambie, E. zaria, and Eimeria sp. were identified by ITS2-targeted species-specific PCRs and genetic sequencing. Next-generation sequencing identified, in order of prevalence: E. nagambie; Eimeria acervulina; Eimeria mivati; Eimeria praecox; Eimeria brunetti; Eimeria mitis; Eimeria sp.; Eimeria maxima; E. zaria, and Eimeria necatrix/tenella. Our results confirmed, for the first time in Brazil, the identification of E. nagambie, E. zaria, and Eimeria spp. ITS-2 and 18S rRNA gene sequences not yet described in Brazil.

Keywords:
Coccidiosis; poultry; molecular diagnosis; next generation sequencing

Resumo

O objetivo deste trabalho foi identificar Eimeria spp. em galinhas domésticas criadas em sistemas de criação alternativos (SCA). Foram utilizadas 93 amostras de DNA e 168 amostras de fezes de galinhas provenientes de SCA, localizados em 17 municípios do estado de São Paulo. As amostras foram examinadas por microscopia ou PCR gênero-específica (locus ITS-1); aquelas positivas foram examinadas por PCRs espécie-específicas para Eimeria lata, Eimeria nagambie e Eimeria zaria (locus ITS-2), seguidas de clonagem (E. lata e E. zaria) e sequenciamento genético, e por outro protocolo de PCR específico para E. lata (locus IMP1). Adicionalmente, as mesmas amostras foram submetidas à nested PCR gênero-específica (gene 18S rRNA), seguida de sequenciamento de nova geração para identificação de Eimeria spp. Eimeria nagambie, E. zaria e Eimeria sp. foram identificadas pela PCR espécie-específica e sequenciamento genético. O sequenciamento de nova geração identificou, em ordem de prevalência: E. nagambie, Eimeria acervulina, Eimeria mivati, Eimeria praecox, Eimeria brunetti, Eimeria mitis, Eimeria sp., Eimeria maxima, E. zaria e Eimeria necatrix/tenella. Os resultados observados confirmaram, pela primeira vez no Brasil, a identificação de E. nagambie, E. zaria e de sequências de Eimeria spp. ainda não descritas no Brasil, referentes aos genes ITS-2 e 18S rRNA.

Palavras-chave:
Coccidiose; aves; diagnóstico molecular; sequenciamento de nova geração

Introduction

Coccidiosis is one of the most economically relevant diseases for the poultry industry (Williams, 1999; Blake et al., 2020). Seven species of Eimeria infect the domestic chicken: Eimeria acervulina, Eimeria brunetti, Eimeria mitis, Eimeria maxima, Eimeria necatrix, Eimeria praecox, and Eimeria tenella (Vrba et al., 2011).

Several studies have detected the occurrence of genetic variants in Eimeria populations in different countries (Morris et al., 2007; Cantacessi et al., 2008; Fornace et al., 2013; Jatau et al., 2016). Three genetic variants, which Cantacessi et al. (2008) called operational taxonomic units (OTUs) x, y, and z were proposed as novel species of domestic chickens: Eimeria lata, Eimeria nagambie, and Eimeria zaria, respectively (Blake et al., 2021). The nomenclature proposed by Blake et al. (2021) is adopted throughout this manuscript, especially when studying cryptic species (Allgayer et al., 2021).

The occurrence of E. lata, E. nagambie, and E. zaria has been reported in alternative and industrial poultry farming systems in several countries (Jatau et al., 2016; Fornace et al., 2013; Hinsu et al. 2018; Godwin & Morgan, 2015; Morgan & Godwin, 2017). However, there is a lack of information about the pathogenesis and epidemiology of these new species. This is of great concern when it comes to their prevalence and epidemiological relevance, including the effectiveness of current control measures against coccidiosis, particularly of vaccination against eimeriosis (Venkatas & Adeleke, 2019), since current vaccines against eimeriosis do not contain these three species, which can infect chickens previously vaccinated (Godwin & Morgan, 2015; Blake et al., 2021).

Eimeria lata, E. nagambie, and E. zaria infect from the middle part of the duodenum to the distal part of the ileum (Cantacessi et al., 2008; Blake et al., 2021) and adversely affect production parameters in broilers and laying hens (Fornace et al., 2013). Moreover, mortality in broiler chickens has been attributed to E. lata and E. nagambie (Morris et al., 2007). Depending on the number of inoculated oocysts, the reduction in weight gain can reach 28.8% and 31.1% in E. lata and E. nagambie infections, respectively (Blake et al., 2021).

Considering the relevance of coccidiosis for the health of poultry and for Brazil’s economy, data on the prevalence of Eimeria spp. in commercial poultry production systems (CPPS) are outdated and scanty in alternative poultry production systems (APPS). Information has been reported about the microscopic or molecular identification of E. acervulina, E. brunetti, E. maxima, E. mitis/mivati, E. necatrix, E. praecox, and E. tenella in CPPS in Brazil (Terra et al., 2001; Santos et al; 2003; Meireles et al., 2004; Luchese et al., 2007; Carvalho et al., 2011; Moraes et al., 2015). However, although E. acervulina, E. brunetti, E. maxima, E. mitis/E. mivati, E. necatrix, E. praecox, and E. tenella have been identified based on morphological and morphometric data (Luchese et al., 2007; Noronha et al., 2020; Silva et al., 2022), no studies so far have focused on the molecular identification of Eimeria spp. in APPS in Brazil. Therefore, the objective of this study was to investigate the occurrence of infection by Eimeria spp. and potential new OTUs in APPS in the State of São Paulo, Brazil.

Material and Methods

Fecal and DNA samples

Fecal and DNA samples originated from asymptomatic chickens raised in APPS in the State of São Paulo (Figure 1). APPS consisted of extensive and semi-intensive broiler and layer production systems located in rural areas, each containing six to 250 chickens of several ages and breeds. Chickens have never been vaccinated against coccidiosis and were not medicated in the weeks prior to sample collection. A total of 261 samples were evaluated: 93 samples consisted of genomic DNA samples stored at -20ºC for approximately four years, which were used in a previous study related to Cryptosporidium spp. (Santana et al., 2018). These samples were extracted from the feces of domestic chickens that were collected by convenience sampling from APPS located in 12 municipalities. The remaining 168 samples consisted of feces collected by convenience sampling from APPS located in seven municipalities, in 2021. Each fecal and DNA sample originated from one pool of recently eliminated feces, from up to 10 chickens per APPS, which were picked up with a disposable wooden spatula and preserved in 2.5% potassium dichromate at 4°C.

Figure 1
Location of Municipalities of the State of São Paulo, Brazil, where chicken feces samples were collected from alternative poultry production systems.

Screening for Eimeria spp. by genus-specific PCR and microscopy

Screening for Eimeria spp. in DNA samples extracted in 2018 was performed using a genus-specific PCR targeting the internal transcribed spacer (ITS)-1 locus (Lew et al., 2003) (Table 1) and Jumpstart™ Taq ReadyMix (Sigma Aldrich), in a SimpliAmp® thermal cycler (Thermo Fisher Scientific). The screening was performed in the following conditions: initial DNA denaturation at 94°C for 2 minutes, followed by 35 cycles, each consisting of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 1 minute, with a final extension cycle at 72°C for 7 minutes. Genomic DNA extracted from Eimeria oocysts from the vaccine Bio-Coccivet R (Vaxxinova Biovet Brazil) was used as a positive control. Ultrapure water was used as a negative control.

Table 1
Molecular protocols used to detect and identify Eimeria spp. in alternative poultry production systems.

Protocol	Primer	Primer sequence	Amplicon size (bp)	Eimeria Species / OTU	Target gene	Reference
PCR	EF1	AAGTTGCGTAAATAGAGCCCTC	317-585	Eimeria spp.	ITS-1	Lew et al. (2003)
	ER1	AGACATCCATTGCTGAAAG
PCR/cloning/sequencing	OTUXfor	GTGGTGTCGTCTGCGCGT	134	E. lata	ITS-2	Fornace et al. (2013)
	OTUXrev	ACCACCGTATCTCTTTCGTGA
PCR/cloning/sequencing	OTUZfor	TATAGTTTCTTTTGCGCGTTGC	154	E. zaria
	OTUZrev	CATATCTCTTTCATGAACGAAAGG
PCR/sequencing	OTUYfor	CAAGAAGTACACTACCACAGCATG	347	E. nagambie
	OTUYrev	ACTGATTTCAGGTCTAAAACGAAT
PCR	OTU-Xf2	GGGTAGAGCCAGGGGTAGAG	1,018	E. lata	IMP1 genomic locus	Blake et al. (2021)
	OTU-Xr2	CGTAGTCCCAAGTGCCAACT
Nested PCR/NGS	18S-F-out	CGGGTAACGGGGAATTAGGG	538	Eimeria spp.	18S rRNA	Hauck et al. (2019)
	18S-R-out	TACGAATGCCCCCAACTGTC
	18S-F-in*	TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGGAGGGCAAGTCTGGTG	260
	18S-R-in*	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTGCTGCAGTATTCAGGGCRA

• ^*
  Sequences of the Illumina adapters are underlined.

Fecal samples collected in 2021 were screened for oocysts of Eimeria spp. by microscopy using a simple salt flotation technique. Oocysts from positive samples were purified by centrifugal flotation in a sucrose solution. DNA samples were extracted from the pellet from the purification protocol using a GenElute™ Stool DNA Isolation Kit (Sigma Aldrich) and were stored at -20°C.

Screening for E. lata, E. nagambie, and E. zaria by species-specific PCR

All the samples positive by genus-specific PCR or by microscopy were subjected to species-specific PCR protocols (Table 1) targeting the ITS-2 locus of E. lata (134 pb), E. nagambie (347 bp), and E. zaria (154 bp) (Fornace et al., 2013). Each reaction consisted of a total volume of 25 μl containing 12.5 μl of JumpStart Taq ReadyMix (Sigma Aldrich), 2.5 μl of target DNA, 200 nM of each primer, and ultrapure water, under the following conditions: initial DNA denaturation at 94° C for 2 min, followed by 39 cycles, each cycle consisting of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, and final extension at 72°C for 7 min. Positive controls for E. lata, E. nagambie, and E. zaria PCRs consisted of DNA samples that were previously diagnosed as positive by species-specific PCRs (Fornace et al., 2013). Ultrapure water was used as a negative control.

Additionally, samples positive by PCR specific for E. lata (Fornace et al., 2013) were further examined using another PCR protocol specific for E. lata (1018 bp) with the primers OTU-Xf2 and OTU-Xr2 (Blake et al., 2021) (Table 1), under the following conditions: initial DNA denaturation at 94°C for 2 min, followed by 40 cycles, each cycle consisting of denaturation at 94°C for 30 s, annealing at 58°C for 30s, extension at 72°C for 60 s, and a final extension cycle at 72°C for 7 min. Plasmids containing the synthetic PCR targeted DNA sequence (candidate IMP1 genomic locus) (GenScript) of E. lata and ultrapure water were used as positive and negative controls, respectively.

Amplicons from PCRs targeting the ITS-2 sequences of E. lata and E. zaria were purified using a QIAquick™ Gel Extraction Kit (Qiagen) and then cloned using a TransformAid™ Bacterial Transformation Kit (Thermo Fisher Scientific) and a CloneJET™ PCR Cloning Kit (Thermo Fisher Scientific).

PCR amplicons from E. nagambie and plasmids from E. lata and E. zaria specific PCRs were purified using ExoSAP-IT™ PCR Product Cleanup Reagent (Thermo Fisher Scientific) and a GenElute™ HP Five-Minute Plasmid Miniprep Kit (Sigma-Aldrich), respectively. They were then sequenced in both directions using the ABI Prism™ Dye Terminator 3.1, on an ABI 3730XL automatic sequencer (Applied Biosystems), at the Sequencing and Functional Genomics Center of UNESP Campus Jaboticabal, SP, Brazil. Sequences were analyzed using CodonCode Aligner version 9.0.1 (CodonCode Corporation), BioEdit Sequence Alignment Editor (Hall, 1999), and the Basic Local Alignment Search Tool (BLAST).

Nested PCR and next-generation genetic sequencing to detect and identify Eimeria spp.

Samples positive for Eimeria spp. by microscopy or PCR plus four negative samples were further examined by genera-specific nested PCR targeting the 18S rRNA gene of Eimeria spp., followed by next-generation sequencing (NGS) (Hauck et al., 2019) to detect and identify Eimeria spp. and potential new OTUs. Overhang adapters compatible with Illumina MiSeq index and sequencing adapters were added to the 5' end of nested PCR primers (Illumina, 2013) (Table 1).

PCR protocols were performed using Jumpstart™ Taq ReadyMix (Sigma Aldrich), under the following conditions. Preparation of 25μL of a solution containing 12.5 μL of Jumpstart™ Taq ReadyMix (Sigma Aldrich), 400 nM (PCR) or 800 nM (nested PCR) of each primer, and 2.5 μL (PCR) or 1 μL (nested PCR) of target DNA. Samples were subjected to initial denaturation for 2 min at 94º C followed by 35 cycles of denaturation at 94º C for 30 s, annealing at 60º C for 30 s, and extension at 72º C for 30 s, followed by a final cycle at 72º C for 7 min, using a SimpliAmp™ thermal cycler (Thermo Fisher Scientific). Genomic DNA extracted from oocysts from the commercial vaccine Bio-Coccivet R (Biorad) and ultrapure water were used as positive and negative controls.

Nested PCR amplicons were visualized by agarose gel electrophoresis, purified with a ProNex™ Size-Selective Purification System (Promega), and quantified using a Qubit™ digital fluorimeter (Thermo Fisher Scientific).

Samples were processed according to the Illumina 16S metagenomic protocol (Illumina, 2013), with 150 bp paired-end reads, using MiSeq™ Reagent kit v2 (Illumina). Libraries were prepared using 1 µl of the nested PCR amplicon, regardless of the quantification result. Amplification reactions were performed in a volume of 50 µl containing 5 µl of Nextera XT™ index primer 1 (N7xx), 5 µl of Nextera XT™ index primer 2 (S5xx), 25 µl of Kapa™ Hot Start High Fidelity Ready Mix (Kapa Biosystems), and 14 µl of ultrapure water. Samples were denatured at 95º C for 3 min, followed by 8 cycles of denaturation at 95º C for 30 s, annealing at 55º C for 30 s, and extension at 72º C for 30 s, with a final extension cycle at 72°C for 5 min.

Libraries were purified with a ProNex™ Size-Selective Purification System (Promega), quantified using a Qubit™ digital fluorimeter (Thermo Fisher Scientific), and normalized to a final DNA concentration of 8 pM. PhiX control library was spiked at a concentration of 15%.

Library sequencing was carried out at the Laboratory of Epigenomics of the Faculdade de Medicina Veterinária, UNESP Campus Araçatuba in a MiSeq™ sequencer (Illumina). Adapter sequences were trimmed according to Illumina FASTQ file generation pipelines included in the Illumina Experimental Manager software. Sequences were analyzed using MetaAmp Version 3.0 - OTU based amplicon analysis (Dong et al., 2017). Further analyses to detect chimeras were performed in OTUs originating from MetaAmp analyses using the chimera.uchime algorithm (Edgar et al., 2011) available on the Galaxy platform (The Galaxy Community, 2022).

A given species/OTU was considered to be present in each sample provided that its sequences: 1) corresponded to more than 1% of the sample sequences; 2) were grouped in the same cluster; and 3) were 97% or more genetically similar to the reference sequences. Representative sequences from each species/OTU were compared with sequences from Eimeria spp. using BLAST searches.

Nucleotide sequences generated in this study were submitted to the GenBank database under accession numbers OR229147-OR229154 and OR226404-OR226414 (Tables 2 and 3).

Table 2
Sequences obtained by E. lata, E. nagambie, and E. zaria ITS-2 gene-targeted specific PCR (Fornace et al., 2013), cloning, and sequencing of fecal samples from domestic chickens raised in alternative poultry production systems.

Species-specific PCR (No. positive/ No. sampled; % positive)	Identification by cloning * and genetic sequencing (No. samples)	GenBank accession numbers from this study	Genetic similarity to sequences published in the GenBank database
			Species	Accession numbers	%
E. lata (6/80; 7.5)	Eimeria sp. (1)	OR229147	E. lata	HE997168	99.3
	Eimeria sp. (2)	OR229148	E. maxima	FJ230377	98.5
	Eimeria sp. (1)	OR229149	E. lata	AM922252	97.8
	Eimeria sp. (2)	OR229150	Eimeria sp.	LN609922	97.8
E. nagambie (15/80; 18.8)	E. nagambie (1)	OR229151	E. nagambie	AM922253	100
	Eimeria sp. (1)	OR229152	Eimeria sp.	AM922253	98.3
E. zaria (17/80; 24)	E. zaria (1)	OR229153	E. zaria	HE997165	100
	E. zaria (1)	OR229154	E. zaria	LT549041	100

• ^*
  Cloning was performed only in amplicons from E. lata (2) and E. zaria (2).

Table 3
Identification of Eimeria spp. in fecal samples from chickens raised in alternative poultry production systems by nested PCR targeting the 18S rRNA gene and next-generation sequencing (Hauck et al., 2019).

Eimeria species	GenBank accession numbers from this study	% similarity to GenBank sequences	No. positive/ No. sampled (% positive)	Number of sequences
E. nagambie	OR226404	100 (LT964973)	41/84 (48.8)	94,160
E. acervulina	OR226405	100 (KT184333)	39/84 (46.4)	133,330
E. mivati	OR226406	100 (FJ236377)	37/84 (44)	59,724
E. praecox	OR226407	100 (KT184352)	36/84 (42.9)	147,810
E. brunetti	OR226408	100 (EBU67116)	33/84 (39.3)	73,285
E. mitis	OR226409	99.6 (FR775303)	32/84 (38.1)	32,102
Eimeria sp.	OR226410	100 (MN073208)	29/84 (34.5)	53,189
E. maxima	OR226411	99.1 (FJ236335)	20/84 (23.8)	57,044
E. maxima	OR226412	100 (FJ236357)	15/84 (17.9)	32,951
E. maxima	OR226413	99.6 (FJ236361)	12/84 (14.3)	9,949
E. zaria	OR226414	99.6 (LT964974)	21/84 (25)	34,005
E. necatrix/tenella *	-	100 (DQ136177)	20/84 (23.8)	42,227
		100 (DQ136185)
E. lata	-	-	0/84 (0%)	0

• ^*
  Sequencing could not distinguish between E. necatrix and E. tenella. The sequence was not uploaded to the GenBank database.

Results

Using genus-specific PCR and microscopy, 33.3% (31/93) and 29.2% (49/168) samples positive for Eimeria spp., respectively, were identified. All the samples positive for Eimeria spp. by genus-specific PCR or microscopy (80/261; 30.7%) were analyzed by species-specific PCRs (see results in Table 2).

All the samples positive for E. lata (6/80; 7.5%) by the protocol of Fornace et al. (2013) were negative by the E. lata-specific PCR protocol of Blake et al. (2021). Four distinct sequences that showed greater genetic similarity to E. lata, E. maxima, or several sequences of Eimeria sp. were identified by genetic sequencing of ITS-2 plasmids from E. lata-specific PCR. These samples were thus classified as Eimeria sp. Two E. zaria-specific PCR sequences showed 100% genetic similarity with E. zaria sequences published in GenBank. Amplicons from E. nagambie-specific PCR showed two distinct genetic sequences: one sequence with 98.3% genetic similarity to E. nagambie was classified as Eimeria sp.; the other sequence had 100% genetic similarity with E. nagambie (Table 2).

Table 3 describes Eimeria species and the number of sequences obtained by the 18S rRNA gene next-generation sequencing. Although E. mivati 18S rRNA gene is currently considered a different type within E. mitis genome (Vrba et al., 2011), the sequences from our study were identified according to the species recorded in the GenBank database. Eimeria necatrix and E. tenella could not be differentiated by NGS of nested PCR amplicons.

The following species were identified, in order of prevalence: E. nagambie, E. acervulina, E. mivati, E. praecox, E. brunetti, E. mitis, unclassified Eimeria sp., E. maxima, E. zaria, and E. necatrix/tenella.

Mono-infections with E. acervulina, E. maxima, E. mitis/mivati, E. nagambie, E. praecox, E. necatrix/tenella, E. zaria, and unidentified Eimeria sp. were detected in 16/84 (19%) APPS. Mixed infections with Eimeria spp., including E. necatrix/tenella and unidentified Eimeria sp. were detected as follows: two species (11/84; 13.1%); three species (10/84 (11.1%); four species (8/84; 9.5%); five species (11/84; 13.1%); six species (11/84; 13.1%); seven species (4/84; 4.8%); and nine species (1/84; 1.2%).

All the samples were negative for E. lata by NGS. Sequences from unclassified Eimeria sp. identified in 34.5% of the samples exhibited 100% genetic similarity to Eimeria sp. 2 RHa-2020 (MN073208) described by Clark et al. (2016) in commercial broiler chickens in the United States (Table 3). Eimeria acervulina, E. brunetti, E. maxima, E. mitis/mivati, E. necatrix/tenella, and E. praecox were detected in vaccine Bio-Coccivet R.

In addition, NGS revealed a low prevalence of sequences representing Eimeria and Isospora species from other hosts, most closely related to Eimeria bovis, Eimeria crandalis, Eimeria dispersa, Eimeria ferrisi, Eimeria inocua, Eimeria mandali, Eimeria mayurai, Eimeria meleagrimitis, Eimeria riyadhae, and Isospora sp. ex Myodes glareolus.

Discussion

The detection of seven species of Eimeria using molecular techniques has been reported in CPPS in Brazil, namely, E. acervulina, E. brunetti, E. maxima, E. mitis, E. necatrix, E. praecox, and E. tenella (Meireles et al., 2004; Carvalho et al., 2011; Moraes et al., 2015; Balestrin et al., 2021). However, no studies to date have focused on the molecular identification of Eimeria species in APPS in Brazil.

Fatoba et al. (2020) identified E. maxima, E. tenella, E. acervulina, E. brunetti, and E. mitis using a species-specific nested PCR targeting the ITS-1 gene in free-range farms in South Africa. They also reported that all their samples tested negative by E. lata, E. nagambie, and E. zaria specific protocols. In backyard flocks, 10 Eimeria species were identified using a capillary electrophoresis assay in Australia (Godwin & Morgan, 2015). The analyses of the ITS-2 gene sequences from our study revealed, for the first time, the presence of unidentified Eimeria sp., E. nagambie, and E. zaria in domestic chickens in Brazil and the detection of E. nagambie in South America. Eimeria lata, E. nagambie, and E. zaria have already been identified in several countries, including Australia (Godwin & Morgan, 2015; Morgan & Godwin, 2017), Nigeria (Jatau et al., 2016; Clark et al., 2016), India (Hinsu et al., 2018), Ghana, Tanzania, Uganda, and Zambia (Fornace et al., 2013; Clark et al., 2016), and the United States (Hauck et al., 2019; Terra et al., 2021). The only study on these three new species in South America described the identification of E. lata and E. zaria in Venezuela (Clark et al., 2016).

Eimeria lata-specific PCR protocol (Fornace et al., 2013) resulted in 6/79 (7.6%) positive samples. However, sequencing of PCR amplicons enabled the identification of genetic sequences most similar to Eimeria sp., E. lata, and E. maxima (Table 2). Another E. lata-specific PCR protocol (Blake et al., 2021) proved to be negative, which confirms the absence, or the presence below the PCR detection threshold, of E. lata.

An ITS-2 sequence amplified by E. nagambie-specific PCR showed 98.3% genetic similarity to E. nagambie (Table 2). Owing to the short number of base pairs of the PCR amplicon and the intraspecies polymorphism of the ITS-2 gene, the genetic similarity to an E. nagambie sequence does allow this sequence to be classified as belonging to E. nagambie.

NGS has recently been used to identify Eimeria spp. from domestic chickens, allowing the identification of all 10 species of Eimeria and new Eimeria OTUs (Hinsu et al., 2018; Hauck et al., 2019; Terra et al., 2021). Using NGS, we identified 18S rRNA sequences from E. nagambie and E. zaria in Brazil, along with the identification of nine species of Eimeria, including E. necatrix/tenella, and an unidentified Eimeria sp. A surprising result of our study was the high prevalence of E. nagambie. Eimeria nagambie was also the most common species in backyard flocks in Australia (Godwin & Morgan, 2015) and the second most prevalent species in backyard flocks in the United States (Hauck et al., 2019).

A sequence from unclassified Eimeria sp. identified in 34.5% of the samples presented 100% genetic similarity to the sequence of Eimeria sp. 2 RHa-2020 (MN073208) described by Clark et al. (2016) in commercial broiler chickens in the United States. Further studies are needed to determine if this sequence is related to new OTUs of Eimeria or even to novel Eimeria species.

The relative abundances of Eimeria spp. were not calculated owing to potential bias introduced by nested PCR (Hauck et al., 2019). However, the highest number of sequences obtained by NGS pertains to E. praecox and E. acervulina (Table 3), which are the species with the highest fecundity (Bumstead & Millard, 1992; Blake et al., 2021). There are no data about E. nagambie fecundity (Blake et al., 2021). Owing to many variables related to the fecundity of Eimeria spp. in domestic chickens (Williams, 1973; Williams, 2001; Jenkins et al., 2013; Xu et al., 2022), definitive inferences cannot be made by comparing the number of NGS sequences with the fecundity data of nine Eimeria species fecundity data available to date.

Identification of the Eimeria species can be presumed by analyzing the morphology and morphometry of the oocysts and macroscopic lesions, but a definitive species identification is more specific and sensitive based on the use of species-specific PCR or by genus-specific PCR followed by genetic sequencing. In this study, NGS and species-specific PCR protocols for E. lata, E. nagambie, and E. zaria were used for the first time in samples from Brazilian farms, which explains the lack of information on these species in studies previously published in Brazil.

This is a pioneering study of the identification of E. nagambie, E. zaria, and potential new Eimeria OTUs in Brazil. The finding of novel Eimeria species in Brazilian chicken farms provides relevant information regarding coccidiosis control, since E. nagambie and E. zaria, in addition to being pathogenic, evade immune protection conferred by Eimeria commercial vaccines (Venkatas & Adeleke, 2019; Blake et al., 2021).

Considering the economic relevance of coccidiosis in domestic chicken farms, further research should be performed on the prevalence of infection by Eimeria spp., particularly E. lata, E. nagambie, E. zaria, and potential new OTUs in domestic chicken farms, especially in CPPS.

Conclusions

In conclusion, 18S rRNA-targeted NGS identified nine species of Eimeria from domestic chickens raised in APPS, including E. necatrix/tenella, and unidentified Eimeria sp. Species-specific PCR protocols targeting the ITS-2 locus followed by sequencing identified, for the first time in Brazil, E. nagambie, E. zaria, and novel sequences most similar to several Eimeria sp., E. lata, E. maxima, and E. nagambie sequences.

Acknowledgements

The authors thank Professor Damer Blake for his valuable suggestions concerning E. lata, E. nagambie, and E. zaria classification and for kindly informing the sequence of the candidate IMP1 genomic locus. We also gratefully acknowledge the financial support of the Coordination for the Improvement of Higher Education Personnel (CAPES), under the Finance Code 001, for a Master of Science Scholarship granted to Soares Júnior, J.C., and São Paulo Research Foundation (FAPESP - Process 2021/10400-2). Lastly, we thank Vaxxinova Biovet Brazil for its kind donation of the vaccine Bio-Coccivet R for this study.

• How to cite: Soares Júnior JC, Itoyama BF, Beretta BMS, Hossotani CMS, Silva MSC, Silva GS, et al. Identification of Eimeria spp. in domestic chickens raised in alternative poultry production systems in the State of São Paulo, Brazil. Braz J Vet Parasitol 2023; 32(4): e011123. https://doi.org/10.1590/S1984-29612023075

References

• Allgayer H, Hiller RF, Valiati VH. Uma análise epistêmica para a elucidação do complexo de espécies crípticas. Conjectura: Filos Educ 2021; 26: 85-100. http://dx.doi.org/10.18226/21784612.v26.e021005
  » http://dx.doi.org/10.18226/21784612.v26.e021005
• Balestrin PWG, Balestrin E, Santiani F, Biezus G, Moraes JC, Casa MS, et al. Prevalence of Eimeria sp. in broiler poultry houses with positive and negative pressure ventilation systems in Southern Brazil. Avian Dis 2021; 65(3): 469-473. http://dx.doi.org/10.1637/aviandiseases-D-21-00044 PMid:34699145.
  » http://dx.doi.org/10.1637/aviandiseases-D-21-00044
• Blake DP, Knox J, Dehaeck B, Huntington B, Rathinam T, Ravipati V, et al. Re-calculating the cost of coccidiosis in chickens. Vet Res (Faisalabad) 2020; 51(1): 115. http://dx.doi.org/10.1186/s13567-020-00837-2 PMid:32928271.
  » http://dx.doi.org/10.1186/s13567-020-00837-2
• Blake DP, Vrba V, Xia D, Jatau ID, Spiro S, Nolan MJ, et al. Genetic and biological characterisation of three cryptic Eimeria operational taxonomic units that infect chickens (Gallus gallus domesticus). Int J Parasitol 2021; 51(8): 621-634. http://dx.doi.org/10.1016/j.ijpara.2020.12.004 PMid:33713650.
  » http://dx.doi.org/10.1016/j.ijpara.2020.12.004
• Bumstead N, Millard B. Variation in susceptibility of inbred lines of chickens to seven species of Eimeria. Parasitology 1992; 104(3): 407-413. http://dx.doi.org/10.1017/S0031182000063654 PMid:1386419.
  » http://dx.doi.org/10.1017/S0031182000063654
• Cantacessi C, Riddell S, Morris GM, Doran T, Woods WG, Otranto D, et al. Genetic characterization of three unique operational taxonomic units of Eimeria from chickens in Australia based on nuclear spacer ribosomal DNA. Vet Parasitol 2008; 152(3-4): 226-234. http://dx.doi.org/10.1016/j.vetpar.2007.12.028 PMid:18243560.
  » http://dx.doi.org/10.1016/j.vetpar.2007.12.028
• Carvalho FS, Wenceslau AA, Teixeira M, Carneiro JAM, Melo ADB, Albuquerque GR. Diagnosis of Eimeria species using traditional and molecular methods in field studies. Vet Parasitol 2011; 176(2-3): 95-100. http://dx.doi.org/10.1016/j.vetpar.2010.11.015 PMid:21167646.
  » http://dx.doi.org/10.1016/j.vetpar.2010.11.015
• Clark EL, Macdonald SE, Thenmozhi V, Kundu K, Garg R, Kumar S, et al. Cryptic Eimeria genotypes are common across the southern but not northern hemisphere. Int J Parasitol 2016; 46(9): 537-544. http://dx.doi.org/10.1016/j.ijpara.2016.05.006 PMid:27368611.
  » http://dx.doi.org/10.1016/j.ijpara.2016.05.006
• Dong X, Kleiner M, Sharp CE, Thorson E, Li C, Liu D, et al. Fast and simple analysis of MiSeq amplicon sequencing data with MetaAmp. Front Microbiol 2017; 8: 1461. http://dx.doi.org/10.3389/fmicb.2017.01461 PMid:28824589.
  » http://dx.doi.org/10.3389/fmicb.2017.01461
• Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 2011; 27(16): 2194-2200. http://dx.doi.org/10.1093/bioinformatics/btr381 PMid:21700674.
  » http://dx.doi.org/10.1093/bioinformatics/btr381
• Fatoba AJ, Zishiri OT, Blake DP, Peters SO, Lebepe J, Mukaratirwa S, et al. Study on the prevalence and genetic diversity of Eimeria species from broilers and free-range chickens in KwaZulu-Natal province, South Africa. Onderstepoort J Vet Res 2020; 87(1): a1837. http://dx.doi.org/10.4102/ojvr.v87i1.1837 PMid:33054259.
  » http://dx.doi.org/10.4102/ojvr.v87i1.1837
• Fornace KM, Clark EL, MacDonald SE, Namangala B, Karimuribo E, Awuni J, et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS One 2013; 8(12): e84254. http://dx.doi.org/10.1371/journal.pone.0084254 PMid:24391923.
  » http://dx.doi.org/10.1371/journal.pone.0084254
• Godwin RM, Morgan JAT. A molecular survey of Eimeria in chickens across Australia. Vet Parasitol 2015; 214(1-2): 16-21. http://dx.doi.org/10.1016/j.vetpar.2015.09.030 PMid:26467277.
  » http://dx.doi.org/10.1016/j.vetpar.2015.09.030
• Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 1999; 41: 95-98.
• Hauck R, Carrisosa M, McCrea BA, Dormitorio T, Macklin KS. Evaluation of next-generation amplicon sequencing to identify Eimeria spp. of chickens. Avian Dis 2019; 63(4): 577-583. http://dx.doi.org/10.1637/aviandiseases-D-19-00104 PMid:31865671.
  » http://dx.doi.org/10.1637/aviandiseases-D-19-00104
• Hinsu AT, Thakkar JR, Koringa PG, Vrba V, Jakhesara SJ, Psifidi A, et al. Illumina next generation sequencing for the analysis of Eimeria populations in commercial broilers and indigenous chickens. Front Vet Sci 2018; 5: 176. http://dx.doi.org/10.3389/fvets.2018.00176 PMid:30105228.
  » http://dx.doi.org/10.3389/fvets.2018.00176
• Illumina. 16S metagenomic sequencing library preparation [online]. 2013 [cited 2023 July 11]. Available from: https://support.illumina.com/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf
  » https://support.illumina.com/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf
• Jatau ID, Lawal IA, Kwaga KP, Tomley FM, Blake DP, Nok AJ. Three operational taxonomic units of Eimeria are common in Nigerian chickens and may undermine effective molecular diagnosis of coccidiosis. BMC Vet Res 2016; 12(1): 86. http://dx.doi.org/10.1186/s12917-016-0713-9 PMid:27259544.
  » http://dx.doi.org/10.1186/s12917-016-0713-9
• Jenkins MC, Parker C, O’Brien C, Miska K, Fetterer R. Differing susceptibilities of Eimeria acervulina, Eimeria maxima, and Eimeria tenella oocysts to desiccation. J Parasitol 2013; 99(5): 899-902. http://dx.doi.org/10.1645/13-192.1 PMid:23617755.
  » http://dx.doi.org/10.1645/13-192.1
• Lew AE, Anderson GR, Minchin CM, Jeston PJ, Jorgensen WK. Inter- and intra-strain variation and PCR detection of the internal transcribed spacer 1 (ITS-1) sequences of Australian isolates of Eimeria species from chickens. Vet Parasitol 2003; 112(1-2): 33-50. http://dx.doi.org/10.1016/S0304-4017(02)00393-X PMid:12581583.
  » http://dx.doi.org/10.1016/S0304-4017(02)00393-X
• Luchese FC, Perin M, Aita RS, Mottin VD, Molento MB, Monteiro SG. Prevalência de espécies de Eimeria em frangos de criação industrial e alternativa. Braz J Vet Res Anim Sci 2007; 44(2): 81-86. http://dx.doi.org/10.11606/issn.1678-4456.bjvras.2007.26645
  » http://dx.doi.org/10.11606/issn.1678-4456.bjvras.2007.26645
• Meireles MV, Roberto LO, Riera RF. Identification of Eimeria mitis and Eimeria praecox in broiler feces using polymerase chain reaction. Rev Bras Cienc Avic 2004; 6(4): 249-252. http://dx.doi.org/10.1590/S1516-635X2004000400010
  » http://dx.doi.org/10.1590/S1516-635X2004000400010
• Moraes JC, França M, Sartor AA, Bellato V, Moura AB, Magalhães ML, et al. Prevalence of Eimeria spp. in broilers by multiplex PCR in the Southern Region of Brazil on two hundred and fifty farms. Avian Dis 2015; 59(2): 277-281. http://dx.doi.org/10.1637/10989-112014-Reg PMid:26473679.
  » http://dx.doi.org/10.1637/10989-112014-Reg
• Morgan JAT, Godwin RM. Mitochondrial genomes of Australian chicken Eimeria support the presence of ten species with low genetic diversity among strains. Vet Parasitol 2017; 243: 58-66. http://dx.doi.org/10.1016/j.vetpar.2017.05.025 PMid:28807311.
  » http://dx.doi.org/10.1016/j.vetpar.2017.05.025
• Morris GM, Woods WG, Richards DG, Gasser RB. Investigating a persistent coccidiosis problem on a commercial broiler-breeder farm utilising PCR-coupled capillary electrophoresis. Parasitol Res 2007; 101(3): 583-589. http://dx.doi.org/10.1007/s00436-007-0516-9 PMid:17404757.
  » http://dx.doi.org/10.1007/s00436-007-0516-9
• Noronha PC, Carrijo DL, Santos GA, Cardozo SP. Detecção e identificação de Eimeria sp em galinhas caipiras produzidas no município de Mineiros, Goiás. Braz J Develop 2020; 6(7): 44048-44057. http://dx.doi.org/10.34117/bjdv6n7-139
  » http://dx.doi.org/10.34117/bjdv6n7-139
• Santana BN, Kurahara B, Nakamura AA, Camargo VS, Ferrari ED, Silva GS, et al. Detection and characterization of Cryptosporidium species and genotypes in three chicken production systems in Brazil using different molecular diagnosis protocols. Prev Vet Med 2018; 151: 73-78. http://dx.doi.org/10.1016/j.prevetmed.2018.01.007 PMid:29496109.
  » http://dx.doi.org/10.1016/j.prevetmed.2018.01.007
• Santos RFS, Kavavata GM, Almeida SM, Hisano M, Calixto LFL, Meireles MV. Ocorrência de Eimeria sp. em frangos de corte no estado de São Paulo. Ars Vet 2003; 19(3): 230-234.
• Silva JT, Alvares FBV, Lima EF, Silva GM Fo, Silva ALP, Lima BA, et al. Prevalence and diversity of Eimeria spp. in free-range chickens in northeastern Brazil. Front Vet Sci 2022; 9: 1031330. http://dx.doi.org/10.3389/fvets.2022.1031330 PMid:36311673.
  » http://dx.doi.org/10.3389/fvets.2022.1031330
• Terra AT, Costa PS, Figueiredo PC, Carvalho ECQ. Freqüência de espécies do gênero Eimeria em frangos de corte abatidos industrialmente no município de Monte Alegre do Sul, Estado de São Paulo. Braz J Vet Parasitol 2001; 10(2): 87-90.
• Terra MTB, Pacheco WJ, Harrison M, McCrea BA, Hauck R. A Survey of coccidia and nematodes in pastured poultry in the state of Georgia. Avian Dis 2021; 65(2): 250-256. http://dx.doi.org/10.1637/aviandiseases-D-20-00120 PMid:34412455.
  » http://dx.doi.org/10.1637/aviandiseases-D-20-00120
• The Galaxy Community. The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2022 update. Nucleic Acids Res 2022; 50(W1): W345-W351. http://dx.doi.org/10.1093/nar/gkac247 PMid:35446428.
  » http://dx.doi.org/10.1093/nar/gkac247
• Venkatas J, Adeleke MA. Emerging threat of Eimeria operational taxonomic units (OTUs) on poultry production. Parasitology 2019; 146(13): 1615-1619. http://dx.doi.org/10.1017/S0031182019001100 PMid:31397242.
  » http://dx.doi.org/10.1017/S0031182019001100
• Vrba V, Poplstein M, Pakandl M. The discovery of the two types of small subunit ribosomal RNA gene in Eimeria mitis contests the existence of E. mivati as an independent species. Vet Parasitol 2011; 183(1-2): 47-53. http://dx.doi.org/10.1016/j.vetpar.2011.06.020 PMid:21767912.
  » http://dx.doi.org/10.1016/j.vetpar.2011.06.020
• Williams RB. A compartmentalised model for the estimation of the cost of coccidiosis to the world’s chicken production industry. Int J Parasitol 1999; 29(8): 1209-1229. http://dx.doi.org/10.1016/S0020-7519(99)00086-7 PMid:10576573.
  » http://dx.doi.org/10.1016/S0020-7519(99)00086-7
• Williams RB. Quantification of the crowding effect during infections with the seven Eimeria species of the domesticated fowl: its importance for experimental designs and the production of oocyst stocks. Int J Parasitol 2001; 31(10): 1056-1069. http://dx.doi.org/10.1016/S0020-7519(01)00235-1 PMid:11429169.
  » http://dx.doi.org/10.1016/S0020-7519(01)00235-1
• Williams RB. The effect of Eimeria acervulina on the reproductive potentials of four other species of chicken coccidia during concurrent infections. Br Vet J 1973; 129(3): 29-31. http://dx.doi.org/10.1016/S0007-1935(17)36498-9 PMid:4738008.
  » http://dx.doi.org/10.1016/S0007-1935(17)36498-9
• Xu L, Xiang Q, Li M, Sun X, Lu M, Yan R, et al. Pathogenic effects of single or mixed infections of Eimeria mitis, Eimeria necatrix, and Eimeria tenella in chickens. Vet Sci 2022; 9(12): 657. http://dx.doi.org/10.3390/vetsci9120657 PMid:36548818.
  » http://dx.doi.org/10.3390/vetsci9120657

Publication Dates

• Publication in this collection
  04 Dec 2023
• Date of issue
  2023

History

• Received
  11 July 2023
• Accepted
  25 Oct 2023