Differentially methylated regions identified in bovine embryos are not observed in adulthood

Abstract

The establishment of epigenetic marks during the reprogramming window is susceptible to environmental influences, and stimuli during this critical stage can cause altered DNA methylation in offspring. In a previous study, we found that low levels of sulphur and cobalt (low S/Co) in the diet offered to oocyte donors altered the DNA methylome of bovine embryos. However, due to the extensive epigenetic reprogramming that occurs during embryogenesis, we hypothesized that the different methylation regions (DMRs) identified in the blastocysts may not maintain in adulthood. Here, we aimed to characterize DMRs previously identified in embryos, in the blood and sperm of adult progenies of two groups of heifers (low S/Co and control). We used six bulls and characterized the DNA methylation levels of KDM2A, KDM5A, KMT2D, and DOT1L genes. Our results showed that all DMRs analysed in both groups and tissues were hypermethylated unlike that noticed in the embryonic methylome profiles. These results suggest that embryo DMRs were reprogrammed during the final stages of de novo methylation during embryogenesis or later in development. Therefore, due to the highly dynamic epigenetic state during early embryonic development, we suggest that is essential to validate the DMRs found in embryos in adult individuals.

Keywords:
epigenetics; reprogramming; methylome; DMRs; cattle

Introduction

DNA methylation has been studied in embryos of various species ever since techniques were first developed for the analysis of DNA methylation (Stevens et al., 1988; Kafri et al., 1992; Kang et al., 2001). The technological advancements of the past few decades have made it possible to access the embryonic methylome through whole-genome sequencing. Several studies that have analysed DNA methylation during embryogenesis in cattle, sheep, and humans have since been published (Guo et al., 2014; Zhu et al., 2018; Duan et al., 2019; Zhou et al., 2019; Zhang et al., 2021b). Although these analyses of the various embryonic stages have provided valuable information to elucidate some regulatory mechanisms, the epigenetic state during the early embryonic development is highly dynamic and requires further study.

During the initial stages of development in mammals, particularly gametogenesis and embryogenesis, extensive epigenetic reprogramming occurs to support proper embryonic and foetus growth (Reik et al., 2001; Canovas et al., 2017). First, a wide loss of DNA methylation is initiated during primordial germ cell (PGC) formation in the foetal phase (Reik et al., 2001). After demethylation, a subsequent de novo DNA methylation process occurs, establishing a new sex-specific pattern in developing gametes (Lee et al., 2002). This de novo methylation process differs between male and female germ lines. In the male germ line, the process is initiated in the foetus; hence, the paternal allele is hypermethylated at birth in this cell lineage (Davis et al., 2000). In the female germ line by contrast, the process is arrested during meiosis in the foetal period, and de novo methylation begins only after birth during folliculogenesis/oogenesis, which is around puberty (Obata et al., 1998; Fagundes et al., 2011). A follicle is recruited for growth, and de novo DNA methylation is initiated in the oocytes. However, the process is not completed without the aid of appropriate hormonal stimuli.

During embryogenesis, the parental pronucleus undergoes a differential demethylation process, where the paternal genome is significantly demethylated by an active mechanism closely following fertilization (Oswald et al., 2000). The maternal genome, however, loses DNA methylation at a later stage due to cleavage divisions through a passive mechanism (Sasaki and Matsui, 2008). After DNA demethylation, global de novo methylation begins at the 8-16 cell stage in cattle (Dean et al., 2001; Ivanova et al., 2020). At the blastocyst stage, where several methylome analyses takes place, de novo methylation has been started; however, a wide range of reprogramming continues until the establishment of DNA methylation patterns in the embryonic and extra-embryonic tissue (Greenberg and Bourc'his, 2019). Therefore, several mechanisms of epigenetic remodeling still happen from the blastocyst stage until the establishment of the tissue epigenome of the adult animal (Xu et al., 2021). Now, how informative could the methylome of the embryos be if the DNA methylation patterns are analysed before the structures have been completely reprogrammed?

One of the main reasons for the increased interest in embryonic DNA methylation is the Developmental Origins of Health and Disease (DOHaD) study and the long-term consequences for the progeny, which is a crucial concern for humans (Almeida et al., 2019; Lapehn and Paquette, 2022). The DOHaD theory states that the foetus undergoes an intrauterine environmental adaptation process in order to cope with those same conditions following birth (Wadhwa et al., 2009; Moreno-Fernandez et al., 2020). Therefore, adverse environmental stimuli during foetal programming can affect the establishment of epigenetic marks. As the offspring may not face the same conditions after birth, these adaptions can lead to susceptibility to diseases in adulthood (Cropley et al., 2006; Martinez et al., 2014).

As a result of several studies in humans and animal models, the maternal diet during early pregnancy is known to affect the embryo and long-term conceptus (Tobi et al., 2015; Wang et al., 2015; Finer et al., 2016; Knight et al., 2018; Serrano-Perez et al., 2020). We found that low levels of sulphur and cobalt in the diet offered to oocyte donors altered the DNA methylome of bovine embryos (Nochi et al., 2022). The inheritance of differential methylation regions (DMRs) by the next generation is known as an intergenerational epigenetic inheritance (Skvortsova et al., 2018). Analysing embryonic methylomes can be helpful for the analysis of epigenetic inheritance as an initial screening strategy. However, caution must be exercised when considering the information extracted from these data and when projecting the embryonic methylome onto adult tissues (Nochi et al., 2022).

Thus, this study tests the hypothesis that the DMRs identified in the embryos are not maintained in the somatic tissues of the animal in adulthood, considering that the embryos have a high probability of losing these DMR patterns during the second wave of epigenetic reprogramming, which occurs during early development (Reik et al., 2001). Accordingly, we aimed to characterize four DMRs in genes, which were previously identified in embryos and are involved in the epigenetic machinery, in the blood and sperm of adult progenies of two groups of heifers used in a related previous study in our laboratory (Nochi et al., 2022). These genes of special interest are related to histone methylation: writer lysine methyltransferase 2D (KMT2D), DOT1-like histone lysine methyltransferase (DOT1L), erasers lysine demethylase 2A (KDM2A), and lysine demethylase 5A (KDM5A).

Methods

Ethical approval

This experimental study has been approved by the Ethics Committee on Animal Use (CEUA-Protocol n° 98/2010), School of Veterinary Medicine and Animal Science, Universidade Estadual Paulista “Júlio de Mesquita Filho.”

Animals and experimental diets

In this study, we used animals from a previous study conducted in our laboratory (Nochi et al., 2022). Briefly, the heifers were separated into groups with different diets, the control and the group with low sulfur and cobalt (low S/Co). The respective diets were offered to the animals for six months (pre- and periconceptional periods). At the end of the experiment, the heifers were inseminated with the same bull used for the in vitro embryo production (IVP) performed in Nochi et al. (2022). Among the progeny of those heifers, we collected the blood and sperm of the bulls in adulthood.

Sample collection

The blood and sperm cells were collected from six bulls (Bull 1, Bull 2, Bull 3, Bull 4, Bull 5, and Bull 6) — the progenies of heifers (two from the control and four from the low S/Co group). Semen from six Nellore bulls (Bos taurus indicus) was collected from the ejaculate via electroejaculation. Sperm quality, concentration, motility, plasma membrane integrity, and morphology were evaluated (Table 1). Semen samples were stored in liquid nitrogen (-196 ºC) until DNA isolation was performed.

Table 1
Concentration (×10⁶/mL), total motility (%), plasma membrane integrity (%), and sperm normal morphology (%) in the semen of each animal before freezing.

	Animals
	Bull 1	Bull 2	Bull 3	Bull 4	Bull 5	Bull 6
Concentration (×106/mL)	1710	1510	1250	2920	650	1750
Total motility (%)	20%	90%	70%	90%	90%	90%
Plasma membrane integrity (%)	43%	79%	82%	66,5%	78%	61%
Sperm normal morphology (%)	31%	80,5%	66,5%	67,5%	64,5%	67%

DNA isolation

Genomic DNA was isolated from white blood cells using the DNeasy Blood & Tissue Kit (Qiagen, CA, USA) according to the manufacturer’s instructions. Sperm DNA was isolated using a protocol based on salting out as described by Carvalho et al. (2012). The DNA samples were stored at -20 °C for sodium bisulphite treatment. The quality of the DNA samples was evaluated using agarose gel electrophoresis.

Sodium bisulphite treatment

Blood and sperm genomic DNA (500 ng) were treated with sodium bisulphite using the EZ DNA Methylation-Lightning kit (Zymo Research, Irvine, CA, USA), according to the manufacturer’s instructions. Sodium bisulphite-treated DNA were stored at -80 °C until PCR amplification was performed.

Bisulphite PCR

PCR was performed to amplify the DMRs in the genes KDM2A, KDM5A, KMT2D, and DOT1L, which are associated with histone-active methylation marks (Nochi et al., 2022). Primers were designed using the MethPrimer (Li and Dahiya, 2002) and Bisulphite Primer Seeker software (Zymo Research) to flank the DMRs, which were located on CpG islands in all genes except KDM5A (Figure 1).

Figure 1
Representation of the KDM2A, KDM5A, KMT2D, and DOT1L gene structures, GC content, and CpG island prediction. Green bars represent the input sequence; below, blue lines represent introns, blue arrows represent exons, and orange arrows represent primer positions. The GC content and CpG islands are predicted for each gene. The graphs were generated using Geneious v2020.0.5 (Biomatters, Auckland, New Zealand).

The primer sequences, GenBank accession numbers, number of CpG sites, amplicon sizes, and annealing temperatures are listed in Table 2. The total volume of each reaction prepared was 20 μL and comprised of 1× Taq buffer, 1.5 mM MgCl₂, 0.4 mM dNTPs, 1 U Platinum™ Taq polymerase (Invitrogen, CA, USA), 0.5 μM primers (forward and reverse), and 2 μL of bisulphite-treated DNA. PCR was performed with an initial denaturing step at 94 °C for 3 min, followed by 29 cycles of 94 °C for 40 s, annealing (Table 2) for 1 min, and 72 °C for 1 min. The final extension was at 72 °C for 15 min. After PCR, amplicons were purified from agarose gels using the Wizard^® SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA), according to the manufacturer’s instructions.

Table 2
Primers for methylation analysis.

Gene		Primer Sequence (5’-3’)	Genbank acession number	CpG sites	Amplicon length (bp)	Annealing (°C)
KDM2A	F:	GGTAAGTGTAGAGGGTTTTGAAGAAAGGAGATATTG	540141	28	387	60
	R:	TTAACTTTCTCAACTTCAAACAACTCCTTTTTACC
KDM5A	F:	AAATTGGTTAAGAAGTTAGTAAAAGAAGAAGAGAG	507962	13	334	55
	R:	ATAATACAAAACCAAATCCTAAAATCAAAACAAACC
KMT2D	F:	TAGTTAGAGTGGAGTAGATTTTGTGGGGTTT	506805	11	333	60
	R:	CACAACTAAAAACCAAACTACCCCCTTATC
DOT1L	F:	GTTATGGGTATTTTTTAGGTTGGTGGTTG	510442	19	335	60
	R:	TACAAAATAAAAACCATATTCCAAACCCAC

• F (forward); R (reverse); bp (base pair).

Cloning and bisulphite sequencing

The purified amplicons were cloned into the TOPO TA Cloning^® vector (Invitrogen, CA, USA) and transferred into DH5α cells using a heat shock procedure. Plasmid DNA was isolated using Pure Yield Plasmid Miniprep (Promega, Madison, WI, USA), and individual clones were sequenced using BigDye^® cycle sequencing chemistry and an ABI3100 automated sequencer (Applied Biosystems, Foster City, CA). Electropherogram quality was analysed using Chromas^® (Technelysium Pty Ltd, South Brisbane, Australia), and methylation patterns were processed using the QUantification tool for Methylation Analysis (QUMA) (Kumaki et al., 2008). DNA sequences were compared with GenBank reference sequences (Table 2), and only those sequences originating from clones with ≥ 95% identity and ≥ 97% cytosine conversion were used in the analysis (n = 684). The efficiency of the bisulphite treatment was calculated based on the percentage of CpH (H = A, C, or T) site conversion divided by the total number of CpH sites in the sequence.

Statistics analysis

Comparison of methylation data between two groups was done using the Mann-Whitney test and more than two groups were performed using the Kruskal-Wallis test followed by Dunn’s multiple comparison test. Comparative methylation analysis of CpG site was performed using Fisher's exact test. Statistical significance was set at p < 0.05. Data analyses were performed using QUMA and GraphPad Prism software.

Results

Overall, we analyzed 688 clones and compared the DNA methylation patterns of the four genes KDM2A, KDM5A, KMT2D, and DOT1L (detected in the blood and sperm of six Nellore bulls) in the control group against that of the low S/Co groups. The DNA methylation levels (Figures2-5) were classified as low (0-20%), moderate (21-50%), and high (51-100%) according to Zhang et al. (2016) and Silveira et al. (2018).

Figure 2
DNA methylation profile of KDM2A gene in blood and sperm for control and low S/Co groups. (A) Blood samples, (B) Sperm samples, and (C) Comparative analysis of methylation by CpG sites between control and low S/Co in blood and sperm. Each line represents an individual DNA clone, and each circle represents a CpG dinucleotide. Black circles represent methylated cytosines and white circles represent unmethylated cytosines. The DNA methylation percentage for each animal (Bull 1, Bull 2, Bull 3, Bull 4, Bull 5, and Bull 6) is represented as mean ± standard deviation of the mean. Differences in DNA methylation among animals within the same group are shown by letters a and b (p < 0.05). (*) represents significant difference in the mean values for methylation of individual CpGs using Fisher's exact test (p<0.05). (n) represents the number of sequenced alleles of each sample.

Figure 5
DNA methylation profile of DOT1L gene in blood and sperm for control and low S/Co groups. (A) Blood samples, (B) Sperm samples, and (C) Comparative analysis of methylation by CpG sites between control and low S/Co in blood and sperm. Each line represents an individual DNA clone, and each circle represents a CpG dinucleotide. Black circles represent methylated cytosines and white circles represent unmethylated cytosines. The DNA methylation percentage for each animal (Bull 1, Bull 2, Bull 3, Bull 4, Bull 5, and Bull 6) is represented as mean ± standard deviation of the mean. Differences in DNA methylation among animals within the same group are shown by letters a and b (p < 0.05). (*) represents significant difference in the mean values for methylation of individual CpGs using Fisher's exact test (p<0.05). (n) represents the number of sequenced alleles of each sample.

In general, a hypermethylated pattern was observed in DNA isolated from both the blood and sperm for all genes, groups, and animals (Figures 2-5). However, the KDM2A and KMT2D genes of three animals showed a lower methylated pattern [KDM2A/sperm/low S/Co/Bull 4 (57.7%), Figure 2B; KMT2D/blood/low S/Co/Bull 6 (60.2%), Figure 4A; and KMT2D/sperm/control/Bull 2 (54.5%), Figure 4B] as the same animal showed alleles with 100% and 0% methylation. We also found more variation in the methylation profile among the sperm alleles in other animals [KDM5A/sperm/low S/Co/Bull 3 (75.8%), Figure 3B; KMT2D/sperm/low S/Co/Bull 5 (94.1%) and Bull 6 (79.4%), Figure 4B; DOT1L/sperm/control/Bull 2 (86%), Figure 5B; DOT1L/sperm/low S/Co/Bull 3 (88.4%) and Bull 5 (90.1%), Figure 5B], but it did not influence the higher methylation pattern.

Figure 4
DNA methylation profile of KMT2D gene in blood and sperm for control and low S/Co groups. (A) Blood samples, (B) Sperm samples, and (C) Comparative analysis of methylation by CpG sites between control and low S/Co in blood and sperm. Each line represents an individual DNA clone, and each circle represents a CpG dinucleotide. Black circles represent methylated cytosines and white circles represent unmethylated cytosines. The DNA methylation percentage for each animal (Bull 1, Bull 2, Bull 3, Bull 4, Bull 5, and Bull 6) is represented as mean ± standard deviation of the mean. Differences in DNA methylation among animals within the same group are shown by letters a and b (p < 0.05). (n) represents the number of sequenced alleles of each sample.

Figure 3
DNA methylation profile of KDM5A gene in blood and sperm for control and low S/Co groups. (A) Blood samples, (B) Sperm samples, and (C) Comparative analysis of methylation by CpG sites between control and low S/Co in blood and sperm. Each line represents an individual DNA clone, and each circle represents a CpG dinucleotide. Black circles represent methylated cytosines and white circles represent unmethylated cytosines. The DNA methylation percentage for each animal (Bull 1, Bull 2, Bull 3, Bull 4, Bull 5, and Bull 6) is represented as mean ± standard deviation of the mean. Differences in DNA methylation among animals within the same group are shown by letters a and b (p < 0.05). (*) represents significant difference in the mean values for methylation of individual CpGs using Fisher's exact test (p<0.05). (n) represents the number of sequenced alleles of each sample.

Interestingly, when we compared the methylation status of each CpG site individually, we found specific CpGs differentially methylated between control and low S/Co for KDM2A in the blood (CpG 17) and sperm (CpG 25) (Figure 2C), for KDM5A in sperm (CpG 4) (Figure 3C), and DOT1L in sperm (Figure 5C). However, when we compared all CpG sites among themselves, there were no differences in DNA methylation patterns for any of the genes between the control and low S/Co groups in the blood or sperm samples (Figure 6A). Therefore, treatment with a low S/Co diet in the heifers during the pre-and periconceptional periods did not affect the DNA methylation pattern of the gamete and blood cells of the progeny in adulthood for the DMRs analyzed.

Figure 6
Percentage of methylation in KDM2A, KDM5A, KMT2D, and DOT1L genes (A) Comparison of DNA methylation levels between control and low S/Co groups for blood and sperm samples. (B) Comparison of DNA methylation levels in blood and sperm samples in the control and low S/Co groups, respectively. Numbers represent significant differences in the mean values for methylation using the Mann-Whitney test (p ≤ 0.05)

We also analyzed DNA methylation in the blood and sperm tissues of the control and low S/Co groups and found a difference in DNA methylation only in the control groups for KDM2A (Figure 6B); however, despite the statistical difference between the tissues analyzed, all samples were considered hypermethylated.

Discussion

In mammals, extensive epigenomic remodelling occurs during the initial stages of development. During gametogenesis and embryogenesis, epigenetic marks are more vulnerable to environmental influences. In our previous study, we presented DMR candidates for investigation, focusing on the impact of maternal nutrition on foetal epigenetic reprogramming during the pre- and peri-conceptional periods (Nochi et al., 2022). Therefore, to validate whether DMRs in blastocysts are maintained in adulthood, we characterized four DMRs in the sperm and blood from F1 animals.

Our previous study applied the experimental diet during the de novo methylation phase of F0 gametogenesis after the animals reached puberty (Nochi et al., 2022). Although Nochi et al. (2022) found an altered DNA methylation pattern in the blastocyst stage between the low S/Co and control groups in their study, we identified a hypermethylated pattern for both groups in all the DMRs analyzed in both the blood and sperm DNA of F1. This result suggests that embryos from both groups reprogrammed their epigenetic profiles correctly in the blood and sperm cells during development. Thus, epigenetic reprogramming during embryogenesis prevents the transmission of F0 gametic epimutations to F1.

Despite a second wave of epigenetic reprogramming, some regions are not reprogrammed during embryogenesis. The DMRs established during gametogenesis are known as germ line DMRs (gDMRs). Those that are reprogrammed are known as transient DMRs (tDMRs) (Proudhon et al., 2012; Smallwood and Kelsey, 2012). In contrast, the imprinted DMRs (iDMRs) are those DMRs that are protected from loss of methylation after fertilization and are not methylated during embryo or tissue differentiation (Proudhon et al., 2012; MacDonald and Mann, 2014; Thakur et al., 2016). In our study model, the diet on final gametogenesis did not exert a permanent effect in the DMRs studied. However, since iDMRs are protected from reprogramming during embryogenesis, if the diet had affected these DMRs in any way, those effects probably would have been retained into adulthood to create metastable epialleles.

In addition to evaluating DNA methylation patterns in white blood cells in F1 adults, we also analysed DNA methylation in the sperm cells of these animals. Despite the hypermethylated state in the blood and sperm samples, we found more variation in DNA methylation patterns among sperm alleles. Interestingly, several studies in humans and cattle have described the potential use of sperm DNA methylation-epimutations as biomarkers of infertility and susceptibility to diseases (Kropp et al., 2017; Nasri et al., 2017; Capra et al., 2019; Lujan et al., 2019; Garrido et al., 2021). Thus, further studies characterizing whether maternal diet can influence the sperm DNA methylation of the offspring will provide valuable information.

A previous study in humans revealed some sensitive environmental hotspots in the embryonic methylome (Silver et al., 2022). In contrast, a low S/Co diet administered during gametogenesis stochastically affected the embryonic methylome (Nochi et al., 2022). Thus, the regions of the embryonic epigenome that are impacted by the dietary effects may be reprogrammed without deleterious changes in the offspring.

It is well known that the diet during pregnancy may affect the offspring. Several studies have confirmed the effect of different maternal diets on the offspring in humans (Roseboom et al., 2006), mice (Guo et al., 2018; Mao et al., 2018; Xie et al., 2018), rats (Carlin et al., 2019; Pedrana et al., 2020), and bovines (Devos et al., 2021; Liu et al., 2021; Noya et al., 2021). Moreover, studies reported that the maternal diet during gestation affects the DNA methylation pattern in the placenta and offspring of mice (Ge et al., 2014; Mahajan et al., 2019; Zhang et al., 2021a), cattle (Liu et al., 2021), and humans (Daniels et al., 2020; Kupers et al., 2022). Interestingly, a study showed that the exposure of IVP embryos to choline in the culture medium alters the DNA methylation profile in the offspring muscle (Estrada-Cortes et al., 2021). However, these studies evaluated the effects during embryogenesis. DMRs, by contrast, are more likely to propagate in the tissue of the offspring when the stimuli affect epigenetic reprogramming beyond the stage of gametogenesis but also embryogenesis. Therefore, determining the time and duration to which the dietary stimuli exert its effect is essential to study and understand the consequences of the maternal diet on the offspring.

Interestingly, studies in livestock have only evaluated the dietary effects during the final stages of de novo methylation (Sinclair et al., 2007; Zglejc-Waszak et al., 2019; Toschi et al., 2020), but Nochi et al. (2022) evaluated the impact of nutrition starting from the initial stage of de novo methylation during gametogenesis. A broad experimental design for the study of environmental influence on gametogenesis should contemplate the erasure of DNA methylation during foetal programming and ensure the dietary effect on oocytes during de novo methylation. However, this experimental design is easier to implement in mice models than it is in cattle because of its expensive and time-consuming nature. Moreover, based on our observations, embryonic methylome can be used only as an initial screening tool because DMRs may be reprogrammed in the final stages of de novo methylation during embryogenesis and foetal growth; therefore, it is crucial to validate the DMRs in adulthood.

Conclusion

In this study, we characterized the DMRs identified in the previous experiment, which showed that the pre-and periconceptional diet affected the DNA methylation profile of embryos. Among the 2,320 DMRs identified in blastocysts by Nochi et al. (2022), the six that we analyzed underwent extensive epigenetic reprogramming in both blood and sperm cells. These results confirm our hypothesis that the DMRs found in embryos may not be maintained in adult animals. Thus, we suggest that after the first screening using WGBS, it is crucial to confirm the inheritance before projecting the embryonic methylome onto adult tissues.

Acknowledgements

We thank CNPq, Brazil and Embrapa Genetic Resources and Biotechnology, Brazil, for providing support for this study.

• Financial support: LNV received funding for this research from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) (grant number 141116/2020-0). MMF received funding for this research from Embrapa Recursos Genéticos e Biotecnologia.
• How to cite: Vargas LN, Nochi ARF, Castro PS, Cunha ATM, Silva TCF, Togawa RC, Silveira MM, Caetano AR, Franco MM. Differentially methylated regions identified in bovine embryos are not observed in adulthood. Anim Reprod. 2023;20(1):e20220076. https://doi.org/10.1590/1984-3143-AR2022-0076

References

• Almeida DL, Pavanello A, Saavedra LP, Pereira TS, Castro-Prado MAA, Mathias PCF. Environmental monitoring and the developmental origins of health and disease. J Dev Orig Health Dis. 2019;10(6):608-15. http://dx.doi.org/10.1017/S2040174419000151
  » http://dx.doi.org/10.1017/S2040174419000151
• Canovas S, Ross PJ, Kelsey G, Coy P. DNA Methylation in Embryo Development: Epigenetic Impact of ART (Assisted Reproductive Technologies). BioEssays. 2017;39(11):1700106. http://dx.doi.org/10.1002/bies.201700106
  » http://dx.doi.org/10.1002/bies.201700106
• Capra E, Lazzari B, Turri F, Cremonesi P, Portela AMR, Ajmone-Marsan P, Stella A, Pizzi F. Epigenetic analysis of high and low motile sperm populations reveals methylation variation in satellite regions within the pericentromeric position and in genes functionally related to sperm DNA organization and maintenance in Bos taurus. BMC Genomics. 2019;20(1):940. http://dx.doi.org/10.1186/s12864-019-6317-6
  » http://dx.doi.org/10.1186/s12864-019-6317-6
• Carlin G, Chaumontet C, Blachier F, Barbillon P, Darcel N, Blais A, Delteil C, Guillin FM, Blat S, van der Beek EM, Kodde A, Tome D, Davila AM. Maternal high-protein diet during pregnancy modifies rat offspring body weight and insulin signalling but not macronutrient preference in adulthood. Nutrients. 2019;11(1):96. http://dx.doi.org/10.3390/nu11010096
  » http://dx.doi.org/10.3390/nu11010096
• Carvalho JO, Michalczechen‐Lacerda VA, Sartori R, Rodrigues FC, Bravim O, Franco MM, Dode MA. The methylation patterns of the IGF2 and IGF2R genes in bovine spermatozoa are not affected by flow‐cytometric sex sorting. Mol Reprod Dev. 2012;79(2):77-84. http://dx.doi.org/10.1002/mrd.21410
  » http://dx.doi.org/10.1002/mrd.21410
• Cropley JE, Suter CM, Beckman KB, Martin DIK. Germ-line epigenetic modification of the murine Avy allele by nutritional supplementation. Proc Natl Acad Sci USA. 2006;103(46):17308-12. http://dx.doi.org/10.1073/pnas.0607090103
  » http://dx.doi.org/10.1073/pnas.0607090103
• Daniels TE, Sadovnikoff AI, Ridout KK, Lesseur C, Marsit CJ, Tyrka AR. Associations of maternal diet and placenta leptin methylation. Mol Cell Endocrinol. 2020;505:110739. http://dx.doi.org/10.1016/j.mce.2020.110739
  » http://dx.doi.org/10.1016/j.mce.2020.110739
• Davis TL, Yang GJ, McCarrey JR, Bartolomei MS. The H19 methylation imprint is erased and re‐established differentially on the parental alleles during male germ cell development. Hum Mol Genet. 2000;9(19):2885-94. http://dx.doi.org/10.1093/hmg/9.19.2885
  » http://dx.doi.org/10.1093/hmg/9.19.2885
• Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, Wolf J, Reik W. Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc Natl Acad Sci USA. 2001;98(24):13734-8. http://dx.doi.org/10.1073/pnas.241522698
  » http://dx.doi.org/10.1073/pnas.241522698
• Devos J, Behrouzi A, Paradis F, Straathof C, Li C, Colazo M, Block H, Fitzsimmons C. Genetic potential for residual feed intake and diet fed during early- to mid-gestation influences post-natal DNA methylation of imprinted genes in muscle and liver tissues in beef cattle. J Anim Sci. 2021;99(5):skab140. http://dx.doi.org/10.1093/jas/skab140
  » http://dx.doi.org/10.1093/jas/skab140
• Duan JE, Jiang ZC, Alqahtani F, Mandoiu I, Dong H, Zheng X, Marjani SL, Chen J, Tian XC. Methylome dynamics of bovine gametes and in vivo early embryos. Front Genet. 2019;10:512. http://dx.doi.org/10.3389/fgene.2019.00512
  » http://dx.doi.org/10.3389/fgene.2019.00512
• Estrada-Cortes E, Ortiz W, Rabaglino MB, Block J, Rae O, Jannaman EA, Xiao Y, Hansen PJ. Choline acts during preimplantation development of the bovine embryo to program postnatal growth and alter muscle DNA methylation. FASEB J. 2021;35(10):e21926. http://dx.doi.org/10.1096/fj.202100991R
  » http://dx.doi.org/10.1096/fj.202100991R
• Fagundes NS, Michalczechen-Lacerda VA, Caixeta ES, Machado GM, Rodrigues FC, Melo EO, Dode MA, Franco MM. Methylation status in the intragenic differentially methylated region of the IGF2 locus in Bos taurus indicus oocytes with different developmental competencies. Mol Hum Reprod. 2011;17(2):85-91. http://dx.doi.org/10.1093/molehr/gaq075
  » http://dx.doi.org/10.1093/molehr/gaq075
• Finer S, Iqbal MS, Lowe R, Ogunkolade BW, Pervin S, Mathews C, Smart M, Alam DS, Hitman GA. Is famine exposure during developmental life in rural Bangladesh associated with a metabolic and epigenetic signature in young adulthood? A historical cohort study. BMJ Open. 2016;6(11):e011768. http://dx.doi.org/10.1136/bmjopen-2016-011768
  » http://dx.doi.org/10.1136/bmjopen-2016-011768
• Garrido N, Cruz F, Egea RR, Simon C, Sadler-Riggleman I, Beck D, Nilsson E, Ben Maamar M, Skinner MK. Sperm DNA methylation epimutation biomarker for paternal offspring autism susceptibility. Clin Epigenetics. 2021;13(1):6. http://dx.doi.org/10.1186/s13148-020-00995-2
  » http://dx.doi.org/10.1186/s13148-020-00995-2
• Ge ZJ, Luo SM, Lin F, Liang QX, Huang L, Wei YC, Hou Y, Han ZM, Schatten H, Sun QY. DNA methylation in oocytes and liver of female mice and their offspring: effects of high-fat-diet-induced obesity. Environ Health Perspect. 2014;122(2):159-64. http://dx.doi.org/10.1289/ehp.1307047
  » http://dx.doi.org/10.1289/ehp.1307047
• Greenberg MVC, Bourc’his D. The diverse roles of DNA methylation in mammalian development and disease. Nat Rev Mol Cell Biol. 2019;20(10):590-607. http://dx.doi.org/10.1038/s41580-019-0159-6
  » http://dx.doi.org/10.1038/s41580-019-0159-6
• Guo H, Zhu P, Yan L, Li R, Hu B, Lian Y, Yan J, Ren X, Lin S, Li J, Jin X, Shi X, Liu P, Wang X, Wang W, Wei Y, Li X, Guo F, Wu X, Fan X, Yong J, Wen L, Xie SX, Tang F, Qiao J. The DNA methylation landscape of human early embryos. Nature. 2014;511(7511):606-10. http://dx.doi.org/10.1038/nature13544
  » http://dx.doi.org/10.1038/nature13544
• Guo Y, Wang Z, Chen L, Tang L, Wen S, Liu Y, Yuan J. Diet induced maternal obesity affects offspring gut microbiota and persists into young adulthood. Food Funct. 2018;9(8):4317-27. http://dx.doi.org/10.1039/C8FO00444G
  » http://dx.doi.org/10.1039/C8FO00444G
• Ivanova E, Canovas S, Garcia-Martinez S, Romar R, Lopes JS, Rizos D, Sanchez-Calabuig MJ, Krueger F, Andrews S, Perez-Sanz F, Kelsey G, Coy P. DNA methylation changes during preimplantation development reveal inter-species differences and reprogramming events at imprinted genes. Clin Epigenetics. 2020;12(1):64. http://dx.doi.org/10.1186/s13148-020-00857-x
  » http://dx.doi.org/10.1186/s13148-020-00857-x
• Kafri T, Ariel M, Brandeis M, Shemer R, Urven L, McCarrey J, Cedar H, Razin A. Developmental pattern of gene-specific DNA methylation in the mouse embryo and germ line. Genes Dev. 1992;6(5):705-14. http://dx.doi.org/10.1101/gad.6.5.705
  » http://dx.doi.org/10.1101/gad.6.5.705
• Kang Y-K, Koo D-B, Park J-S, Choi Y-H, Chung A-S, Lee K-K, Han Y-M. Aberrant methylation of donor genome in cloned bovine embryos. Nat Genet. 2001;28(2):173-7. http://dx.doi.org/10.1038/88903
  » http://dx.doi.org/10.1038/88903
• Knight AK, Park HJ, Hausman DB, Fleming JM, Bland VL, Rosa G, Kennedy EM, Caudill MA, Malysheva O, Kauwell GPA, Sokolow A, Fisher S, Smith AK, Bailey LB. Association between one-carbon metabolism indices and DNA methylation status in maternal and cord blood. Sci Rep. 2018;8(1):16873. http://dx.doi.org/10.1038/s41598-018-35111-1
  » http://dx.doi.org/10.1038/s41598-018-35111-1
• Kropp J, Carrillo JA, Namous H, Daniels A, Salih SM, Song J, Khatib H. Male fertility status is associated with DNA methylation signatures in sperm and transcriptomic profiles of bovine preimplantation embryos. BMC Genomics. 2017;18(1):280. http://dx.doi.org/10.1186/s12864-017-3673-y
  » http://dx.doi.org/10.1186/s12864-017-3673-y
• Kumaki Y, Oda M, Okano M. QUMA: quantification tool for methylation analysis. Nucleic Acids Res. 2008;36(Suppl 2):W170-5. http://dx.doi.org/10.1093/nar/gkn294
  » http://dx.doi.org/10.1093/nar/gkn294
• Kupers LK, Fernandez-Barres S, Nounu A, Friedman C, Fore R, Mancano G, Dabelea D, Rifas-Shiman SL, Mulder RH, Oken E, Johnson L, Bustamante M, Jaddoe VWV, Hivert MF, Starling AP, de Vries JHM, Sharp GC, Vrijheid M, Felix JF. Maternal Mediterranean diet in pregnancy and newborn DNA methylation: a meta-analysis in the PACE Consortium. Epigenetics. 2022;17(11):1419-31. http://dx.doi.org/10.1080/15592294.2022.2038412
  » http://dx.doi.org/10.1080/15592294.2022.2038412
• Lapehn S, Paquette AG. The placental epigenome as a molecular link between prenatal exposures and fetal health outcomes through the DOHaD hypothesis. Curr Environ Health Rep. 2022;9:490-501. http://dx.doi.org/10.1007/s40572-022-00354-8
  » http://dx.doi.org/10.1007/s40572-022-00354-8
• Lee J, Inoue K, Ono R, Ogonuki N, Kohda T, Kaneko-Ishino T, Ogura A, Ishino F. Erasing genomic imprinting memory in mouse clone embryos produced from day 11.5 primordial germ cells. Development. 2002;129(8):1807-17. http://dx.doi.org/10.1242/dev.129.8.1807
  » http://dx.doi.org/10.1242/dev.129.8.1807
• Li L-C, Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics. 2002;18(11):1427-31. vailable http://dx.doi.org/10.1093/bioinformatics/18.11.1427
  » http://dx.doi.org/10.1093/bioinformatics/18.11.1427
• Liu L, Amorin R, Moriel P, DiLorenzo N, Lancaster PA, Penagaricano F. Maternal methionine supplementation during gestation alters alternative splicing and DNA methylation in bovine skeletal muscle. BMC Genomics. 2021;22(1):780. http://dx.doi.org/10.1186/s12864-021-08065-4
  » http://dx.doi.org/10.1186/s12864-021-08065-4
• Lujan S, Caroppo E, Niederberger C, Arce JC, Sadler-Riggleman I, Beck D, Nilsson E, Skinner MK. Sperm DNA Methylation Epimutation Biomarkers for Male Infertility and FSH Therapeutic Responsiveness. Sci Rep. 2019;9(1):16786. http://dx.doi.org/10.1038/s41598-019-52903-1
  » http://dx.doi.org/10.1038/s41598-019-52903-1
• MacDonald WA, Mann MR. Epigenetic regulation of genomic imprinting from germ line to preimplantation. Mol Reprod Dev. 2014;81(2):126-40. http://dx.doi.org/10.1002/mrd.22220
  » http://dx.doi.org/10.1002/mrd.22220
• Mahajan A, Sapehia D, Thakur S, Mohanraj PS, Bagga R, Kaur J. Effect of imbalance in folate and vitamin B12 in maternal/parental diet on global methylation and regulatory miRNAs. Sci Rep. 2019;9(1):17602. http://dx.doi.org/10.1038/s41598-019-54070-9
  » http://dx.doi.org/10.1038/s41598-019-54070-9
• Mao J, Pennington KA, Talton OO, Schulz LC, Sutovsky M, Lin Y, Sutovsky P. In utero and postnatal exposure to high fat, high sucrose diet suppressed testis apoptosis and reduced sperm count. Sci Rep. 2018;8(1):7622. http://dx.doi.org/10.1038/s41598-018-25950-3
  » http://dx.doi.org/10.1038/s41598-018-25950-3
• Martinez D, Pentinat T, Ribo S, Daviaud C, Bloks VW, Cebria J, Villalmanzo N, Kalko SG, Ramon-Krauel M, Diaz R, Plosch T, Tost J, Jimenez-Chillaron JC. In utero undernutrition in male mice programs liver lipid metabolism in the second-generation offspring involving altered Lxra DNA methylation. Cell Metab. 2014;19(6):941-51. http://dx.doi.org/10.1016/j.cmet.2014.03.026
  » http://dx.doi.org/10.1016/j.cmet.2014.03.026
• Moreno-Fernandez J, Ochoa JJ, Lopez-Frias M, Diaz-Castro J. Impact of early nutrition, physical activity and sleep on the fetal programming of disease in the pregnancy: a narrative review. Nutrients. 2020;12(12):3900. http://dx.doi.org/10.3390/nu12123900
  » http://dx.doi.org/10.3390/nu12123900
• Nasri F, Gharesi-Fard B, Namavar Jahromi B, Farazi-Fard MA, Banaei M, Davari M, Ebrahimi S, Anvar Z. Sperm DNA methylation of H19 imprinted gene and male infertility. Andrologia. 2017;49(10):e12766. http://dx.doi.org/10.1111/and.12766
  » http://dx.doi.org/10.1111/and.12766
• Nochi ARF, Vargas LN, Sartori R, Junior RG, Araujo DB, Figueiredo RA, Togawa RC, Costa MMC, Grynberg P, Mendonca AS, Kussano NR, Pivato I, Silva BDM, Spricigo JFW, Leme LO, da Silva JP, Caetano AR, Dode MAN, Franco MM. Low levels of sulfur and cobalt during the pre- and periconceptional periods affect the oocyte yield of donors and the DNA methylome of preimplantation bovine embryos. J Dev Orig Health Dis. 2022;13(2):231-43. http://dx.doi.org/10.1017/S2040174421000222
  » http://dx.doi.org/10.1017/S2040174421000222
• Noya A, Ripoll G, Casasus I, Sanz A. Long-term effects of early maternal undernutrition on the growth, physiological profiles, carcass and meat quality of male beef offspring. Res Vet Sci. 2021;142:1-11. http://dx.doi.org/10.1016/j.rvsc.2021.10.025
  » http://dx.doi.org/10.1016/j.rvsc.2021.10.025
• Obata Y, Kaneko-Ishino T, Koide T, Takai Y, Ueda T, Domeki I, Shiroishi T, Ishino F, Kono T. Disruption of primary imprinting during oocyte growth leads to the modified expression of imprinted genes during embryogenesis. Development. 1998;125(8):1553-60. http://dx.doi.org/10.1242/dev.125.8.1553
  » http://dx.doi.org/10.1242/dev.125.8.1553
• Oswald J, Engemann S, Lane N, Mayer W, Olek A, Fundele R, Dean W, Reik W, Walter J. Active demethylation of the paternal genome in the mouse zygote. Curr Biol. 2000;10(8):475-8. http://dx.doi.org/10.1016/S0960-9822(00)00448-6
  » http://dx.doi.org/10.1016/S0960-9822(00)00448-6
• Pedrana G, Viotti H, Lombide P, Cavestany D, Martin GB, Vickers MH, Sloboda DM. Maternal undernutrition during pregnancy and lactation affects testicular morphology, the stages of spermatogenic cycle, and the testicular IGF-I system in adult offspring. J Dev Orig Health Dis. 2020;11(5):473-83. http://dx.doi.org/10.1017/S2040174420000306
  » http://dx.doi.org/10.1017/S2040174420000306
• Proudhon C, Duffie R, Ajjan S, Cowley M, Iranzo J, Carbajosa G, Saadeh H, Holland ML, Oakey RJ, Rakyan VK, Schulz R, Bourc’his D. Protection against de novo methylation is instrumental in maintaining parent-of-origin methylation inherited from the gametes. Mol Cell. 2012;47(6):909-20. http://dx.doi.org/10.1016/j.molcel.2012.07.010
  » http://dx.doi.org/10.1016/j.molcel.2012.07.010
• Reik W, Dean W, Walter J. Epigenetic reprogramming in mammalian development. Science. 2001;293(5532):1089-93. http://dx.doi.org/10.1126/science.1063443
  » http://dx.doi.org/10.1126/science.1063443
• Roseboom T, de Rooij S, Painter R. The Dutch famine and its long-term consequences for adult health. Early Hum Dev. 2006;82(8):485-91. http://dx.doi.org/10.1016/j.earlhumdev.2006.07.001
  » http://dx.doi.org/10.1016/j.earlhumdev.2006.07.001
• Sasaki H, Matsui Y. Epigenetic events in mammalian germ-cell development: reprogramming and beyond. Nat Rev Genet. 2008;9(2):129-40. http://dx.doi.org/10.1038/nrg2295
  » http://dx.doi.org/10.1038/nrg2295
• Serrano-Perez B, Molina E, Noya A, Lopez-Helguera I, Casasus I, Sanz A, Villalba D. Maternal nutrient restriction in early pregnancy increases the risk of late embryo loss despite no effects on peri-implantation interferon-stimulated genes in suckler beef cattle. Res Vet Sci. 2020;128:69-75. http://dx.doi.org/10.1016/j.rvsc.2019.10.023
  » http://dx.doi.org/10.1016/j.rvsc.2019.10.023
• Silveira MM, Bayão HXS, dos Santos Mendonça A, Borges NA, Vargas LN, Caetano AR, Rumpf R, Franco MM. DNA methylation profile at a satellite region is associated with aberrant placentation in cloned calves. Placenta. 2018;70:25-33. http://dx.doi.org/10.1016/j.placenta.2018.08.007
  » http://dx.doi.org/10.1016/j.placenta.2018.08.007
• Silver MJ, Saffari A, Kessler NJ, Chandak GR, Fall CHD, Issarapu P, Dedaniya A, Betts M, Moore SE, Routledge MN, Herceg Z, Cuenin C, Derakhshan M, James PT, Monk D, Prentice AM. Environmentally sensitive hotspots in the methylome of the early human embryo. eLife. 2022;11:e72031. http://dx.doi.org/10.7554/eLife.72031
  » http://dx.doi.org/10.7554/eLife.72031
• Sinclair KD, Allegrucci C, Singh R, Gardner DS, Sebastian S, Bispham J, Thurston A, Huntley JF, Rees WD, Maloney CA, Lea RG, Craigon J, McEvoy TG, Young LE. DNA methylation, insulin resistance, and blood pressure in offspring determined by maternal periconceptional B vitamin and methionine status. Proc Natl Acad Sci USA. 2007;104(49):19351-6. http://dx.doi.org/10.1073/pnas.0707258104
  » http://dx.doi.org/10.1073/pnas.0707258104
• Skvortsova K, Iovino N, Bogdanovic O. Functions and mechanisms of epigenetic inheritance in animals. Nat Rev Mol Cell Biol. 2018;19(12):774-90. http://dx.doi.org/10.1038/s41580-018-0074-2
  » http://dx.doi.org/10.1038/s41580-018-0074-2
• Smallwood SA, Kelsey G. De novo DNA methylation: a germ cell perspective. Trends Genet. 2012;28(1):33-42. http://dx.doi.org/10.1016/j.tig.2011.09.004
  » http://dx.doi.org/10.1016/j.tig.2011.09.004
• Stevens ME, Maidens PM, Robinson ES, Vandeberg JL, Pedersen RA, Monk M. DNA methylation in the developing marsupial embryo. Development. 1988;103(4):719-24. http://dx.doi.org/10.1242/dev.103.4.719
  » http://dx.doi.org/10.1242/dev.103.4.719
• Thakur A, Mackin SJ, Irwin RE, O’Neill KM, Pollin G, Walsh C. Widespread recovery of methylation at gametic imprints in hypomethylated mouse stem cells following rescue with DNMT3A2. Epigenetics Chromatin. 2016;9(1):53. http://dx.doi.org/10.1186/s13072-016-0104-2
  » http://dx.doi.org/10.1186/s13072-016-0104-2
• Tobi EW, Slieker RC, Stein AD, Suchiman HE, Slagboom PE, van Zwet EW, Heijmans BT, Lumey LH. Early gestation as the critical time-window for changes in the prenatal environment to affect the adult human blood methylome. Int J Epidemiol. 2015;44(4):1211-23. http://dx.doi.org/10.1093/ije/dyv043
  » http://dx.doi.org/10.1093/ije/dyv043
• Toschi P, Capra E, Anzalone DA, Lazzari B, Turri F, Pizzi F, Scapolo PA, Stella A, Williams JL, Marsan PA, Loi P. Maternal peri-conceptional undernourishment perturbs offspring sperm methylome. Reproduction. 2020;159(5):513-23. http://dx.doi.org/10.1530/REP-19-0549
  » http://dx.doi.org/10.1530/REP-19-0549
• Wadhwa PD, Buss C, Entringer S, Swanson JM. Developmental origins of health and disease: brief history of the approach and current focus on epigenetic mechanisms. Semin Reprod Med. 2009;27(5):358-68. http://dx.doi.org/10.1055/s-0029-1237424
  » http://dx.doi.org/10.1055/s-0029-1237424
• Wang X, Lan X, Radunz AE, Khatib H. Maternal nutrition during pregnancy is associated with differential expression of imprinted genes and DNA methyltranfereases in muscle of beef cattle offspring. J Anim Sci. 2015;93(1):35-40. http://dx.doi.org/10.2527/jas.2014-8148
  » http://dx.doi.org/10.2527/jas.2014-8148
• Xie R, Sun Y, Wu J, Huang S, Jin G, Guo Z, Zhang Y, Liu T, Liu X, Cao X, Wang B, Cao H. Maternal high fat diet alters gut microbiota of offspring and exacerbates DSS-induced colitis in adulthood. Front Immunol. 2018;9:2608. http://dx.doi.org/10.3389/fimmu.2018.02608
  » http://dx.doi.org/10.3389/fimmu.2018.02608
• Xu R, Li C, Liu X, Gao S. Insights into epigenetic patterns in mammalian early embryos. Protein Cell. 2021;12(1):7-28. http://dx.doi.org/10.1007/s13238-020-00757-z
  » http://dx.doi.org/10.1007/s13238-020-00757-z
• Zglejc-Waszak K, Waszkiewicz EM, Franczak A. Periconceptional undernutrition affects the levels of DNA methylation in the peri-implantation pig endometrium and in embryos. Theriogenology. 2019;123:185-93. http://dx.doi.org/10.1016/j.theriogenology.2018.10.002
  » http://dx.doi.org/10.1016/j.theriogenology.2018.10.002
• Zhang S, Chen X, Wang F, An X, Tang B, Zhang X, Sun L, Li Z. Aberrant DNA methylation reprogramming in bovine SCNT preimplantation embryos. Sci Rep. 2016;6(1):1-11. http://dx.doi.org/10.1038/srep30345
  » http://dx.doi.org/10.1038/srep30345
• Zhang Q, Xiao X, Zheng J, Li M, Yu M, Ping F, Wang T, Wang X. Maternal high-fat diet disturbs the DNA methylation profile in the brown adipose tissue of offspring mice. Front Endocrinol (Lausanne). 2021a;12:705827. http://dx.doi.org/10.3389/fendo.2021.705827
  » http://dx.doi.org/10.3389/fendo.2021.705827
• Zhang Z, Xu J, Lyu S, Xin X, Shi Q, Huang Y, Yu X, Zhu X, Li Z, Wang X, Lang L, Xu Z, Wang E. Whole-genome DNA methylation dynamics of sheep preimplantation embryo investigated by single-cell DNA methylome sequencing. Front Genet. 2021b;12:753144. http://dx.doi.org/10.3389/fgene.2021.753144
  » http://dx.doi.org/10.3389/fgene.2021.753144
• Zhou F, Wang R, Yuan P, Ren Y, Mao Y, Li R, Lian Y, Li J, Wen L, Yan L, Qiao J, Tang F. Reconstituting the transcriptome and DNA methylome landscapes of human implantation. Nature. 2019;572:660-4. http://dx.doi.org/10.1038/s41586-019-1500-0
  » http://dx.doi.org/10.1038/s41586-019-1500-0
• Zhu P, Guo H, Ren Y, Hou Y, Dong J, Li R, Lian Y, Fan X, Hu B, Gao Y, Wang X, Wei Y, Liu P, Yan J, Ren X, Yuan P, Yuan Y, Yan Z, Wen L, Yan L, Qiao J, Tang F. Single-cell DNA methylome sequencing of human preimplantation embryos. Nat Genet. 2018;50(1):12-9. http://dx.doi.org/10.1038/s41588-017-0007-6
  » http://dx.doi.org/10.1038/s41588-017-0007-6

Publication Dates

• Publication in this collection
  13 Mar 2023
• Date of issue
  2023

History

• Received
  08 Aug 2022
• Accepted
  14 Feb 2023