Genetic polymorphisms of CYP2B6*6, CYP2C8*3 and CYP2D6*4 in vivax malaria patients from Brazilian Amazon

Abstract

Genetic variability in the host metabolism of antimalarial drugs influenced by the polymorphisms of cytochrome P450 (CYP) could lead to significant changes in antimalarial treatment response. However, little is known about the frequency of alleles CYP2B6, CYP2C8, and CYP2D6 in an Amazonian population, especially with vivax malaria. Therefore, this study aimed to determine the frequency of CYP alleles CYP2B6*6, CYP2C8*3, and CYP2D6*4 in patients with vivax malaria. The study included 231 patients with vivax malaria treated at a health care reference in Manaus, northern Brazil. A sample of peripheral blood from each subject was collected to perform DNA extraction and genotypic analysis. Genotyping of polymorphisms was performed by allelic discrimination using Real-time polymerase chain reaction. The CYP2D6*4 allele was the most prevalent among patients who developed severe malaria. The frequencies of the CYP2B6*6 and CYP2D6*4 were not different between the severe and uncomplicated malaria. There was a significant association between heterozygous CYP2D6*4 and severe cases of malaria. The results are in agreement with other reports described in the literature for different populations. Future studies are needed to understand the clinical implications of the polymorphisms in patients with vivax malaria.

Keywords:
Malaria; Metabolism; CYP; Pharmacogenetics.

INTRODUCTION

Malaria is an infectious-parasitic disease that affects the health of different populations distributed in endemic areas around the world (Westenberger et al., 2010). The majority of reported cases of the disease in Latin America are concentrated in Brazil, and the agent with the highest prevalence is Plasmodium vivax (Oliveira-Ferreira et al., 2010; WHO, 2011).

In the past, vivax malaria was considered a benign and self-limiting disease. However, studies have demonstrated the importance of this species in the development of severe forms of the disease, previously attributed only to P. falciparum in different parts of the world, including deaths (Kochar et al., 2005).

According to World Health Organization (WHO) criteria (2010), severe malaria is defined as an infection with complications that are potentially fatal to humans. Among the main clinical manifestations described in the literature for severe P. vivax malaria, some follow:kell severe anemia, thrombocytopenia, respiratory distress syndrome, neurological syndrome, renal failure, pulmonary edema, spleen rupture, jaundice, metabolic acidosis, and hypoglycemia (Alexandre et al., 2010).

There is ample knowledge and publications on the type of clinical manifestations that have been commonly observed in severe vivax malaria. However, comparatively little is known about the pathophysiological mechanisms involved in severe P. vivax malaria, as well as the influence of genetic factors in increasing individual susceptibility of the host to the development of severe forms of the disease.

Adequate antimalarial therapy is employed in order to avoid the clinical progression of the infection. According to Mehlotra, Henry-Halldin and Zimmerman (2009), the response to antimalarial treatment may be virtually determined by the plasma concentration of active drug or metabolite in the blood. These authors also consider that the genetic variability of the host in the metabolism of antimalarial drugs could generate inadequate plasma concentrations, contributing to therapeutic inefficacy due to sub-therapeutic levels or even to the selection of resistant parasites.

Metabolism is an extremely important pharmacokinetic step for the drug to reach adequate plasma concentrations at its site of action. There is a large inter-individual variety in the pharmacokinetic profile of many antimalarial agents that may result in alteration in plasma drug concentration (Kerb et al., 2009). Cytochrome P450 (CYP) enzymes are mainly responsible for the metabolism of antimalarials in the body (Guzmán, Carmona-Fonseca, 2006). These enzymes are highly polymorphic and these differences, in isolation or associated with other factors, may contribute to the variability in the therapeutic response (cure, relapse, or resistance) or in the toxicity often reported with the use of antimalarials (Tomalik-Scharte et al., 2008; Kerb et al., 2009).

In addition, the CYP isoform genes have been frequently reported in the literature associated with changes in the metabolic profile of isoforms for various drugs, including antimalarials (Parikh et al., 2007, Tiong et al., 2010). Several CYP enzymes are involved in the metabolism of antimalarial drugs (Guzmán, Carmona-Fonseca, 2006). Among the main antimalarials currently used, some are listed: chloroquine (CYP2C8, CYP3A4, CYP2D6) (Projean et al., 2003); primaquine (CYP1A2, CYP2B6, CYP2D6, CYP3A4) (Li et al., 2003; Ganesan et al., 2009); mefloquine (CYP3A4) (Li et al., 2003); artemether (CYP2B6, CYP3A4) (Honda et al., 2011); (CYP2A6) (Yusof, Hua, 2012), and amodiaquine (CYP2C8) (Honda et al., 2011).

Studies that describe the prevalence of polymorphisms in areas endemic to malaria or even that relate antimalarial therapeutic efficacy to the phenotypic and genotypic characteristics of CYP are scarce. Studies in patients with malaria classified some individuals as poor metabolizers when they had certain polymorphisms in the isoforms CYP2C8 and CYP2C19, responsible for the metabolism of the drugs amodiaquine and proguanil, respectively (Cavaco et al. 2006, Parikh et al., 2007). More recently, Honda et al. (2011) reported the participation of different alleles of CYP2B6 involved in the demethylation of artesunate. However, it is necessary to carry out other studies to better understand the clinical significance of the influence of polymorphisms in these enzymes on the therapeutic efficacy of antimalarial drugs.

CYP2B6 is expressed primarily in the liver, comprising about 2 to 10 % of the total hepatic CYP content, and in some extrahepatic tissues including the kidney, brain, intestine and skin (Wang, Tompkins, 2008). This isoform plays an important role in the metabolism of drugs such as antineoplastic agents, anticonvulsants, benzodiazepines, and antimalarials such as those derived from artemisinin and primaquine (Ganesan et al., 2009; Honda et al., 2011).

Polymorphisms in CYP2B6*6, predominantly CYP2B6: 516GT, are associated with pharmacokinetic changes with important clinical repercussions for some substrates. This variant has often been associated with reduced CYP2B6 enzyme activity, elevated plasma concentration, reduced clearance and consequent increased neurotoxicity of efavirenz. In addition is the increased risk of developing drug resistance with efavirenz due to discontinuation of treatment after experiencing adverse effects in patients (Haas et al., 2004; Gounden et al., 2010).

CYP2C9 is responsible for the oxidative metabolism of important pharmacological classes including some antimalarials (chloroquine, amodiaquine, dapsone), hypoglycemic agents (repaglinide, rosiglitazone), chemotherapeutics (paclitaxolpaclitaxel), and hypolipemics (simvastatin) (Kim et al., 2003; Ingelman-Sundberg et al., 2007).

The CYP2C8*3 allele is characterized by the presence of two variants, CYP2C8 416G>A (rs11572080, Arg139Lys) and CYP2C8 1196A> G (rs10509681, Lys399Arg), exons 3 and 8, respectively (Dai et al., 2001). It occurs more frequently in Caucasians and rarely in Africans and Asians (Dai et al., 2001; Bahadur et al., 2002; Wu et al., 2013). In a study by Cavaco et al. (2006), the frequency of the CYP2C8*3 allele was 19.8 % among Portuguese Caucasians.

The enzyme CYP2D6 is responsible for the metabolism of approximately 25 % of the drugs used in the clinical practice, with the dose required to achieve the same plasma concentration ranging from 10 to 30 times between the individuals (Ingelman-Sundberg, Rodriguez-Antona, 2005). Among the main classes of drugs metabolized by this enzyme are antimalarials such as chloroquine and primaquine, antidepressants, antipsychotics, antiarrhythmics, beta-blockers, antiemetics, and opioids (Projean et al., 2003; Pybus et al., 2013).

Studies have shown the influence of genetic polymorphisms of CYP2D6 on the therapeutic outcome of central nervous system and cardiovascular disorders, cancer, as well as drug interactions (Rodriguez-Antona et al., 2010; Madlensky et al., 2011). The polymorphism of this enzyme has often been implicated in the ML phenotype (Sachse et al., 1997). However, the role of polymorphisms in this enzyme in CYP2D6 is not known, as well as its influence on clinical response.

However, studies that describe the prevalence of polymorphisms in malaria endemic areas or relate the antimalarial therapeutic response and phenotypic and genotypic characteristics of CYP, or that describe the prevalence of polymorphisms in malaria endemic areas are scarce. There are no descriptions in the literature regarding polymorphisms in CYP genes and a possible association with the severity of P. vivax infection.

Studies of this nature could contribute to the genotypic characterization of individuals from areas endemic to malaria for CYP (the major CYP isoforms involved in antimalarial metabolism), as well as for the understanding of determinants of severe malaria as a function of metabolic alterations, and still allow the discovery of possible molecular markers of risk for the development of severe clinical forms of vivax malaria.

Therefore, the aim of this study was to carry out the molecular characterization of the main cytochrome P450 isoforms involved in the metabolism of antimalarials in patients with Plasmodium vivax malaria.

MATERIAL AND METHODS

Setting and study design

This was an observational, retrospective, case-control study, and samples from the proposal “Clinical characterization of malaria complicated by Plasmodium vivax”, developed at the Tropical Medicine Foundation Dr. Heitor Vieira Dourado - FMT-HVD were used.

Patients with malaria caused by Plasmodium vivax treated at FMT-HDV from March 2012 to April 2015 were included in the study. The diagnosis of malaria was performed by the thick drop method and confirmation of monoinfection by this species was performed by molecular diagnosis - PCR. Clinical-laboratory information was obtained from all individuals, and this information was extracted from the medical records and standardized questionnaires. The study comprised 231 patients. Patients were classified as uncomplicated or severe malaria as described previously, according to WHO recommendations (WHO, 2015).

The study protocol was previously approved by the National Commission for Research Ethics (CONEP), in June 2009, decision no. 343/2009.

Molecular analysis

Genomic DNA was extracted from 300 μL of blood using the commercial Wizard® Genomic DNA Purification Kit, according to the manufacturer’s protocol. After extraction, the DNA was stored at -70 °C until the time of molecular analysis.

Each patient’s DNA was subjected to real-time PCR amplification through StepOnePlus ™ v. 2.0 (Applied Biosystems) using 96-well optical plates and the TaqMan® system for allelic discrimination (Table I).

TABLE I
Probes performed in the Real Time PCR technique

Polimorfism	Allele	Ref. SNP ID	Sequence
15631 G>T	CYP2B6*6	rs37455274	TCATGGACCCCACCTTCCTCTTCCA[G/T]
			TCCATTACCGCCAACATCATCTGCT
2130 G>A	CYP2C8*3	rs11572080	CTCTTGAACACGGTCCTCAATGCTC[C/T]
			TCTTCCCCATCCCAAAATTCCGCAA
1846 G>A	CYP2D6*4	rs3892097	AGACCGTTGGGGCGAAAGGGGCGTC[C/T]
			TGGGGGTGGGAGATGCGGGTAAGGG

• RefSNP accession ID (rs number): https://www.ncbi.nlm.nih.gov/snp/

Statistical Analysis

Results were presented as mean, standard deviation, and percentages. The 1-sided Fisher´s exact test was applied to verify the association of variables and the level of significance was set to P < 0.05. All analyses were performed using SPSS statistical software (version 18.0).

RESULTS AND DISCUSSION

Of the 231 patients with vivax malaria included in the study, 85 (36.8 %) had severe malaria, 136 (58.9 %) of uncomplicated malaria, and 10 (4.3 %) could not be classified as severity due to the absence of clinical-laboratory data, which were evaluated only in relation to allelic frequency.

The mean age was similar between the two groups (31.8 ±24.9 vs 33.5 ± 19.9 - p=0.611), uncomplicated and severe, respectively. The occurrence of severe malaria was higher in male patients (45.5 %) than female (31.2 %) (p=0.020). Interestingly, we found that twice as many (36.1 % versus 63.9 %) patients who reported having been previously infected with Plasmodium did not develop severe disease. Although this relationship was not statistically significant, it is believed that there is clinical protection in patients frequently exposed to malarial infections (Alves et al., 2002; Costa et al., 2011).

The genotypic and allelic frequencies of CYP2B6*6, CYP2C8*3, and CYP2D6*4 are summarized in Table II. The frequency of mutated patients to CYP2B6*6 was 42.2 %, being 27.8 % in heterozygosity (G/T) and 14.3 % in homozygous (T/T). To the CYP2C8*3, only 13.5 %, were found, being all heterozygous patients G/A. To the CYP2D6*4 allele, the frequency of mutated patients was 6.5 %, being 15.2 % heterozygosity (G/A) and 1.3 % homozygous (A/A).

TABLE II
Genotypic and allelic frequency of CYP2B6*6, CYP2C8*3 and CYP2D6*4 in uncomplicated and severe P. vivax malaria patients from Manaus, Amazonas state

Allele	Profile	Genotype	Total		Severe		Uncomplicated		p-value	p-value RP(IC95%)
			(N)	% allele	(N)	% allele	(N)	% allele
CYP2B6*6	Wild	G/G	133		54		75		0.059b
	Mutated	G/T	64	28.26	25	21.76	35	31.48		0.152b
		T/T	33		6		25			0.728 (0.411-1.253)
	Total		230		85		135
CYP2C8*3	Wild	G/G	192		73		111		0.180a
	Mutated	G/A	30	6.76	8	9.87	20	15.27		0.180a
		A/A	0		0		0			0.608 (0.254-1.454)
	Total		222		81		131
CYP2D6*4	Wild	G/G	193		64		121		0.026b
	Mutated	G/A	35	8.87	19	13.52	14	5.88		0.007a
		A/A	3		2		1			2.647 (1.277-5.485)
	Total		231		85		136

• N - Total number of patients; PR - prevalence ratio; CI - confidence interval; p^a - p-value based on Fisher’s exact tests; p^b X²- Yates´s corrections; %allele - mutant allele.

Polymorphisms in CYP enzymes may contribute to variations in efficacy and safety of antimalarial drugs (Tomalik-Scharte et al., 2008). Both efficacy and safety are dependent on plasma concentrations and adequate exposures, since insufficient exposures to the drug are associated with a greater risk of failure or therapeutic resistance while longer exposure is related to a greater chance of developing adverse reactions (Guzmán, Carmona-Fonseca, 2006).

In Brazil, chloroquine and primaquine are still the basis of malaria vivax complications treatment. Antiparasitic activity of these antimalarial drugs is dependent on metabolism (Projean et al., 2003; Ganesan et al., 2009; Pybus et al., 2013) and therefore, polymorphisms in these isoforms may alter the catalytic activity of the enzyme. Studies suggest that the CYP2D6*4 and CYP2C8*3 alleles reduce the catalytic activity of CYP2D6 and CYP2C8 enzymes involved in the metabolism of drugs (Sachse et al., 1997; Paganotti et al., 2011; Stage et al., 2013). Thus, the metabolism of these antimalarial drugs would be involved in the presence of these alleles. Therefore, the hypothesis of the conversion of primaquine and chloroquine in their respective active metabolites would be lower, resulting consequently, in a lower pharmacological effect of antimalarials in patients of these alleles being suggested.

CYP2B6*6 (T), CYP2C8*3 (A) and CYP2D6*4 (A) were 28.26 %, 6.7 %, and 8.87 %, respectively, in the study population. The frequency of these polymorphisms specifically in patients with vivax malaria was not found in the literature. However, the allelic frequencies found in this study were very similar to the data published on the NCBI home page. According to Table III, in general the allelic frequencies found in this study were similar to other reports described in the literature.

TABLE III
Allelic frequencies in patients with vivax malaria compared to other studies published in the literature

Population	Number of patients included	Percentage			Reference
		CYP2B6*6	CYP2C8*3	CYP2D6*4
Brazilians	231	28.2	6.7	8.8	This study
Brazilians	1,034	36.9	9.8	11.7	Suárez-Kurtz et al., 2012
Brazilians	115	-	-	14.5	Maciel et al., 2009
Colombians	152	36.5	-	-	Restrepo et al., 2011
Indians	123	-	12	-	Muthiah et al., 2005
Chinese	123	38	-	-	Hodel et al., 2013
Black Africans	148	34	0	4.1	Hodel et al., 2013
White Europeans	35	28.6	-	-	Lang et al., 2001
Black Europeans	146	34	-	-	Wyen et al., 2008

Genotyping studies conducted in Colombians and Africans for the CYP2B6*6 allele reported a frequency of 36.5 % and 35 %, respectively (Restrepo et al., 2011, Hodel et al., 2013). For CYP2C8*3, a frequency of 0 % among Africans and 2.94 % among Chinese was reported (Hodel et al., 2013, Wu et al., 2013). In the present study, we compared the prevalence of CYP2D6*4 with a frequency of 14.5 % among Brazilians and 4.1 % in Africans (Maciel et al., 2009; Hodel et al., 2013).

Although this study was not designed with the objective of evaluating the impact of the polymorphisms found in the metabolism of antimalarials, some inferences can be made from the pharmacological point of view. Previous studies have reported increased in vivo and in vitro metabolic activity of the CYP2B6 enzyme associated with the CYP2B6*6 variant (Nakajima et al., 2007; Ariyoshi et al., 2011; Honda et al., 2011). It is assumed that the main antimalarial activity of artemisinin derivatives is carried out by dihydroartemisinin (DHA), which is the main active metabolite of this pharmacological group. Therefore, individuals carrying this variant could have higher concentrations of DHA, which, theoretically, would increase the pharmacological effect, thus justifying the higher frequency of carriers of this polymorphism found in the non-severe group.

Likewise, primaquine’s parasitic anti-infectious activity is biotransformation dependent (Ganesan et al., 2009). Heterozygous carriers of this allele tend to have a lower enzymatic activity when compared to those carrying the two functional alleles (Zanger, Schwab, 2013). Thus, primaquine metabolism would be compromised in the presence of the CYP2D6*4 allele, therefore it can be suggested that the conversion of this drug into the active metabolite would be lower, and consequently, result in a lower pharmacological effect of the antimalarial. This would explain the higher frequency of individuals with this polymorphism in the group with severe malaria.

However, we know that such data are not sufficient to evaluate the impact of these polymorphisms on the outcome of the malaria disease, since other factors, not only parasitemia, are necessary to characterize the severity of the disease. In addition, the complexity involving the genotype-metabolism relationship in vivo requires a study designed specifically for this purpose. Polymorphisms in CYP isoforms have been considered as risk factors for development or may interfere with the clinical evolution of diseases. These studies reveal that the importance of CYP may be beyond pharmacogenetics, since polymorphisms in these enzymes can act as adjuvants in the pathogenesis or even interfere with the prognosis of many diseases, regardless of the introduction of drug therapy.

In the specific case of malaria, it is already known that some genetic factors linked to the host, e.g. hemoglobinopathies, offer differential risks to the development of infection with Plasmodium spp. There were no significant differences between the distribution of genotypes, the number of CYP2C8*3 allele carriers, and the severity of malaria. In contrast, for the CYP2D6*4 allele, it was verified that the frequency of polymorphism was higher in the severe group, and there was an association between the heterozygous genotype and the severity of the disease. Yet the chance of severity development among the patients with this polymorphism in this study was 2,647 times higher when compared to non-carriers. However, because it is a pioneering and innovative association of CYP2B6*6, CYP2C8*3, and CYP2D6*4 polymorphisms for the severity of malaria, it was not possible to establish whether these were random or if in fact there was a significant relationship in the evolution of malaria.

Hematological, biochemical and parasitemia data of patients included in this study before or after starting pharmacological treatment were not available, together with the scarcity of data in the literature on the influence of these polymorphisms in current-day antimalarial metabolism in our region, were limiting factors to evaluate the outcome of the polymorphisms studied in the treatment of patients with vivax malaria. This study attempted to describe the frequency of CYP2B6*6, CYP2C8*3, and CYP2D6*4 alleles in patient carriers of vivax malaria and attempt to associate such polymorphisms with the severity of the disease, However, it is important to mention the importance of developing future studies focused on the evaluation of the impact of the pharmacogenetic profile on the metabolism of antimalarials, especially primaquine, the only available drug used in the treatment and prevention of relapses by P. vivax, and also for the confirmation and clarification of the associations found in this study, since only then will it be possible to predict of these genetic factors in the outcome of malaria.

CONCLUSION

This study described the profile of allelic frequencies of some important polymorphisms from metabolizing enzymes in patients suffering from malaria. Based on the results presented in this study, it can be concluded that the frequencies of the CYP2B6*6, CYP2C8*3, and CYP2D6*4 alleles in patient carriers of vivax malaria are in agreement with other reports described in the literature for different populations. The CYP2D6*4 allele was the most prevalent among patients who developed serious malaria. The frequencies of CYP2B6*6 and CYP2D6*4 were not different between the severe and uncomplicated groups. There was a significant association between heterozygous CYP2D6*4 and severe cases of malaria. Further studies are needed to elucidate the role of these polymorphisms in the outcome of vivax malaria.

ACKNOWLEDGMENTS

We thank all patients and staff of the Tropical Medicine Foundation (FMT-HD) for the medical support. The authors also thank the Fundação de Amparo à Pesquisa do Estado do Amazonas (FAPEAM), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) for financial support.

REFERENCES

• Alexandre MA, Ferreira CO, Siqueira AM, Magalhães BL, Mourão MP, Lacerda MV, et al. Severe Plasmodium vivax malaria, Brazilian Amazon. Emerg Infect Dis. 2010;16(10):1611-4.
• Alves FP, Durlacher RR, Menezes MJ, Krieger H, Silva LH, Camargo EP. High prevalence of asymptomatic Plasmodium vivax and Plasmodium falciparum infections in native Amazonian populations. Am J Trop Med Hyg. 2002;66(6):641-8.
• Bahadur N, Leathart JB, Mutch E, Steimel-Crespi D, Dunn SA, Gilissen R, et al. CYP2C8 polymorphisms in Caucasians and their relationship with paclitaxel 6alpha-hydroxylase activity in human liver microsomes. Biochem Pharmacol. 2002;64(11):1579-89.
• Cavaco I, Piedade R, Gil JP, Ribeiro V. CYP2C8 polymorphism among the Portuguese. Clin Chem Lab Med. 2006;44(2):168-70.
• Costa FT, Lopes SC, Ferrer M, Leite JÁ, Martin-Jaular L, Bernabeu M, et al. On cytoadhesion of Plasmodium vivax: raison d’être? Mem Inst Oswaldo Cruz. 2011;106 Suppl 1:79-84.
• Dai D, Zeldin DC, Blaisdell JA, Chanas B, Coulter SJ, Ghanayem BI, et al. Polymorphisms in human CYP2C8 decrease metabolism of the anticancer drug paclitaxel and arachidonic acid. Pharmacogenetics. 2001;11(7):597-607.
• Ganesan S, Tekwani BL, Sahu R, Tripathi LM, Walker LA. Cytochrome P(450)-dependent toxic effects of primaquine on human erythrocytes. Toxicol Appl Pharmacol. 2009;241(1):14-22.
• Gounden V, van Niekerk C, Snyman T, George JA. Presence of the CYP2B6 516G> T polymorphism, increased plasma Efavirenz concentrations and early neuropsychiatric side effects in South African HIV-infected patients. AIDS Res Ther. 2010;7:32.
• Guzmán V, Carmona-Fonseca J. El citocromo P-450 y la respuesta terapéutica a los antimaláricos [Cytochrome P-450 and the response to antimalarial drugs]. Rev Panam Salud Publica. 2006;19(1):9-22.
• Haas DW, Ribaudo HJ, Kim RB, Tierney C, Wilkinson GR, Gulick RM, et al. Pharmacogenetics of efavirenz and central nervous system side effects: an Adult AIDS Clinical Trials Group study. AIDS. 2004;18(18):2391-400.
• Hodel EMS, Csajka C, Ariey F, Guidi M, Kabanywanyi AM, Duong S, et al. Effect of single nucleotide polymorphisms in cytochrome P450 isoenzyme and n-acetyltransferase 2 genes on the metabolism of artemisinin-based combination therapies in malaria patients from Cambodia and Tanzania. Antimicrob Agents Chemother. 2013;57(2):950-8.
• Honda M, Muroi Y, Tamaki Y, Saigusa D, Suzuki N, Tomioka Y, et al. Functional characterization of CYP2B6 allelic variants in demethylation of antimalarial artemether. Drug Metab Dispos. 2011;39(10):1860-5.
• Ingelman-SundbergM,Rodriguez-AntonaC.Pharmacogenetics of drug-metabolizing enzymes: implications for a safer and more effective drug therapy. Philos Trans R Soc Lond B Biol Sci. 2005;360(1460):1563-70.
• Ingelman-Sundberg M, Sim SC, Gomez A, Rodriguez-Antona C. Influence of cytochrome P450 polymorphisms on drug therapies: pharmacogenetic, pharmacoepigenetic and clinical aspects. Pharmacol Ther. 2007;116(3):496-526. doi: 10.1016/j.pharmthera.2007.09.004. Epub 2007 Oct 9.
  » https://doi.org/10.1016/j.pharmthera.2007.09.004
• Kerb R, Fux R, Mörike K, Kremsner PG, Gil JP, Gleiter CH, et al. Pharmacogenetics of antimalarial drugs: effect on metabolism and transport. Lancet Infect Dis. 2009;9(12):760-74.
• Kim KA, Park JY, Lee JS, Lim S. Cytochrome P450 2C8 and CYP3A4/5 are involved in chloroquine metabolism in human liver microsomes. Arch Pharm Res. 2003;26(8):631-7.
• Kochar DK, Saxena V, Singh N, Kochar SK, Kumar SV, Das A. Plasmodium vivax malaria. Emerg Infect Dis. 2005;11(1):132-4. doi: 10.3201/eid1101.040519.
  » https://doi.org/10.3201/eid1101.040519
• Lang T, Klein K, Nüssler AK, Neuhaus P, Hofmann U, Eichelbaum M, et al. Extensive genetic polymorphism in the human CYP2B6 gene with impact on expression and function in human liver. Pharmacogenetics 2001;11(5):399-415.
• Li XQ, Björkman A, Andersson TB, Gustafsson LL, Masimirembwa CM. Identification of human cytochrome P(450)s that metabolise anti-parasitic drugs and predictions of in vivo drug hepatic clearance from in vitro data. Eur J Clin Pharmacol. 2003;59(5-6):429-42. doi: 10.1007/s00228-003-0636-9.
  » https://doi.org/10.1007/s00228-003-0636-9
• Maciel ME, Oliveira FK, Propst GB, Bicalho M da G, Cavalli IJ, Ribeiro EM de SF. Population analysis of xenobiotic metabolizing genes in South Brazilian Euro and Afro-descendants. Genet Mol Biol [Internet]. 2009;32(Genet. Mol. Biol., 2009 32(4)):723-8.
• Madlensky L, Natarajan L, Tchu S, Pu M, Mortimer J, Flatt SW, et al, Hillman G, Fontecha MR, Lawrence HJ, Parker BA, Wu AH, Pierce JP. Tamoxifen metabolite concentrations, CYP2D6 genotype, and breast cancer outcomes. Clin. 2011;89(5):718-25.
• Mehlotra RK, Henry-Halldin CN, Zimmerman PA. Application of pharmacogenomics to malaria: a holistic approach for successful chemotherapy. Pharmacogenomics. 2009;10(3):435-49.
• Muthiah YD, Lee WL, Teh LK, Ong CE, Ismail R. Genetic polymorphism of CYP2C8 in three Malaysian ethnics: CYP2C8*2 and CYP2C8*3 are found in Malaysian Indians. J Clin Pharm Ther. 2005;30(5):487-90.
• Oliveira-Ferreira J, Lacerda MV, Brasil P, Ladislau JL, Tauil PL, Daniel-Ribeiro CT. Malaria in Brazil: an overview. Malar J. 2010;9:115.
• Paganotti GM, Gallo BC, Verra F, Sirima BS, Nebié I, Diarra A, et al. Human genetic variation is associated with Plasmodium falciparum drug resistance. J Infect Dis. 2011;204(11):1772-8.
• Parikh S, Ouedraogo JB, Goldstein JA, Rosenthal PJ, Kroetz DL. Amodiaquine metabolism is impaired by common polymorphisms in CYP2C8: implications for malaria treatment in Africa. Clin Pharmacol Ther. 2007;82(2):197-203.
• Projean D, Baune B, Farinotti R, Flinois JP, Beaune P, Taburet AM, et al. In vitro metabolism of chloroquine: identification of CYP2C8, CYP3A4, and CYP2D6 as the main isoforms catalyzing N-desethylchloroquine formation. Drug Metab Dispos. 2003;31(6):748-54.
• Pybus BS, Marcsisin SR, Jin X, Deye G, Sousa JC, Li Q, et al. The metabolism of primaquine to its active metabolite is dependent on CYP 2D6. Malar J. 2013;12:212.
• Restrepo JG, Martínez C, García-Agúndez A, Gaviria E, Laguna JJ, García-Martín E, et al. Cytochrome P450 CYP2B6 genotypes and haplotypes in a Colombian population. Pharmacogenet Genomics. 2011;21(12):773-8.
• Rodriguez-Antona C, Gomez A, Karlgren M, Sim SC, Ingelman-Sundberg M. Molecular genetics and epigenetics of the cytochrome P450 gene family and its relevance for cancer risk and treatment. Hum Genet. 2010;127(1):1-17.
• Sachse C, Brockmöller J, Bauer S, Roots I. Cytochrome P450 2D6 variants in a Caucasian population: allele frequencies and phenotypic consequences. Am J Hum Genet. 1997;60(2):284-95.
• Stage TB, Christensen MMH, Feddersen S, Beck-Nielsen H, Brøsen K. The role of genetic variants in CYP2C8, LPIN1, PPARGC1A and PPARγ on the trough steady-state plasma concentrations of rosiglitazone and on glycosylated haemoglobin A1c in type 2 diabetes. Pharmacogenet Genomics 2013;23(4):219-27.
• Suárez-Kurtz G, Pena SD, Struchner CJ, Hutz MH. Pharmacogenomic Diversity among Brazilians: Influence of Ancestry, Self-Reported Color, and Geographical Origin. Front Pharmacol. 2012;3:191.
• Tomalik-Scharte D, Lazar A, Fuhr U, Kirchheiner J. The clinical role of genetic polymorphisms in drug-metabolizing enzymes. Pharmacogenomics J. 2008;8:4-15.
• Tiong KH, Yiap BC, Tan EL, Ismail R, Ong CE. Functional characterization of cytochrome P450 2A6 allelic variants CYP2A6*15, CYP2A6*16, CYP2A6*21, and CYP2A6*22. Drug Metab Dispos. 2010;38(5):745-51.
• Wang H, Tompkins LM. CYP2B6: new insights into a historically overlooked cytochrome P450 isozyme. Curr Drug Metab. 2008;9(7):598-610.
• Westenberger SJ, McClean CM, Chattopadhyay R, Dharia NV, Carlton JM, Barnwell JW, et al. A systems-based analysis of Plasmodium vivax lifecycle transcription from human to mosquito. PLoS Negl Trop Dis. 2010;4(4):e653.
• World Health Organization. World Malaria Report. 2011.
• WHO. Malaria - Drug Therapy. 2.Malaria - diagnosis. 3.Antimalarials - administration and dosage. 4. Drug Therapy, Combination. 5.Guideline. Third Edition: WHO, 2015.
• Wu X, Zuo J, Guo T, Yuan L. CYP2C8 polymorphism frequencies among Han, Uighur, Hui, and Mongolian Chinese populations. Genet Test Mol Biomarkers. 2013;17(2):104-8.
• Wyen C, Hendra H, Vogel M, Hoffmann C, Knechten H, Brockmeyer NH, et al. Impact of CYP2B6 983T>C polymorphism on non-nucleoside reverse transcriptase inhibitor plasma concentrations in HIV-infected patients. 2008;61(4):914-8.
• Yusof W, Hua GS. Gene, ethnic and gender influences predisposition of adverse drug reactions to artesunate among Malaysians. Toxicol Mech Methods. 2012;22(3):184-92.
• Zanger UM, Schwab M. Cytochrome P450 enzymes in drug metabolism: regulation of gene expression, enzyme activities, and impact of genetic variation. Pharmacol Ther. 2013;138(1):103-41.

• SPONSORSHIPS

  Financial support was provided by grants from: • Fundação de Amparo à Pesquisa do Estado do Amazonas (FAPEAM). Protocol Number: 1094/2013-FAPEAM. • Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES). • The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Publication Dates

• Publication in this collection
  17 Nov 2023
• Date of issue
  2023

History

• Received
  16 Mar 2023
• Accepted
  26 July 2023