Relevant coexpression of STMN1, MELK and FOXM1 in glioblastoma and review of the impact of STMN1 in cancer biology

Coexpressão relevante de STMN1, MELK e FOXM1 em glioblastoma e revisão do impacto de stmn1 na biologia do câncer

Abstracts

OBJECTIVE:

To analyze the associated expression of STMN1, MELK and FOXM1 in search of alternative drugable target in glioblastoma (GBM) and to review relevant functional roles of STMN1 in cancer biology.

METHOD:

STMN1, MELK and FOXM1 expressions were studied by quantitative PCR and their coexpressions were analyzed in two independent glioblastoma cohorts. A review of articles in indexed journals that addressed the multiple functional aspects of STMN1 was conducted, focusing on the most recent reports discussing its role in cancer, in chemoresistance and in upstream pathways involving MELK and FOXM1.

RESULTS:

Significant associated expressions of MELK and FOXM1 were observed with STMN1 in GBM. Additionally, the literature review highlighted the relevance of STMN1 in cancer progression.

CONCLUSION:

STMN1 is very important to induce events in cancer development and progression, as cellular proliferation, migration, and drug resistance. Therefore, STMN1 can be an important therapeutic target for a large number of human cancers. In glioblastoma, the most aggressive brain tumor, the MELK/FOXM1/STMN1 presented significant associated expressions, thus pointing MELK and FOXM1 as alternative targets for therapy instead of STMN1, which is highly expressed in normal brain tissue. Continuous functional research to understand the STMN1 signaling pathway is worthwhile to improve the therapeutic approaches in cancer.

KEYWORDS:
Stathmin; cytoskeleton; microtubules; glioblastoma

OBJETIVO:

Analisar as expressões associadas de STMN1, MELK e FOXM1 na procura de alvos alternativos de tratamento em glioblastoma (GBM) e revisar os papeis funcionais relevantes de STMN1 na biologia do câncer.

MÉTODO:

As expressões de STMN1, MELK e FOXM1 foram estudadas por PCR quantitativo e suas coexpressões foram analisadas em dois coortes independentes de GBM. A revisão dos artigos publicados em revistas indexadas na procura dos aspectos funcionais múltiplos de STMN1 foi conduzida focando-se nos estudos mais recentes discutindo o seu papel em câncer, quimiorresistência e vias de sinalização envolvendo MELK e FOXM1.

RESULTADOS:

Observou-se expressões associadas significantes de MELK e FOXM1 com STMN1. Adicionalmente, a revisão da literatura salientou a relevância do STMN1 na progressão do câncer.

CONCLUSÃO:

STMN1 é muito importante nos eventos relacionados ao desenvolvimento e progressão do câncer, como proliferação celular, migração e resistência ao tratamento. Desta forma, STMN1 pode ser um forte alvo terapêutico em um grande número de cânceres humanos. Em GBM, o tumor cerebral mais agressivo, MELK/FOXM1/STMN1 apresentaram significativa associação em suas expressões gênicas, indicando, portanto, MELK e FOXM1 como alvos alternativos para terapia em substituição ao STMN1, que apresenta alta expressão no tecido cerebral normal. Perseverar nos estudos funcionais para o entendimento da via de sinalização do STMN1 é relevante para melhorar os esquemas terapêuticos para câncer.

PALAVRAS-CHAVE:
Stathmin; citoesqueleto; microtúbulos; glioblastoma

INTRODUCTION

Cell proliferation and migration are two relevant features in cancer biology determining tumor growth and invasion/metastasis. The subcellular cytoskeleton is essential to control these processes.¹ This includes the microtubule dynamic behavior involving rapid switches between periods of polymerization (growth) and depolymerization (shrinkage) at the microtubule extremity (named dynamic instability).

Currently, several proteins are known to be related to microtubule interaction with tubulin, and participate in microtubule dynamics. The stathmin (STMN) family members are among those proteins that inhibit microtubule polymerization. Four members of evolutionarily conserved cytosolic proteins compose this family, namely STMN1 to 4. STMN1 and STMN3 are ubiquitously expressed in different cells, while STMN2 and STMN4 are more restricted to the nervous system.² These proteins share up to 70% of sequence homology in a highly conserved C-terminus within the tubulin-binding stathmin-like domain, and in the N-terminus region containing the phosphorylation sites, which also dictates their cellular localization.^3,4

STMN1 is also known as Oncoprotein 18 (Op 18); it is an important microtubule dynamics regulator involved in cell proliferation, differentiation, cell cycle progression and migration. STMN1 has been described as associated to a wide range of malignancies and is a target for alternative therapy in cancer treatment.⁵

STMN2, also known as the superior cervical ganglion-10 protein (SCG10), has been reported as a neuron-specific growth-associated phosphoprotein, abundant in the growth cone of neurons. In particular, STMN2 is described as a neuronal marker at an early stage of neural development, playing a regulatory role in the control of neuronal differentiation.⁶Previous studies have also described its role in osteogenesis.⁷In liver tumorigenesis, it has been described as a target of β-catenin/TCF-mediated transcription in the Wnt dependent regulation of microtubule dynamics in hepatoma cells.⁸ Moreover, STMN2 plays a role in promoting the invasive potential of gastric cancer cells.⁹

STMN3, also known as SCLIP, is involved in the development of the central nervous system, including axonal branching and dendritic differentiation of Purkinje cells.^10,11 STMN3 is highly expressed in glioma samples, and has been associated to migration and invasion of glioma cells.¹² Additionally, STMN3 has been described as a modulator of the sensitivity of ovarian cancer cells to microtubule-targeting drugs by preventing the formation of the spindle and consequently promoting mitosis arrest.¹³

STMN4, also known as RB3, presents two splice variants, RB3’ and RB3’’.¹⁴ STMN4 has a putative role in neuronal morphogenesis and plasticity.^15,16

Among the members of the stathmin family, STMN1 is the most studied member, and cumulative evidence singles out STMN1 as a candidate target for cancer therapy. However, STMN1 can hardly become an eligible drug for brain tumors, as its expression is high in brain tissue,¹⁷ and consequently undesirable side effects would be expected. Therefore, the search for more suitable up or downstream targets in the STMN1 signaling pathway is an alternative strategy. On this rationale, we previously linked MELK upstream to STMN1 in glioma cells,¹⁷ and have also demonstrated the importance of MELK in astrocytoma progression, mainly in GBM.¹⁸ More recently, AKT/FOXM1/STMN1 pathway has been reported to confer multidrug resistance phenotype in non-small cell lung cancer.¹⁹FOXM1 is a transcription factor of the forkhead family that plays critical roles in cell cycle progression and cell fate decision.

In the present work, we analyzed the STMN1, MELK and FOXM1 associated expressions in our GBM cohort, and validated our results in an expanded independent public cohort in silico. To highlight the relevance of this pathway in cancer biology, we also present a review focused on the role of STMN1 in tumor progression promoting proliferation and migration through regulation of microtubule dynamics.

MATERIALS AND METHOS

Analysis of Cases and Gene Expression

Eighty-seven astrocytomas grade IV or GBM and 22 non-neoplastic (NN) brain anonymized tissues from epilepsy patients subjected to temporal lobectomy were obtained during therapeutic surgery from patients treated by the Neurosurgery Group of the Department of Neurology at Hospital das Clínicas of the Faculdade de Medicina da Universidade de São Paulo. Written informed consents were obtained from all patients in accordance with ethical guidelines. This project was approved by the Ethic Committee of Faculdade de Medicina da Universidade de Sao Paulo (case # 0263/07).

Samples were immediately snap-frozen in liquid nitrogen and necrotic and non-neoplastic areas were removed by microdissection from the tumoral blocks prior to RNA extraction. Total RNA extraction, reverse transcription and qRT-PCR (Sybr Green approach) were performed as previously described.¹⁷ Quantitative data were normalized using the geometric mean of three reference genes suitable for the analysis: hypoxanthine phosphoribosyltransferase (HPRT), glucuronidase beta (GUSB) and TATA box-binding protein (TBP), as previously demonstrated by our group.²⁰ Primers of housekeeping genes, STMN1 and MELK are described in our previous report.¹⁷ Primers for FOXM1 were synthesized by (Integrated DNA Technologies, IDT, Coralville, IA) as follows (5' to 3'): FOXM1 F: GAAGAACTCCATCCGCCACA, FOXM1 R: TCAAGTAGCGGTTGGCACTG. All reactions were performed in duplicates and and the 2^−ΔCt method was applied to calculate gene expression levels, where ΔCt = [Ct target gene] - [geometric mean Ct of reference genes] and Ct is the cycle threshold. The median values of gene expression were used to divide samples with high and low expression.

Analysis of The Cancer Genome Atlas (TCGA) GBM gene expression database

STMN1, MELK and FOXM1 gene expression levels were analyzed in an independent cohort at the cBio Portal for Cancer Genomics database (http://www.cbioportal.org).²¹RNAseq data set of 154 cases of GBM²²was used to assess coexpression analysis of mRNA levels (z-score, RNA Seq V2 RSEM).

Statistical analyses

Mann Whitney tests were performed to compare STMN1, MELK and FOXM1 expression levels between GBM and NN samples. Correlations between gene expression values in different groups of tumors were assessed using the Spearman-rho correlation tests (non-parametric test).

Literature review focused in STMN1

A literature search was conducted in the PubMed database using the following terms: "stathmin", "cancer". Only articles in English were selected, with a search ending in September 2017. We selected reviews and articles that described STMN1 and cancer. We focused specially in the most recent data of STMN1 role in cancer treatment and chemoresistance.

RESULTS

We aimed to analyze the association of STMN1, MELK and FOXM1 in two independent cohorts of GBM. Initially, we analyzed STMN1, MELK and FOXM1 expression levels in 87 GBM samples compared to 22 non-neoplastic (NN) brain samples in our case database (Figure 1A, B and C).

Figure 1
STMN1, MELK and FOXM1 expression levels in glioblastoma (GBM) and non-neoplastic brain tissue samples (NN). A, B, C: Box and whiskers plots of STMN1, MELK and FOXM1 gene expressions in GBM and NN groups analyzed by real time PCR. The top and the botton of boxes represent the first and third quartiles, respectively, and the lines in the middle the median expression in the groups. The error bars show the range of 5-95th percentiles (whiskers). D, E, F: Coexpressions between STMN1 and MELK, STMN1 and FOXM1 and FOXM1 and MELK expression levels in our GBM series (Spearman-rho test). G, H, I: Coexpressions between STMN1 and MELK, STMN1 and FOXM1 and FOXM1 and MELK expression levels analyzed in RNAseq data of 157 cases from a GBM-TCGA cohort by z-Score (of RSEM).

Coexpression analyses were significantly positive for STMN1 and MELK, STMN1 and FOXM1 and MELK and FOXM1 (Figure 1D, E and F). Our results were validated in a larger independent public database of TCGA corroborating the tight association among MELK, FOXM1 and STMN1 (Figure 1G, H and I).

Additionally, we divided the GBM cases of our cohort in low (44 cases) and high (43 cases) STMN1 expression. In the first group, there were 11 cases (25%) that presented high FOXM1 expression, while in the second group there were 32 cases (73%) with high FOXM1 expression (Figure 2). Our data indicate that overexpression of STMN1 correlates to an overexpression of FOXM1.

Figure 2
STMN1 and FOXM1 expression analysis of our GBM cohort. We divided the GBM samples according to STMN1 expression (low and high, based on median gene expression values). The horizontal bars represent the median expression of each group. Red dots represent cases with high FOXM1 expression levels (cases above median of FOXM1 expression level).

DISCUSSION

Altogether, our data demonstrate that MELK and FOXM1 expressions are significantly associated to STMN1 expression, pointing them as promising alternative targets in the STMN1 signaling pathway for glioma therapy.

A schematic illustration of the signaling pathway involving STMN1, MELK and FOXM1 is proposed in Figure 3, implementing the interaction network recently published.¹⁹ STMN1 plays a central role in the regulation of cell cycle, proliferation, epithelial mesenchymal transition and chemoresistance, crucial processes in cancer progression. The details of these STMN1 roles are reviewed and presented below.

Figure 3
STMN1, MELK and FOXM1 signaling. Activation of a tyrosine kinase receptor (TKR) activates PI3K/AKT and RAS/MAPK signaling pathways. Both pathways are activated through formation of the complex GRB/SOS (growth factor receptor-bound protein 2/ Son of Sevenless homologs), which binds to phosphorylated TKR. Both PI3K and RAS/MAPK pathways result in STMN1 phosphorylation, through MELK and FOXM1. Phosphorylation inactivates STMN1 and allows the association of tubulin dimers and polymerization of microtubules. STMN1 dephosphorilation activates the protein, causing in the sequestration of tubulin. This dynamics of STMN1 activation/inactivation results in depolymerization/polymerization of microtubules and consequently cell cycle progression/proliferation, epithelial-mesenchymal transition and chemoresistance. (Figure adapted from Marie et al., 2016)

STMN1 and microtubule dynamics

Tight regulation of cytoskeletal microtubule dynamics in living cells is essential for many cellular functions. Microtubules are a network of filaments comprising heterodimer α/β-tubulin subunits that play a key role during cell events such as proliferation, migration and differentiation. The dynamic reorganization of microtubules in cells is regulated by proteins that promote their assembly (stabilizers) or disassembly (destabilizers). Microtubules (dis)assembly is partially determined by the concentration of free tubulin heterodimers in the cytoplasm, where it determines the growth rate of microtubule by incorporation of tubulin at its ends. STMN1 is one of the most prominent and rapid microtubule regulators in response to cell needs. STMN1 downregulation increases the concentration of microtubule polymers and decreases the concentration of free tubulin heterodimers.²³

STMN1 (de)phosphorylation and cell cycle

The dynamic regulation of the tubulin assembly by STMN1 is performed by its four extremely conserved phosphorylation sites within the N-terminal domain: Ser16, Ser25, Ser38 and Ser63.^24,25 The dephosphorylated (active) STMN1 promotes the depolymerization of microtubules by sequestering tubulin heterodimers into a ternary complex T2S where one STMN1 molecule interacts with two molecules of α,β-tubulin through the stathmin-like domain.²⁶On the other hand, the phosphorylated (inactive) STMN1 impacts negatively on STMN-tubulin association, and therefore promotes microtubule stabilization and formation of mitotic spindle.²⁷This post-translational phosphorylation of STMN1 by multiple kinases is largely dependent on specific stimulus especially during cell cycle progression, and migration.²⁸

In mitotic cells, sequential phosphorylation of the four residues of STMN1 blocks tubulin binding to T2S and terminates depolymerization activity, consequently allowing the spindle formation.²⁹Initially, a moderate STMN1 inactivation is achieved by Ser25 and Ser38 phosphorylation by MAPK and p34^cdk2 during G1/S phase. Next, for the metaphase initiation, these two residues are phosphorylated by CDK1, a master regulator of M phase progression, and also by CDK2 and CDK5.^30,31

STMN1 total inactivation occurs by sequential phosphorylation of Ser16 and Ser63 residues.^32,33 by protein kinase A (PKA),^24,34 Aurora B kinase,³⁵ p65PAK,³⁶ or Ca²⁺/calmodulin-dependent kinases isoforms CaMKII and IV at the final step of M phase.^37,38 Such a condition allows the mitotic spindle to be properly organized.^32,39 When chromosome segregation is completed, the spindle must be disassembled to allow proper exit from mitosis, and enter to anaphase and telophase.⁴⁰ The microtubule-depolymerizing activity of STMN1 is restored by dephosphorilation to disassemble the mitotic spindle. At this point, different serine/threonine protein phosphatases, as protein phosphatase 1 (PP1), protein phosphatase 2A (PP2A) and protein phosphatase 2B (PP2B), dephosphorylate STMN1.^41,42

Additionally, STMN1 phosphorylation at Ser28 and Ser38 residues is also mediated by c-Jun N-terminal kinase (JNK).^43,44 The JNKs are stress-activated serine/threonine kinases that regulate both cell death and cell proliferation, and they are also regulators of critical processes such as inflammation and metabolism. c-JUN overexpression also stimulates STMN1 transcription via direct activation of its promoter by the activating transcription factor (ATF)-like or by indirect activation of the E2F activity.⁴⁵ Extracellular signal-regulated kinases (ERK), also known as mitogen-activated kinase (MAPK) act as an integration point for multiple biochemical signals, and also phosphorylate STMN1of unknown function, that is frequently up-regulated in transformed cells. Stimulation of various cell-surface receptors results in extensive phosphorylation of Op18 and this protein has, therefore, previously been implicated in intracellular signaling. In the present study, by expression of specific Op18 cDNA mutant constructs and phosphopeptide mapping, we have identified in vivo phosphorylation sites. In conjunction with in vitro phosphorylation experiments, using purified wild-type and mutant Op18 proteins in combination with a series of kinases, these results have identified two distinct proline-directed kinase families that phosphorylate Op18 with overlapping but distinct site preference. These two kinase families, mitogen activated protein (MAP.⁴ Also in the MAPK cascade, apoptosis signal-regulating kinase (ASK1) activates the JNK and p38 MAPK cascades through STNM1 phosphorylation and ASK1 is involved in a broad range of activities including cell differentiation and stress-induced apoptosis.^45-48 Moreover, ribosomal protein S6 kinase A3 (RPS6KA3, RSK2) can reduce microtubule depolymerization by phosphorylation of STMN1 specifically at Ser16 residue.⁴⁹

Additionally, peptide hormones as gonadotropin-releasing hormone (LHRH) secreted from hypothalamic neurons, regulators of LH and FSH synthesis and release, have also been described to induce STMN1 phosphorylation in a PKC-dependent pathway.⁵⁰ More recently, thyroid hormone receptor (THR) has been reported as a transcription regulator of STMN1 in hepatocellular carcinoma. Thyroxine (T3) binds to nuclear TRHs to exert numerous physiological processes, including ontogenesis, cell growth, cellular differentiation and metabolism. Clinical and experimental observations suggest that T3 might regulate microtubule network assembly through repression of STMN1 expression.⁵¹

In addition to hormones and growth factors, ion channels can also activate STMN1. Activation of ion channels initiate a Ca⁺² response in parallel with activation of several protein kinase families, particularly Ca⁺²/Calmodulin-dependent protein kinase type Gr which is mainly expressed at high levels in neural cells and CD4-positive T lymphocytes. And, as consequence STMN1 is phosphorylated.^37,38

Therefore, STMN1 is able to integrate multiple extracellular inputs through hormone peptides, ion channels, and growth factor receptors to intracellular molecular networks, regulating multiple cellular activities and signaling pathways.

STMN1 and cell migration

Cell migration is a complex cellular behavior that results from the coordinated changes in the regulation of microtubule dynamics.⁵² Therefore, STMN1, a master microtubule regulator, is also involved in cell migration, with crucial role in cytoskeletal rearrangements for formation and dispersal of adhesion sites between cells and extracellular matrix. Intrinsically, STMN1 is involved in extension and retraction of leading edges which depend on polymerization of actin microfilaments, and microtubule assembly (stability) and disassembly (instability).^53,54

Microtubules may participate in cell migration in a Rac1- and p21-activated kinase-dependent manner. In the advancing cell edge of the migrating cells, there is a Rac1 mediated microtubule net growth dependent on Pak kinase activity. Pak1 can directly phosphorylate STMN1 at S16 residue, in EGF-stimulated cells. This leads to downregulation of the STMN1 inhibitory activity on bulk tubulin polymerization with consequent microtubule growth.⁵⁵

Moreover, STMN1 may interact with p27 and Cdk2/Cdk5, leading to enhanced protein phosphorylation and consequent tubulin stabilization and inhibition of cell migration.⁵⁶

Another recent study has demonstrated that STMN1 phosphorylation at Ser25 and Ser38 is required to maintain the migration properties of breast cancer cells through interaction with glucose-regulated protein of molecular mass 78 (GRP78). Furthermore, this interaction is regulated by MEK kinase-dependent phosphorylation of STMN1, which has an important role in cell proliferation, differentiation, migration and invasion of breast cancer cells with impact on tumor recurrence and metastasis.⁵⁷ Similarly, STMN1 was described as playing a fundamental role in neuroblastoma cells by regulating the invasion and transendothelial migration by RhoA/ROCK signaling, in a microtubule-independent manner.⁵⁸ Association of STMN1 expression with metastasis has also been reported in other types of tumor, indicating STMN1 as a molecular biomarker for the risk of metastasis.⁵

STMN1 and cancer

STMN1 modifications have been frequently reported in cancer. In 2010, Jeon et al. first reported positive correlation of STMN1 overexpression with lymph node metastasis, migration foci and vascular invasion, with negative impact in recurrence free survival of diffuse type of gastric carcinoma. The same group demonstrated the oncogenic role of STMN1 by the decrease of proliferation rate, migration and invasion of gastric cancer cells in vitro through STMN1 inhibition.⁵⁹ Henceforth, STMN1 has been considered as a mitotic regulator oncoprotein that modulates microtubule stability.⁶⁰

STMN1 expression is also upregulated in various human malignancies, including colorectal,⁶¹ ovarian,^62,63 hepatocellular,^64,65 gastric,^66,67 cutaneous,⁶⁸ prostate,⁶⁹ breast,^70,71 cervical,⁷² lung,^73-75 bladder,⁷⁶colorectal,^61,77 pancreas,^78,79 nasopharyngeal,⁸⁰ esophageal,^81,82 oral squamous cell,⁸³gallbladder,⁸⁴ endometrial cancer,^85,86 choleoangiocarcinoma,⁸⁷ GBM,¹⁷ medulloblastoma,^88,89 meningeomas^90,91 and acute leukemia.⁹² Upregulated STMN1 expression and/or activity (phosphorylation status) have been correlated with tumor grade, tumor progression, invasion/ metastasis, poor survival and drug resistance in several types of malignanciesfirstly identified as the downstream target of many signal transduction pathways. Several studies then indicated that stathmin is overexpressed in many types of human malignancies, thus deserving the name of Oncoprotein 18 (Op18,^5,28 highlighting the central role of STMN1 in tumor onset and progression. Accordingly, cumulative evidences have demonstrated reduction of important features of tumor, such as cell proliferation, motility, and metastasis by STMN1 downregulation.

In cancer, the most common and studied mechanism of STMN1 activation is mediated by phosphorylation by several intracellular signaling kinases, as mentioned above, but it can be also mediated by protein sequestration. The p27^Kip1, a cyclin-dependent kinase (CDK) inhibitor,^55,93,94 and STAT3, a transcription factor signal transducer and activator transcription 3,^95,96 are both able to bind to STNM1, and consequently preventing its ability to sequester free tubulin heterodimers. FOXM1 is another transcription factor able to activate STMN1, as demonstrated recently in non-small cell lung cancer.¹⁹ Recently, we identified STMN1 as one of the proteins downstream the maternal embryonic leucine zipper kinase (MELK) pathway in GBM cell lines.¹⁷Similar to STMN1, MELK is involved in tumor cell cycle, proliferation and differentiation in several human cancers.⁹⁷ MELK silencing has led to the decrease of STMN1 expression.¹⁷ And, MELK directly binds to FOXM1 and regulates its phosphorylation,⁹⁸ and consequently FOXM1 modulates STMN1 expression.¹⁷

On the other hand, STMN1 downregulation can the modulated by TP53, a transcription factor that represses STMN1 transcription and regulates cell cycle arrest at the G2/M and G1/S checkpoints.^99,100 There are cumulative evidences that STMN1 is the key downstream target of p53, mainly in cells harboring mutant p53 protein, as in hepatocellular carcinoma patients. And such condition is associated to a poorer prognosis.¹⁰¹ Corroborating these observations, STMN1 inhibition in cancer cells harboring TP53 mutation has decreased cell proliferation and viability, increased apoptosis and suppressed tumorigenicity, suggesting that STMN1 is required for the survival of p53-mutant cells.^102-105 Recently, it was suggested that overexpressed STMN1 interacts with p53 and contributes to the gain-of-function of p53.¹⁰⁵ Altogether, these data suggest that targeting STMN1 may be an interesting approach to treat different types of cancers with aberrant p53 function.

Additionally, small non-coding RNAs, micro-RNAs (miRNAs) also modulate STMN1 expression. STMN1 is negatively regulated by the oncogene miR-221 during epithelial-mesenchymal transition (EMT) in bladder cancer cells¹⁰⁶ and by miR-34a in osteosarcoma.¹⁰⁷ Downregulation of miR-223 has been described to increase STMN1 expression in liver cancer, stimulating tumor cell growth and mobility.¹⁰⁸

These cumulative evidences corroborating the oncoprotein properties of STMN1 turn it a potential therapeutic target.

STMN1 as potential therapeutic target

STMN1 expression may be modulated interfering in the several mechanisms enumerated above, and also through Nf-κB in pancreatic cancer, where STMN1 silencing reduced cell viability and promoted cell cycle arrest at G2/M phase.⁷⁸ Or, by inhibiting of HIF-1α and VEGF mRNA levels through the decrease of AKT phosphorylation in the PI3K/AKT/mTOR signaling pathway, as in ovarian cancer.¹⁰⁹

Of note, STMN1 modulation may be of interest to approach multidrug resistance. Chemoresistance of several solid cancers, including non-small cell lung (NSCLC), esophageal, breast, gastric, endometrial, bladder, retinoblastoma, glioma, osteosarcoma and colorectal cancers has been related to overexpression of STMN1. This association was described especially for microtubule-destabilizing drugs, as taxol, paclitaxel and docetaxel, but also for platinum, temozolamide, doxorubicin, arsenic acid, gefitinib and zoledronic acid.^110-112 More recently, upregulation of STMN1 expression by FOXM1 has been described in NSCLC. STMN1 overexpression was related to EMT and conferred multidrug tyrosine kinase inhibitors (TKIs) resistance on these cells. Mechanistically TKIs, the first group of target-based compounds used as therapy for large numbers of cancer, activate AKT/FOXM1/STMN1 pathway that has conferred multidrug resistance phenotype.¹⁹

SUMMARY

Altogether, the results reviewed above suggest that expression of the STMN1 is very important to induce events in cancer development and progression, as cellular proliferation, migration, and drug resistance. Therefore, STMN1 can be an important candidate target for a large number of human cancers. In GBM, the most aggressive brain tumor, the MELK/FOXM1/STMN1 presented significant associated expressions, thus pointing MELK and FOXM1 as alternative targets for therapy instead of STMN1, which is highly expressed in normal brain tissue. In conclusion, continuous research to better elucidate the interacting mechanism with STMN1 looking for new therapeutic strategies is worthwhile.

ACKNOWLEDGEMENTS

We thank the Sao Paulo Research Foundation (FAPESP), grants 2013/02162-8 and 2015/03614-5, Conselho Nacional de Pesquisa (CNPq), Fundação Faculdade de Medicina (FFM) and Faculdade de Medicina da USP (FMUSP) for financial support.

REFERENCES

• ¹
  Gardner MK, Zanic M, Howard J. Microtubule catastrophe and rescue. Curr Opin Cell Biol. 2013;25(1):1-9. DOI:10.1016/j.ceb.2012.09.006
  » https://doi.org/10.1016/j.ceb.2012.09.006
• ²
  Bièche I, Maucuer A, Laurendeau I, Lachkar S, Spano AJ, Frankfurter A, et al. Expression of stathmin family genes in human tissues: Non-neural-restricted expression for SCLIP. Genomics. 2003;81(4):400-10. DOI:10.1016/S0888-7543(03)00031-4
  » https://doi.org/10.1016/S0888-7543(03)00031-4
• ³
  Cassimeris L. The oncoprotein 18/stathmin family of microtubule destabilizers. Curr. Opin. Cell Biol. 2002;14(1):18-24. DOI:10.1016/S0955-0674(01)00289-7
  » https://doi.org/10.1016/S0955-0674(01)00289-7
• ⁴
  Lin X, Liao Y, Chen X, Long D, Yu T, Shen F. Regulation of Oncoprotein 18/Stathmin Signaling by ERK Concerns the Resistance to Taxol in Nonsmall Cell Lung Cancer Cells. Cancer Biother Radiopharm. 2016;31(2):37-43. DOI:10.1089/cbr.2015.1921
  » https://doi.org/10.1089/cbr.2015.1921
• ⁵
  Biaoxue R, Hua L, Wenlong G, Shuanying Y. Overexpression of stathmin promotes metastasis and growth of malignant solid tumors: a systemic review and meta-analysis. Oncotarget. 2016;7(48):78994-9007. DOI:10.18632/oncotarget.12982
  » https://doi.org/10.18632/oncotarget.12982
• ⁶
  Grenningloh G, Soehrman S, Bondallaz P, Ruchti E, Cadas H. Role of the microtubule destabilizing proteins SCG10 and stathmin in neuronal growth. J Neurobiol. 2004;58(1):60-9. DOI:10.1002/neu.10279
  » https://doi.org/10.1002/neu.10279
• ⁷
  Chiellini C, Grenningloh G, Cochet O, Scheideler M, Trajanoski Z, Ailhaud G, et al. Stathmin-like 2, a developmentally-associated neuronal marker, is expressed and modulated during osteogenesis of human mesenchymal stem cells. Biochem Biophys Res Commun. 2008;374(1):64-8. DOI:10.1016/j.bbrc.2008.06.121
  » https://doi.org/10.1016/j.bbrc.2008.06.121
• ⁸
  Lee H-S, Lee DC, Park M-H, Yang S-J, Lee JJ, Kim DM, et al. STMN2 is a novel target of beta-catenin/TCF-mediated transcription in human hepatoma cells. Biochem Biophys Res Commun. 2006;345(3):1059-67. DOI:10.1016/j.bbrc.2006.05.017
  » https://doi.org/10.1016/j.bbrc.2006.05.017
• ⁹
  Guo Q, Su N, Zhang J, Li X, Miao Z, Wang G, et al. PAK4 kinase-mediated SCG10 phosphorylation involved in gastric cancer metastasis. Oncogene. 2014;33(25):3277-87. DOI:10.1038/onc.2013.296
  » https://doi.org/10.1038/onc.2013.296
• ¹⁰
  Poulain FE, Sobel A. The »,» ®,® §,§ ­,­ ¹,¹ ²,² ³,³ ß,ß Þ,Þ þ,þ ×,× Ú,Ú ú,ú Û,Û û,û Ù,Ù ù,ù ¨,¨ Ü,Ü ü,ü Ý,Ý ý,ý ¥,¥ ÿ,ÿ ¶,¶ SCG10-LIke Protein »,» ®,® §,§ ­,­ ¹,¹ ²,² ³,³ ß,ß Þ,Þ þ,þ ×,× Ú,Ú ú,ú Û,Û û,û Ù,Ù ù,ù ¨,¨ Ü,Ü ü,ü Ý,Ý ý,ý ¥,¥ ÿ,ÿ ¶,¶ SCLIP is a novel regulator of axonal branching in hippocampal neurons, unlike SCG10. Mol Cell Neurosci. 2007;34(2):137-46. DOI:10.1016/j.mcn.2006.10.012
  » https://doi.org/10.1016/j.mcn.2006.10.012
• ¹¹
  Poulain FE, Chauvin S, Wehrlé R, Desclaux M, Mallet J, Vodjdani G, et al. SCLIP is crucial for the formation and development of the Purkinje cell dendritic arbor. J Neurosci. 2008;28(29):7387-98. DOI:10.1523/JNEUROSCI.1942-08.2008
  » https://doi.org/10.1523/JNEUROSCI.1942-08.2008
• ¹²
  Zhang Y, Ni S, Huang B, Wang L, Zhang X, Li X, et al. Overexpression of SCLIP promotes growth and motility in glioblastoma cells. Cancer Biol Ther. 2015;16(1):97-105. DOI:10.4161/15384047.2014.987037
  » https://doi.org/10.4161/15384047.2014.987037
• ¹³
  Xie X, Bartholomeusz C, Ahmed AA, Kazansky A, Diao L, Baggerly KA, et al. Bisphosphorylated PEA-15 sensitizes ovarian cancer cells to paclitaxel by impairing the microtubule-destabilizing effect of SCLIP. Mol Cancer Ther. 2013;12(6):1099-111. DOI:10.1158/1535-7163.MCT-12-0737
  » https://doi.org/10.1158/1535-7163.MCT-12-0737
• ¹⁴
  Ozon S, Maucuer A, Sobel A. The stathmin family -- molecular and biological characterization of novel mammalian proteins expressed in the nervous system. Eur J Biochem. 1997;248:794-806. DOI:10.1111/j.1432-1033.1997.t01-2-00794.x
  » https://doi.org/10.1111/j.1432-1033.1997.t01-2-00794.x
• ¹⁵
  Beilharz EJ, Zhukovsky E, Lanahan AA, Worley PF, Nikolich K, Goodman LJ. Neuronal activity induction of the stathmin-like gene RB3 in the rat hippocampus: possible role in neuronal plasticity. J Neurosci. 1998;18(23):9780-9.
• ¹⁶
  Nakao C, Itoh TJ, Hotani H, Mori N. Modulation of the stathmin-like microtubule destabilizing activity of RB3, a neuron-specific member of the SCG10 family, by its N-terminal domain. J Biol Chem. 2004;279(22):23014-21. DOI:10.1074/jbc.M313693200
  » https://doi.org/10.1074/jbc.M313693200
• ¹⁷
  Marie SK, Oba-Shinjo SM, da Silva R, Gimenez M, Nunes Reis G, Tassan JP et al. Stathmin involvement in the maternal embryonic leucine zipper kinase pathway in glioblastoma. Proteome Sci. 2016;14:6. DOI:10.1186/s12953-016-0094-9.
  » https://doi.org/10.1186/s12953-016-0094-9
• ¹⁸
  Marie SK, Okamoto OK, Uno M, Hasegawa AP, Oba-Shinjo SM, Cohen T et al. Maternal embryonic leucine zipper kinase transcript abundance correlates with malignancy grade in human astrocytomas. Int J Cancer. 2008;122(4):807-15. DOI:10.1002/ijc.23189
  » https://doi.org/10.1002/ijc.23189
• ¹⁹
  Li M, Yang J, Zhou W, Ren Y, Wang X, Chen H et al. Activation of an AKT/FOXM1/STMN1 pathway drives resistance to tyrosine kinase inhibitors in lung cancer. Br J Cancer. 2017;117(7):974-83. DOI:10.1038/bjc.2017.292.
  » https://doi.org/10.1038/bjc.2017.292
• ²⁰
  Valente V, Teixeira SA, Neder L, Okamoto OK, Oba-Shinjo SM, Marie SK et al. Selection of suitable housekeeping genes for expression analysis in glioblastoma using quantitative RT-PCR. BMC Mol Biol. 2009;10:17. DOI:10.1186/1471-2199-10-17
  » https://doi.org/10.1186/1471-2199-10-17
• ²¹
  Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal. 2013;6(269):pl1. DOI:10.1126/scisignal.2004088.
  » https://doi.org/10.1126/scisignal.2004088
• ²²
  Brennan CW, Verhaak RG, McKenna A, Campos B, Noushmehr H, Salama SR, et al. TCGA Research Network. The somatic genomic landscape of glioblastoma. Cell. 2013;155: 462-77. DOI:10.1016/j.cell.2013.09.034.
  » https://doi.org/10.1016/j.cell.2013.09.034
• ²³
  Holmfeldt P, Brännström K, Stenmark S, Gullberg M. Aneugenic activity of Op18/stathmin is potentiated by the somatic Q18-->e mutation in leukemic cells. Mol Biol Cell. 2006;17(7):2921-30. DOI:10.1091/mbc.E06-02-0165
  » https://doi.org/10.1091/mbc.E06-02-0165
• ²⁴
  Berettas L, Dobransky T. Multiple phosphorylation of stathmin. Identification of four sites phosphorylated in intact cells and in vitro by cyclic AMP-dependent protein kinase and p34cdc2. J Biol Chem. 1993;268(27):20076-84.
• ²⁵
  Curmi PA, Gavet O, Charbaut E, Ozon S, Lachkar-Colmerauer S, Manceau V, et al. Stathmin and its phosphoprotein family: general properties, biochemical and functional interaction with tubulin. Cell Struct Funct. 1999;24(5):345-57.
• ²⁶
  Belmont LD, Mitchison TJ. Identification of a protein that interacts with tubulin dimers and increases the catastrophe rate of microtubules. Cell. 1996;23;84(4):623-31. DOI:10.1016/S0092-8674(00)81037-5
  » https://doi.org/10.1016/S0092-8674(00)81037-5
• ²⁷
  Honnappa S, Jahnke W, Seelig J, Steinmetz MO. Control of intrinsically disordered stathmin by multisite phosphorylation. J Biol Chem. 2006;281(23):16078-83. DOI:10.1074/jbc.M513524200
  » https://doi.org/10.1074/jbc.M513524200
• ²⁸
  Belletti B, Baldassarre G. Stathmin: a protein with many tasks. New biomarker and potential target in cancer. Expert Opin Ther Targets. 2011;15(11):1249-66. DOI:10.1517/14728222.2011.620951
  » https://doi.org/10.1517/14728222.2011.620951
• ²⁹
  Strahler JR, Lamb BJ, Ungar DR, Fox DA, Hanash SM. Cell cycle progression is associated with distinct patterns of phosphorylation of Op18. Biochem Biophys Res Commun. 1992;185(1):197-203. DOI:10.1016/S0006-291X(05)80975-1
  » https://doi.org/10.1016/S0006-291X(05)80975-1
• ³⁰
  Brattsand G, Marklund U, Nylander K, Roos G, Gullberg M. Cell-cycle-regulated phosphorylation of oncoprotein 18 on Ser16, Ser25 and Ser38. Eur J Biochem. 1994;220(2):359-68. DOI:10.1111/j.1432-1033.1994.tb18632.x
  » https://doi.org/10.1111/j.1432-1033.1994.tb18632.x
• ³¹
  Hayashi K, Pan Y, Shu H, Ohshima T, Kansy JW, White CL, et al. Phosphorylation of the tubulin-binding protein, stathmin, by Cdk5 and MAP kinases in the brain. J Neurochem. 2006;99(1):237-50. DOI:10.1111/j.1471-4159.2006.04113.x
  » https://doi.org/10.1111/j.1471-4159.2006.04113.x
• ³²
  Larsson N, Marklund U, Gradin HM, Brattsand G, Gullberg M. Control of microtubule dynamics by oncoprotein 18: dissection of the regulatory role of multisite phosphorylation during mitosis. Mol Cell Biol. 1997;17(9):5530-9. DOI:10.1128/MCB.17.9.5530
  » https://doi.org/10.1128/MCB.17.9.5530
• ³³
  Andersen SS, Ashford AJ, Tournebize R, Gavet O, Sobel A, Hyman AA, et al. Mitotic chromatin regulates phosphorylation of Stathmin/Op18. Nature. 1997;389(6651):640-3. DOI:10.1038/39382
  » https://doi.org/10.1038/39382
• ³⁴
  Schubart UK, Alago W, Danoff A. Properties of p19, a novel cAMP-dependent protein kinase substrate protein purified from bovine brain. J Biol Chem. 1987;262(24):11871-7.
• ³⁵
  Gadea BB, Ruderman J V. Aurora B is required for mitotic chromatin-induced phosphorylation of Op18/Stathmin. Proc Natl Acad Sci U S A. 2006;103(12):4493-8. DOI:10.1073/pnas.0600702103
  » https://doi.org/10.1073/pnas.0600702103
• ³⁶
  Daub H, Gevaert K, Vandekerckhove J, Sobel A, Hall A. Rac/Cdc42 and p65PAK regulate the microtubule-destabilizing protein stathmin through phosphorylation at serine 16. J Biol Chem. 2001;276(3):1677-80. DOI:10.1074/jbc.C000635200
  » https://doi.org/10.1074/jbc.C000635200
• ³⁷
  Marklund U, Larsson N, Brattsand G, Osterman O, Chatila TA, Gullberg M. Serine 16 of oncoprotein 18 is a major cytosolic target for the Ca2+/calmodulin-dependent kinase-Gr. Eur J Biochem. 1994;225(1):53-60. DOI:10.1111/j.1432-1033.1994.00053.x
  » https://doi.org/10.1111/j.1432-1033.1994.00053.x
• ³⁸
  le Gouvello S, Manceau V, Sobel A. Serine 16 of stathmin as a cytosolic target for Ca2+/calmodulin-dependent kinase II after CD2 triggering of human T lymphocytes. J Immunol. 1998;161(3):1113-22.
• ³⁹
  Holmfeldt P, Larsson N, Segerman B, Howell B, Morabito J, Cassimeris L, et al. The catastrophe-promoting activity of ectopic Op18/stathmin is required for disruption of mitotic spindles but not interphase microtubules. Mol Biol Cell. 2001;12(1):73-83. DOI:10.1091/mbc.12.1.73
  » https://doi.org/10.1091/mbc.12.1.73
• ⁴⁰
  Iancu C, Mistry SJ, Arkin S, Wallenstein S, Atweh GF. Effects of stathmin inhibition on the mitotic spindle. J Cell Sci. 2001;114(Pt 5):909-16.
• ⁴¹
  Tournebize R, Andersen SS, Verde F, Dorée M, Karsenti E, Hyman AA. Distinct roles of PP1 and PP2A-like phosphatases in control of microtubule dynamics during mitosis. EMBO J. 1997;16(18):5537-49. DOI:10.1093/emboj/16.18.5537
  » https://doi.org/10.1093/emboj/16.18.5537
• ⁴²
  Mistry SJ, Li HC, Atweh GF. Role for protein phosphatases in the cell-cycle-regulated phosphorylation of stathmin. Biochem J. 1998;334(Pt 1):23-9.
• ⁴³
  Yeap YYC, Ng IH, Badrian B, Nguyen T-V, Yip YY, Dhillon AS, et al. c-Jun N-terminal kinase/c-Jun inhibits fibroblast proliferation by negatively regulating the levels of stathmin/oncoprotein 18. Biochem J. 2010;430(2):345-54. DOI:10.1042/BJ20100425
  » https://doi.org/10.1042/BJ20100425
• ⁴⁴
  Yip YY, Yeap YYC, Bogoyevitch MA, Ng DC. Differences in c-Jun N-terminal kinase recognition and phosphorylation of closely related stathmin-family members. Biochem Biophys Res Commun. 2014;446(1):248-54. DOI:10.1016/j.bbrc.2014.02.101
  » https://doi.org/10.1016/j.bbrc.2014.02.101
• ⁴⁵
  Kinoshita I, Leaner V, Katabami M, Manzano RG, Dent P, Sabichi A et al. Identification of cJun-responsive genes in Rat-1a cells using multiple techniques: increased expression of stathmin is necessary for cJun-mediated anchorage-independent growth. Oncogene. 2003;22(18):2710-22. DOI:10.1038/sj.onc.1206371
  » https://doi.org/10.1038/sj.onc.1206371
• ⁴⁶
  Parker CG, Hunt J, Diener K, McGinley M, Soriano B, Keesler GA, et al. Identification of stathmin as a novel substrate for p38 delta. Biochem Biophys Res Commun. 1998;249(3):791-6. DOI:10.1006/bbrc.1998.9250
  » https://doi.org/10.1006/bbrc.1998.9250
• ⁴⁷
  Mizumura K, Takeda K, Hashimoto S, Horie T, Ichijo H. Identification of Op18/stathmin as a potential target of ASK1-p38 MAP kinase cascade. J Cell Physiol. 2006;206(2):363-70. DOI:10.1002/jcp.20465
  » https://doi.org/10.1002/jcp.20465
• ⁴⁸
  Hu JY, Chu ZG, Han J, Dang YM, Yan H, Zhang Q, et al. The p38/MAPK pathway regulates microtubule polymerization through phosphorylation of MAP4 and Op18 in hypoxic cells. Cell Mol Life Sci. 2010;67(2):321-33. DOI:10.1007/s00018-009-0187-z
  » https://doi.org/10.1007/s00018-009-0187-z
• ⁴⁹
  Alesi GN, Jin L, Li D, Magliocca KR, Kang Y, Chen ZG, et al. RSK2 signals through stathmin to promote microtubule dynamics and tumor metastasis. Oncogene. 2016;35(41):5412-21. DOI:10.1038/onc.2016.79
  » https://doi.org/10.1038/onc.2016.79
• ⁵⁰
  Drouva SV, Poulin B, Manceau V, Sobel A. Luteinizing hormone-releasing hormone-signal transduction and stathmin phosphorylation in the gonadotrope alphaT3-1 cell line. Endocrinology. 1998;139(5):2235-9. DOI:10.1210/endo.139.5.5995
  » https://doi.org/10.1210/endo.139.5.5995
• ⁵¹
  Tseng YH, Huang YH, Lin TK, Wu SM, Chi HC, Tsai CY et al. Thyroid hormone suppresses expression of stathmin and associated tumor growth in hepatocellular carcinoma. Sci Rep. 2016;6:38756. DOI:10.1038/srep38756
  » https://doi.org/10.1038/srep38756
• ⁵²
  Hunter AW, Wordeman L. How motor proteins influence microtubule polymerization dynamics. J Cell Sci. 2000;113 Pt 24:4379-89.
• ⁵³
  Rakic P, Knyihar-Csillik E, Csillik B. Polarity of microtubule assemblies during neuronal cell migration. Proc Natl Acad Sci U S A. 1996;93(17):9218-22. DOI:10.1073/pnas.93.17.9218
  » https://doi.org/10.1073/pnas.93.17.9218
• ⁵⁴
  Schimmack S, Taylor A, Lawrence B, Schmitz-Winnenthal H, Fischer L, Büchler MW, et al. Stathmin in pancreatic neuroendocrine neoplasms: a marker of proliferation and PI3K signaling. Tumor Biol. 2014;36(1):399-408. DOI:10.1007/s13277-014-2629-y
  » https://doi.org/10.1007/s13277-014-2629-y
• ⁵⁵
  Baldassarre G, Belletti B, Nicoloso MS, Schiappacassi M, Vecchione A, Spessotto P et al . p27(Kip1)-stathmin interaction influences sarcoma cell migration and invasion. Cancer Cell. 2005;7(1):51-63. DOI:10.1016/j.ccr.2004.11.025
  » https://doi.org/10.1016/j.ccr.2004.11.025
• ⁵⁶
  Nadeem L, Brkic J, Chen YF, Bui T, Munir S, Peng C. Cytoplasmic mislocalization of p27 and CDK2 mediates the anti-migratory and anti-proliferative effects of Nodal in human trophoblast cells. J Cell Sci. 2013;126(Pt 2):445-53. DOI:10.1242/jcs.110197
  » https://doi.org/10.1242/jcs.110197
• ⁵⁷
  Kuang XY, Jiang HS, Li K, Zheng YZ, Liu YR, Qiao F et al. The phosphorylation-specific association of STMN1 with GRP78 promotes breast cancer metastasis. Cancer Lett. 2016;377(1):87-96. DOI:10.1016/j.canlet.2016.04.035
  » https://doi.org/10.1016/j.canlet.2016.04.035
• ⁵⁸
  Fife CM, Sagnella SM, Teo WS, Po'uha ST, Byrne FL, Yeap YY, et al. Stathmin mediates neuroblastoma metastasis in a tubulin-independent manner via RhoA/ROCK signaling and enhanced transendothelial migration. Oncogene. 2017;36(4):501-11. DOI:10.1038/onc.2016.220
  » https://doi.org/10.1038/onc.2016.220
• ⁵⁹
  Jeon T-Y, Han M-E, Lee Y-W, Lee Y-S, Kim G-H, Song G-A, et al. Overexpression of stathmin1 in the diffuse type of gastric cancer and its roles in proliferation and migration of gastric cancer cells. Br J Cancer. 2010;102(4):710-8. DOI:10.1038/sj.bjc.6605537
  » https://doi.org/10.1038/sj.bjc.6605537
• ⁶⁰
  Rubin CI, Atweh GF. The role of stathmin in the regulation of the cell cycle. J Cell Biochem. 2004;93(2):242-50. DOI:10.1002/jcb.20187
  » https://doi.org/10.1002/jcb.20187
• ⁶¹
  Tan HT, Wu W, Ng YZ, Zhang X, Yan B, Ong CW, et al. Proteomic analysis of colorectal cancer metastasis: stathmin-1 revealed as a player in cancer cell migration and prognostic marker. J Proteome Res. 2012;11(2):1433-45. DOI:10.1021/pr2010956
  » https://doi.org/10.1021/pr2010956
• ⁶²
  Wei SH, Lin F, Wang X, Gao P, Zhang HZ. Prognostic significance of stathmin expression in correlation with metastasis and clinicopathological characteristics in human ovarian carcinoma. Acta Histochem. 2008;110(1):59-65. DOI:10.1016/j.acthis.2007.06.002
  » https://doi.org/10.1016/j.acthis.2007.06.002
• ⁶³
  Reyes HD, Miecznikowski J, Gonzalez-Bosquet J, Devor EJ, Zhang Y, Thiel KW, et al. High stathmin expression is a marker for poor clinical outcome in endometrial cancer: An NRG oncology group/gynecologic oncology group study. Gynecol Oncol. 2017;146(2):247-53. DOI:10.1016/j.ygyno.2017.05.017
  » https://doi.org/10.1016/j.ygyno.2017.05.017
• ⁶⁴
  Hsieh SY, Huang SF, Yu MC, Yeh T Sen, Chen TC, Lin YJ, et al. Stathmin1 overexpression associated with polyploidy, tumor-cell invasion, early recurrence, and poor prognosis in human hepatoma. Mol Carcinog. 2010;49(5):476-87. DOI:10.1002/mc.20627
  » https://doi.org/10.1002/mc.20627
• ⁶⁵
  Chen YL, Uen YH, Li CF, Horng KC, Chen LR, Wu WR, et al. The E2F transcription factor 1 transactives stathmin 1 in hepatocellular carcinoma. Ann Surg Oncol 2013;20(12):4041-54. DOI:10.1245/s10434-012-2519-8
  » https://doi.org/10.1245/s10434-012-2519-8
• ⁶⁶
  Jeon T-Y, Han M-E, Lee Y-W, Lee Y-S, Kim G-H, Song G-A, et al. Overexpression of stathmin1 in the diffuse type of gastric cancer and its roles in proliferation and migration of gastric cancer cells. Br J Cancer. 2010;102(4):710-8. DOI:10.1038/sj.bjc.6605537
  » https://doi.org/10.1038/sj.bjc.6605537
• ⁶⁷
  Liu X, Liu H, Liang J, Yin B, Xiao J, Li J, et al. Stathmin is a potential molecular marker and target for the treatment of gastric cancer. Int J Clin Exp Med. 2015;8(4):6502-9.
• ⁶⁸
  Li X, Wang L, Li T, You B, Shan Y, Shi S, et al. STMN1 overexpression correlates with biological behavior in human cutaneous squamous cell carcinoma. Pathol Res Pract. 2015;211(11):816-23. DOI:10.1016/j.prp.2015.07.009
  » https://doi.org/10.1016/j.prp.2015.07.009
• ⁶⁹
  Sabherwal Y, Mahajan N, Helseth DL, Gassmann M, Shi H, Zhang M. PDEF downregulates stathmin expression in prostate cancer. Int J Oncol. 2012;40(6):1889-99. DOI:10.3892/ijo.2012.1392
  » https://doi.org/10.3892/ijo.2012.1392
• ⁷⁰
  Baquero MT, Hanna JA, Neumeister V, Cheng H, Molinaro AM, Harris LN, et al. Stathmin expression and its relationship to microtubule-associated protein tau and outcome in breast cancer. Cancer. 2012;118(19):4660-9. DOI:10.1002/cncr.27453
  » https://doi.org/10.1002/cncr.27453
• ⁷¹
  Procházková I, Lenčo J, Fučíková A, Dresler J, Čápková L, Hrstka R, Nenutil R, Bouchal P. Targeted proteomics driven verification of biomarker candidates associated with breast cancer aggressiveness. Biochim Biophys Acta. 2017;1865(5):488-98. DOI:10.1016/j.bbapap.2017.02.012
  » https://doi.org/10.1016/j.bbapap.2017.02.012
• ⁷²
  Xi W, Rui W, Fang L, Ke D, Ping G, Hui-Zhong Z. Expression of stathmin/op18 as a significant prognostic factor for cervical carcinoma patients. J Cancer Res Clin Oncol. 2009;135(6):837-46. DOI:10.1007/s00432-008-0520-1
  » https://doi.org/10.1007/s00432-008-0520-1
• ⁷³
  Nie W, Xu M-D, Gan L, Huang H, Xiu Q, Li B. Overexpression of stathmin 1 is a poor prognostic biomarker in non-small cell lung cancer. Lab Investig. 2014;95(1):56-64. DOI:10.1038/labinvest.2014.124
  » https://doi.org/10.1038/labinvest.2014.124
• ⁷⁴
  Sun R, Liu Z, Wang L, Lv W, Liu J, Ding C, et al. Overexpression of stathmin is resistant to paclitaxel treatment in patients with non-small cell lung cancer. Tumour Biol. 2015;36(9):7195-204. DOI:10.1007/s13277-015-3361-y
  » https://doi.org/10.1007/s13277-015-3361-y
• ⁷⁵
  Yurong L, Biaoxue R, Wei L, Zongjuan M, Hongyang S, Ping F et al. Stathmin overexpression is associated with growth, invasion and metastasis of lung adenocarcinoma. Oncotarget. 2017;8(16):26000-12. DOI:10.18632/oncotarget
  » https://doi.org/10.18632/oncotarget
• ⁷⁶
  Hemdan T, Lindén M, Lind SB, Namuduri A V, Sjöstedt E, de Stahl TD, et al. The prognostic value and therapeutic target role of stathmin-1 in urinary bladder cancer. Br J Cancer. 2014;111(6):1180-7. DOI:10.1038/bjc.2014.427
  » https://doi.org/10.1038/bjc.2014.427
• ⁷⁷
  Zhang HQ, Guo X, Guo SQ, Wang Q, Chen XQ, Li XN, et al. STMN1 in colon cancer: expression and prognosis in Chinese patients. Eur Rev Med Pharmacol Sci. 2016;20(10):2038-44.
• ⁷⁸
  Lu Y, Liu C, Cheng H, Xu Y, Jiang J, Xu J et al. Stathmin, interacting with Nf- κB, promotes tumor growth and predicts poor prognosis of pancreatic cancer. Curr Mol Med. 2014;14(3):328-39.
• ⁷⁹
  Watanabe A, Araki K, Yokobori T, Altan B, Ishii N, Tsukagoshi M et al. Stathmin 1 promotes the proliferation and malignant transformation of pancreatic intraductal papillary mucinous neoplasms. Oncol Lett. 2017;13(3):1783-88. DOI:10.3892/ol.2017.5603
  » https://doi.org/10.3892/ol.2017.5603
• ⁸⁰
  Hsu HP, Li CF, Lee SW, Wu WR, Chen TJ, Chang KY et al. Overexpression of stathmin 1 confers an independent prognostic indicator in nasopharyngeal carcinoma. Tumour Biol. 2014;35(3):2619-29. DOI:10.1007/s13277-013-1345-3
  » https://doi.org/10.1007/s13277-013-1345-3
• ⁸¹
  Wang F, Xuan XY, Yang X, Cao L, Pang LN, Zhou R, et al. Stathmin is a marker of progression and poor prognosis in esophageal carcinoma. Asian Pac J Cancer Prev. 2014;15(8):3613-8. DOI:10.7314/APJCP.2014.15.8.3613
  » https://doi.org/10.7314/APJCP.2014.15.8.3613
• ⁸²
  Suzuki S, Yokobori T, Altan B, Hara K, Ozawa D, Tanaka N, et al. High stathmin1 expression is associated with poor prognosis and chemoradiation resistance in esophageal squamous cell carcinoma. Int J Oncol. 2017. DOI:10.3892/ijo.2017.3899. [Epub ahead of print]
  » https://doi.org/10.3892/ijo.2017.3899
• ⁸³
  Ma HL, Jin SF, Tao WJ, Zhang ML, Zhang ZY. Overexpression of stathmin/oncoprotein 18 correlates with poorer prognosis and interacts with p53 in oral squamous cell carcinoma. J. Cranio-Maxillofacial Surg.2016;44(10):1725-32. DOI:10.1016/j.jcms.2016.07.033
  » https://doi.org/10.1016/j.jcms.2016.07.033
• ⁸⁴
  Wang J, Yao Y, Ming Y, Shen S, Wu N, Liu J, et al. Downregulation of stathmin 1 in human gallbladder carcinoma inhibits tumor growth in vitro and in vivo. Sci Rep. 2016;28;6:28833. DOI:10.1038/srep28833
  » https://doi.org/10.1038/srep28833
• ⁸⁵
  Trovik J, Wik E, Stefansson IM, Marcickiewicz J, Tingulstad S, Staff AC, et al. Stathmin overexpression identifies high-risk patients and lymph node metastasis in endometrial cancer. Clin Cancer Res. 2011;17(10):3368-77. DOI:10.1158/1078-0432.CCR-10-2412
  » https://doi.org/10.1158/1078-0432.CCR-10-2412
• ⁸⁶
  He X, Liao Y, Lu W, Xu G, Tong H, Ke J, et al. Elevated STMN1 promotes tumor growth and invasion in endometrial carcinoma. Tumour Biol. 2016;37(7):9951-8. DOI:10.1007/s13277-016-4869-5
  » https://doi.org/10.1007/s13277-016-4869-5
• ⁸⁷
  Watanabe A, Suzuki H, Yokobori T, Tsukagoshi M, Altan B, Kubo N, et al. Stathmin1 regulates p27 expression, proliferation and drug resistance, resulting in poor clinical prognosis in cholangiocarcinoma. Cancer Sci. 2014;105(6):690-6. DOI:10.1111/cas.12417
  » https://doi.org/10.1111/cas.12417
• ⁸⁸
  Neben K, Korshunov A, Benner A, Wrobel G, Hahn M, Kokocinski F, et al. Microarray-based screening for molecular markers in medulloblastoma revealed STK15 as independent predictor for survival. Cancer Res. 2004;64(9):3103-11. DOI:10.1158/0008-5472.CAN-03-3968
  » https://doi.org/10.1158/0008-5472.CAN-03-3968
• ⁸⁹
  Zanini C, Mandili G, Bertin D, Cerutti F, Baci D, Leone M, et al. Analysis of different medulloblastoma histotypes by two-dimensional gel and MALDI-TOF. Child's Nerv Syst 2011;27(12):2077-85. DOI:10.1007/s00381-011-1515-9
  » https://doi.org/10.1007/s00381-011-1515-9
• ⁹⁰
  Liu H, Li Y, Li Y, Zhou L, Bie L. STMN1 as a candidate gene associated atypical meningioma progression. Clin Neurol Neurosurg. 2017;159:107-10. DOI:10.1016/j.clineuro.2017.06.003
  » https://doi.org/10.1016/j.clineuro.2017.06.003
• ⁹¹
  Wang H, Li W, Wang G, Zhang S, Bie L. Overexpression of STMN1 is associated with the prognosis of meningioma patients. Neurosci Lett. 2017;654:1-5. DOI:10.1016/j.neulet.2017.06.020
  » https://doi.org/10.1016/j.neulet.2017.06.020
• ⁹²
  Hanash SM, Strahler JR, Kuick R, Chu EHY, Nichols D. Identification of a polypeptide associated with the malignant phenotype in acute leukemia. J Biol Chem. 1988;263(26):12813-5.
• ⁹³
  Schiappacassi M, Lovat F, Canzonieri V, Belletti B, Berton S, Di Stefano D et al. p27Kip1 expression inhibits glioblastoma growth, invasion, and tumor-induced neoangiogenesis. Mol Cancer Ther. 2008;7(5):1164-75. DOI:10.1158/1535-7163.MCT-07-2154
  » https://doi.org/10.1158/1535-7163.MCT-07-2154
• ⁹⁴
  Schiappacassi M, Lovisa S, Lovat F, Fabris L, Colombatti A, Belletti B et al. Role of T198 modification in the regulation of p27(Kip1) protein stability and function. PLoS One. 2011;6(3):e17673. DOI:10.1371/journal.pone.0017673
  » https://doi.org/10.1371/journal.pone.0017673
• ⁹⁵
  Ng DCH, Bao HL, Cheh PL, Huang G, Zhang T, Poli V, et al. Stat3 regulates microtubules by antagonizing the depolymerization activity of stathmin. J Cell Biol 2006;172(2):245-57. DOI:10.1083/jcb.200503021
  » https://doi.org/10.1083/jcb.200503021
• ⁹⁶
  Verma NK, Dourlat J, Davies AM, Long A, Liu WQ, Garbay C, et al. STAT3-stathmin interactions control microtubule dynamics in migrating T-cells. J Biol Chem 2009;284(18):12349-62. DOI:10.1074/jbc.M807761200
  » https://doi.org/10.1074/jbc.M807761200
• ⁹⁷
  Ganguly R, Hong CS, Smith LG, Kornblum HI, Nakano I. Maternal embryonic leucine zipper kinase: key kinase for stem cell phenotype in glioma and other cancers. Mol Cancer Ther. 2014;13(6):1393-8. DOI:10.1158/1535-7163.MCT-13-0764
  » https://doi.org/10.1158/1535-7163.MCT-13-0764
• ⁹⁸
  Joshi K, Banasavadi-Siddegowda Y, Mo X, Kim SH, Mao P, Kig C et al. MELK-dependent FOXM1 phosphorylation is essential for proliferation of glioma stem cells. Stem Cells. 2013;31(6):1051-63. DOI:10.1002/stem.1358
  » https://doi.org/10.1002/stem.1358
• ⁹⁹
  Johnsen JI, Aurelio ON, Kwaja Z, Jörgensen GE, Pellegata NS, Plattner R, et al. p53-mediated negative regulation of stathmin/Op18 expression is associated with G2/M cell-cycle arrest. Int J Cancer. 2000;88(5):685-91. DOI:10.1002/1097-0215(20001201)88:5<685::AID-IJC1>3.0.CO;2-Z
  » https://doi.org/10.1002/1097-0215(20001201)88:5<685::AID-IJC1>3.0.CO;2-Z
• ¹⁰⁰
  Fang L, Min L, Lin Y, Ping G, Rui W, Ying Z, et al. Downregulation of stathmin expression is mediated directly by Egr1 and associated with p53 activity in lung cancer cell line A549. Cell Signal. 2010;22(1):166-73. DOI:10.1016/j.cellsig.2009.09.030
  » https://doi.org/10.1016/j.cellsig.2009.09.030
• ¹⁰¹
  Yuan RH, Jeng YM, Chen HL, Lai PL, Pan HW, Hsieh FJ, et al. Stathmin overexpression cooperates with p53 mutation and osteopontin overexpression, and is associated with tumour progression, early recurrence, and poor prognosis in hepatocellular carcinoma. J Pathol. 2006;209(4):549-58. DOI:10.1002/path.2011
  » https://doi.org/10.1002/path.2011
• ¹⁰²
  Alli E, Yang J-M, Hait WN. Silencing of stathmin induces tumor-suppressor function in breast cancer cell lines harboring mutant p53. Oncogene. 2007;26(7):1003-12. DOI:10.1038/sj.onc.1209864
  » https://doi.org/10.1038/sj.onc.1209864
• ¹⁰³
  Sonego M, Schiappacassi M, Lovisa S, Dall'Acqua A, Bagnoli M, Lovat F, et al. Stathmin regulates mutant p53 stability and transcriptional activity in ovarian cancer. EMBO Mol Med. 2013;5(5):707-22. DOI:10.1002/emmm.201201504
  » https://doi.org/10.1002/emmm.201201504
• ¹⁰⁴
  Silva VC, Plooster M, Leung JC, Cassimeris L. A delay prior to mitotic entry triggers caspase 8-dependent cell death in p53-deficient hela and hct-116 cells. Cell Cycle. 2015;14(7):1070-81. DOI:10.1080/15384101.2015.1007781
  » https://doi.org/10.1080/15384101.2015.1007781
• ¹⁰⁵
  Ma HL, Jin SF, Ju WT, Fu Y, Tu YY, Wang LZ et al. Stathmin is overexpressed and regulated by mutant p53 in oral squamous cell carcinoma. J Exp Clin Cancer Res. 2017;36(1):109. DOI:10.1186/s13046-017-0575-4
  » https://doi.org/10.1186/s13046-017-0575-4
• ¹⁰⁶
  Liu J, Cao J, Zhao X. miR-221 facilitates the TGFbeta1-induced epithelial-mesenchymal transition in human bladder cancer cells by targeting STMN1. BMC Urol. 2015;15:36. DOI:10.1186/s12894-015-0028-3
  » https://doi.org/10.1186/s12894-015-0028-3
• ¹⁰⁷
  Vetter NS, Kolb EA, Mills CC, Sampson VB. The Microtubule Network and Cell Death Are Regulated by an miR-34a/Stathmin 1/ßIII-Tubulin Axis. Mol Cancer Res. 2017;15(7):953-64. DOI:10.1158/1541-7786.MCR-16-0372
  » https://doi.org/10.1158/1541-7786.MCR-16-0372
• ¹⁰⁸
  Wong QW, Lung RW, Law PT, Lai PB, Chan KY, To KF, et al. MicroRNA-223 is commonly repressed in hepatocellular carcinoma and potentiates expression of Stathmin1. Gastroenterology. 2008;135(1):257-69. DOI:10.1053/j.gastro.2008.04.003
  » https://doi.org/10.1053/j.gastro.2008.04.003
• ¹⁰⁹
  Tamura K, Yoshie M, Miyajima E, Kano M, Tachikawa E. Stathmin Regulates Hypoxia-Inducible Factor-1a Expression through the Mammalian Target of Rapamycin Pathway in Ovarian Clear Cell Adenocarcinoma. ISRN Pharmacol. 2013;2013:279593. DOI:10.1155/2013/279593
  » https://doi.org/10.1155/2013/279593
• ¹¹⁰
  McGrogan BT, Gilmartin B, Carney DN, McCann A. Taxanes, microtubules and chemoresistant breast cancer. Biochim Biophys Acta - Rev Cancer 2008;1785(2):96-132. DOI:10.1016/j.bbcan.2007.10.004
  » https://doi.org/10.1016/j.bbcan.2007.10.004
• ¹¹¹
  Biaoxue R, Xiguang C, Hua L, Shuanying Y. Stathmin-dependent molecular targeting therapy for malignant tumor: the latest 5 years' discoveries and developments. J Transl Med. 2016;14(1):279. DOI:10.1186/s12967-016-1000-z
  » https://doi.org/10.1186/s12967-016-1000-z
• ¹¹²
  Bai T, Yokobori T, Altan B, Ide M, Mochiki E, Yanai M et al. High STMN1 level is associated with chemo-resistance and poor prognosis in gastric cancer patients. Br J Cancer. 2017;116(9):1177-85. DOI:10.1038/bjc.2017.76
  » https://doi.org/10.1038/bjc.2017.76

Publication Dates

• Publication in this collection
  Sep-Oct 2017

History

• Received
  04 July 2017
• Reviewed
  04 Aug 2017
• Accepted
  18 Oct 2017