Genomic relationships of the polyploid rhizoma peanut (Arachis glabrata Benth.) inferred by genomic in situ hybridization (GISH)

Abstract

The rhizoma peanut (Arachis glabrata Benth., section Rhizomatosae) is a tetraploid perennial legume. Although several A. glabrata cultivars have been developed as forage and ornamental turf, the origin and genomic constitution of this species are still unknown. In this study, we evaluated the affinity between the genomes of A. glabrata and the probable diploid donors of the sections Rhizomatosae, Arachis, Erectoides and Procumbentes by genomic in situ hybridization (GISH). Single GISH analyses detected that species of the sections Erectoides (E₂ subgenome) and Procumbentes (E₃ subgenome) were the diploid species with the highest degree of genomic affinity with A. glabrata. Based on single GISH experiments and DNA sequence similarity, three species -A. duranensis, A. paraguariensis subsp. capibarensis, and A. rigonii-, which showed the most uniform and brightest hybridization patterns and lowest genetic distance, were selected as probes for double GISH experiments. Double GISH experiments showed that A. glabrata is constituted by four identical or very similar chromosome complements. In these assays, A. paraguariensis subsp. capibarensis showed the highest brightness onto A. glabrata chromosomes. Thus, our results support the autopolyploid origin of A. glabrata and show that the species with E₂ subgenome are the most probable ancestors of this polyploid legume forage.

Key words
Arachis ; chloroplast trnT-S and trnT-Y sequences; genomic constitution; genomic in situ hybridization (GISH); nuclear ribosomal internal transcribed spacer (ITS); polyploidy

INTRODUCTION

Arachis L. (Leguminosae) is a South American genus that comprises 83 species (Krapovickas & Gregory 1994, Valls & Simpson 2005, Valls et al. 2013, Santana & Valls 2015, Valls & Simpson 2017, Seijo et al. 2021). According to their morphological characteristics, geographic distribution, and cross-compatibility, these species have been distributed into nine taxonomic sections: Arachis, Caulorrhizae, Erectoides, Extranervosae, Heteranthae, Procumbentes, Rhizomatosae, Trierectoides and Triseminatae (Krapovickas & Gregory 1994). These species are mostly autogamous with geocarpic fruits (Krapovickas & Gregory 1994), and have two basic chromosome numbers: x = 9 and x = 10 (Fernández & Krapovickas 1994, Peñaloza & Valls 2005, Lavia et al. 2008). In these species, seven different genomes (A, B, D, F, G, K, and R) have been formally recognized (Smartt et al. 1978, Stalker 1991, Robledo et al. 2009, Robledo & Seijo 2010, Silvestri et al. 2015, Ortiz et al. 2017), while other five (Am, C, E, Ex and T) have been assigned based on the infrageneric division (Smartt & Stalker 1982). In addition, in the species with E genome, three subgenomes (E₁, E₂ and E₃) have been tentatively suggested for the series Trierectoides, Erectoides and Procumbentes, respectively (Smartt & Stalker 1982), which are currently homonymous sections (Krapovickas & Gregory 1994).

The genus Arachis includes three economically important species: the peanut (A. hypogaea), the forage peanut (A. pintoi) and the rhizoma peanut (A. glabrata). Arachis hypogaea L. (section Arachis) is an oilseed crop and a direct source of human food, whereas A. pintoi Krapov. & W.C. Greg. (section Caulorrhizae) and A. glabrata Benth. (section Rhizomatosae) are forage species used in tropical and subtropical regions. The genome composition and genetic origin of A. hypogaea (Seijo et al. 2004, 2007, 2018, Grabiele et al. 2012, Zhang et al. 2016, Bertioli et al. 2019, 2020) and A. pintoi (Lavia et al. 2011, Pucciariello et al. 2013) have been deeply investigated at both cytogenetic and molecular levels, whereas those of A. glabrata remain largely unknown.

Arachis glabrata is a tetraploid species with 2n=4x=40 (Gregory et al. 1973). It is a perennial warm-season legume, native to the northeast of Argentina, east of Paraguay and Bolivia, and south of Brazil (Krapovickas & Gregory 1994). On the basis of leaf morphology and geographic distribution, two varieties have been recognized: A. glabrata var. glabrata and var. hagenbeckii (Harms ex Kuntze) F. J. Herm. (Krapovickas & Gregory 1994). In North America and Australia, this species is used as a forage crop because of its high tolerance to grazing and cold temperatures, high nutritive value and digestibility (similar to those of alfalfa), good dry matter production, fast coverage rate, and high potential for use in mixtures with vigorous C4 grasses (French et al. 2006, Mullenix et al. 2016). Several cultivars have been developed and are commercialized as forage and ornamental turf (Prine et al. 1981, 1986, 1990, 2010, Muir et al. 2010, Quesenberry et al. 2010). However, since all commercial cultivars derive from a few plant introductions, their genetic variability is reduced (French et al. 1994). Moreover, it is estimated that over 90% of the planted A. glabrata corresponds to the cultivar ‘Florigraze’ (Quesenberry et al. 2010), increasing the concern for the genetic vulnerability of this crop.

The potential productivity and adaptability of A. glabrata could be increased by incorporating accessions of this species from diverse origins to the breeding programs as well as by using the available genetic diversity in related Arachis species. For the latter purpose, to select the most compatible species from a panel of potential wild species with desirable traits to be introgressed, basic information about the genome composition of A. glabrata is still needed. The available information about the genetic origin of A. glabrata and its polyploid nature is still controversial. Different genomic constitutions and different degrees of diploidization have been reported (Gregory & Gregory 1979, Raman 1981, Jahnavi & Murty 1985, Singh & Simpson 1994, Ortiz et al. 2011, 2017), and also different wild species have been postulated to be involved in the genetic origin of A. glabrata. Therefore, investigating the genomic constitution of A. glabrata and its genomic relationships with genetically related Arachis species will help in the selection of diploid parents for the genetic improvement of the existing A. glabrata commercial cultivars.

Together with other two tetraploid [A. pseudovillosa (Chodat and Hassl.) Krapov. & W.C. Greg. and A. nitida Valls, Krapov. & C.E.Simpson, 2n=4x=40] and one diploid (A. burkartii Handro, 2n=2x=20) species, A. glabrata is included in the section Rhizomatosae for having rhizomes (Gregory et al. 1973, Fernández & Krapovickas 1994, Peñaloza & Valls 2005, Valls & Simpson 2005). The relationships of A. glabrata with other species of the section Rhizomatosae and with other species of the genus as a whole have been inferred from the analysis of cross-compatibility assays (Gregory & Gregory 1979, Krapovickas & Gregory 1994), field observations (Valls 1996), molecular markers (Gimenes et al. 2002, Nobile et al. 2004, Angelici et al. 2008), genomic sequences (internal transcribed spacers (ITS) and 5.8S ribosomal DNA (rDNA)) (Bechara et al. 2010, Friend et al. 2010), and comparative karyotype analyses (Ortiz et al. 2017). These approaches have demonstrated that A. glabrata is not closely related to A. burkartii, but revealed some genomic affinity with diploid species of the sections Arachis, Erectoides and Procumbentes. All these data suggest that the section Rhizomatosae may not be monophyletic, and have opened questions about the polyploid nature of A. glabrata, its genomic constitution, and the species that participated in its origin.

The genomic constitution and genetic origin of many polyploid plants have been investigated by complementary approaches such as genomic in situ hybridization (GISH) and DNA sequence polymorphism analysis (Liu et al. 2006, Chester et al. 2010, Mavrodiev et al. 2015, Marques et al. 2018, Wang et al. 2019). GISH has shown to be very useful in clarifying the genomic constitution and potential diploid ancestor of the allopolyploid peanut A. hypogaea (Seijo et al. 2007), whereas the variation in the ITS and 5.8 rDNA of nuclear rDNA (Bechara et al. 2010, Friend et al. 2010) and non-coding chloroplast DNA (cpDNA) sequences (Grabiele et al. 2012) has been useful to determine the wild species that most probably participated in the genetic origin of peanut. Therefore, we expect that these techniques could provide useful information to determine the genomic relationships of the polyploid A. glabrata.

In the present study, we conducted single and double GISHs onto both varieties of A. glabrata, by using ten diploid Arachis species representing the A, Am, K, E (E₂ and E₃ subgenomes) and R genomes, with the aim to: 1) gain insights into the genomic affinities between A. glabrata and its probable diploid genome donors, and 2) test the genomic composition and polyploid nature of A. glabrata. The polymorphisms of the nuclear ribosomal ITS and two non-coding cpDNA regions were used as aid to identify the most probable genome donors of A. glabrata from a set of cross-compatible species.

MATERIALS AND METHODS

Plant material

Samples of both A. glabrata varieties and ten diploid Arachis species were obtained from the Instituto de Botánica del Nordeste (Corrientes, Argentina). The diploid species analyzed were selected among those reported to produce hybrids with A. glabrata (Krapovickas & Gregory 1994) and to share karyotype landmarks similar to those of the tetraploid (Ortiz et al. 2017), except A. pusilla Benth., which was included as negative control for cytogenetic analyses. The original provenances and collection numbers of the species analyzed are cited in Table I.

Table I
List of the Arachis species and samples studied, their provenance, chromosome number, genome formula, type of DAPI pattern and number of ribosomal loci (rDNA). Species are ordered first by ploidy level and then by genomic constitution.

Taxon	Provenance a and collection number b	2n	Genomic constitutionc	DAPI Pattern d	rDNA loci e
					18-26S rDNA	5S rDNA
Sect. Rhizomatosae Krapov. & W.C. Greg.
A. glabrata Benth var. glabrata	Argentina, Prov. Misiones, Dept. Candelaria. SeLaSo 2842	40	E2E2E2E2*	Type 2	2 (10,10)	2 (3, 3)
A. glabrata Benth. var. hagenbeckii (Harms ex Kuntze) F. J. Herm.	Paraguay, Dept. Paraguari, 2 km N from Caapucú. KGPSc 30107	40	E2E2E2E2*	Type 2	2 (10,10)	2 (3, 3)
A. burkartii Handro	Argentina, Prov. Corrientes, Dept. Monte Caseros. SeSo 2872	20	RR	Type 5	4 (3+, 4, 10^)	1 (3)
Sect. Erectoides Krapov. & W.C. Greg.
A. hermannii Krapov. & W.C. Greg.	Brazil, St. MS, Mun. Coxim. VRGeSv 7560	20	E2E2	Type 2	1 (10)	1 (3)
A. major Krapov. & W. C. Gregory	Brazil, St. MS, Mun. Rio Negro. VPoBi 9468	20	E2E2	Type 2	1 (10)	1 (3)
A. paraguariensis subsp. capibarensis Krapov. & W.C. Greg.	Brazil, St. MS, Mun. Porto Murtinho. HLKHe 565/566	20	E2E2	Type 2	1 (10)	1 (3)
Sect. Procumbentes Krapov. & W.C. Greg.
A. appressipila Krapov. & W.C. Greg.	Brazil, St. MS, Corumbá. GKP 9993	20	E3E3	Type 2	2 (9, 10)	1 (3)
A. lignosa (Chodat & Hassl.) Krapov. & W.C. Greg.	Brazil, St. MS, Porto Murtinho. VRcSgSv 13570	20	E3E3	Type 2	1 (10)	1 (3)
A. rigonii Krapov. & W.C. Greg.	Bolivia, Dept. Santa Cruz, Santa Cruz de la Sierra. GKP 10034	20	E3E3	Type 2	1 (10)	1 (3)
Sect. Arachis
A. duranensis Krapov. & W.C. Greg.	Argentina, Prov. Salta, Dept. San Martín, Campo Durán. K 7988	20	AA	Type 1	2 (2, 10)	1 (3)
A. batizocoi Krapov. & W.C. Greg.	Bolivia, Dept. Santa Cruz, Prov. Cordillera, Paja Colorada. KGBPScS 30079	20	KK	Type 1	2 (4, 10)	3 (3, 8, 10)
Sect. Heteranthae Krapov. & W.C. Greg.
A. pusilla Benth.	Brazil, St. MG, Mun. Januária. VFaPzSv 13107	20	AmAm	Type 5	3 (2, 3, 10+)	1 (10)

• ^aNR National route, PR Provincial route, BR Brazilian route, Prov province, St State, Dept department, Mun Municipality. ^bCollectors: B, D.J. Banks; Bi, L. Bianchetti; Fa, L. Faraco de Freitas; G, W.C. Gregory; Ge, M.A.N. Gerin; H, R.O. Hammons; He, V. Hemsy; Hn, R. Heyn; K, A. Krapovickas; L, W.R. Langford; La, G.I. Lavia; P, J.R. Pietrarelli; Po, A. Pott; Pz, E. Pizarro, R, V.R. Rao; Rc, R.C. Oliveira; S, C.E. Simpson; Sc, A. Schinini; Se, J.G. Seijo; Sg, A.K. Singh; So, V. Solís Neffa; Sv, G.P. Silva; V, J.F.M. Valls. ^cgenome designation following Smartt & Stalker (1982), Robledo & Seijo (2010), Ortiz et al. (2017). E₂ and E₃ are subgenomes. * Genome constitution proposed in this work. ^dPatterns of DAPI heterochromatin distribution following Silvestri et al. (2020). ^eData are extracted from Robledo et al. (2009), Robledo & Seijo (2010), Ortiz et al. (2017) and Silvestri et al. (2020). Data correspond to the haploid complement. Numbers in parentheses are designations of the chromosome pairs bearing ribosomal sites. ^two 18-26S rDNA sites, +co-localization of 5S rDNA and 18-26S rDNA sites, underlined number indicates chromosome pair without DAPI bands.

Selection of diploid species by genetic distance of nuclear and cpDNA sequences

DNA extraction

Total genomic DNA (gDNA) was extracted from young actively growing leaves by using the cetyl trimethylammonium bromide (CTAB) procedure (Doyle & Doyle 1987). DNA concentrations and qualities were determined by spectrophotometry and gel electrophoresis, respectively.

DNA amplification, sequencing and analysis

ITS1, ITS2, 5.8S of nuclear rDNA and the two chloroplast trnT-S and trnT-Y sequences from the Arachis species analyzed were amplified via polymerase chain reaction (PCR) by using the primers and PCR profiles listed in Table II. The ITS sequences from eight species and the cpDNA sequences from two species used here were downloaded from GenBank (http://www.ncbi.nlm.nih.gov). The remaining ITS and cpDNA sequences were amplified in a 25 μl reaction mixture containing 100 ng template DNA, 1× reaction buffer, 0.5 μM of each primer, 0.2 mM of each dNTP, and 1U GoTaq DNA polymerase (Promega). The PCR products were detected on 1.4% agarose gels and submitted for sequencing to Macrogen Inc. (Seoul, Korea). The basic information about these sequences, including the GenBank identification numbers, is listed in Table SI (Supplementary Material).

Table II
The primers and PCR condition for the three regions analyzed.

Region	Name of primers	Sequence of primers (5”-3”)	Profiles	Source
ITS1-5.8S-ITS2	ITS5m ITS4	GGAAGGAGAAGTCGTAACAAGG TCCTCCGCTTATTGATATGC	1 cycle: 2 min 94°C; 35 cycles: 60s 94°C, 60s 55 °C, 60s 72°C; 1 cycle: 10min 72 °C.	White et al. (1990)
trnT–S	trnTUGUR trnSGGA	AGGTTAGAGCATCGCATTTG TACCGAGGGTTCGAATCCCTC T	1 cycle: 5 min 94°C; 35 cycles: 55s 94°C, 25s 56 °C, 25s 72°C; 1 cycle: 10min 72 °C.	Shaw et al. (2005)
trnT–Y	trnTGGU trnYGUA	CTACCACTGAGTTAAAAGGG CCGAGCTGGATTTGAACCA	1 cycle: 5 min 94°C; 35 cycles: 55s 94°C, 25s 56°C, 25s 72°C; 1 cycle: 10min 72 °C.	Shaw et al. (2005)

The sequences from chloroplast and nuclear markers were analyzed and edited using the Chromas 2.6.6 software (http://technelysium.com.au/wp/wp/chromas/), aligned with ClustalW, and refined manually using the software package MEGA v. 7 (Kumar et al. 2016). Species relationships were analyzed using the unweighted pair group method with arithmetic mean (UPGMA) (Sokal & Michener 1958) to estimate the genetic distances among Arachis species with the MEGA v.7 software. These analyses were performed using evolutionary distances calculated by the composite maximum likelihood method (Sneath & Sokal 1973, Tamura et al. 2004). Our objective was not to conduct a phylogenetic analysis but to identify the diploid species with the lowest genetic distance with A. glabrata, and thus to reduce the number of possible different combinations of double GISH experiments. The two cpDNA regions were analyzed together in the same sequence matrix because we had no reason to suspect incongruences among different regions of a uniparentally inherited, non-recombining genome. However, the plastid and nuclear sequences were analyzed separately.

GISH experiments

Chromosome preparations

All plants were grown under greenhouse conditions. Healthy root tips (5-20 mm long) of seedlings and rhizomes were pretreated with 2 mM 8-hydroxyquinoline for 3 h at room temperature (Fernández & Krapovickas 1994), and fixed and stored in absolute ethanol:glacial acetic acid (3:1) at -20 °C. Root apices were digested in 1 % (w/v) cellulase (from Trichoderma viride; Onozuka R-10, Serva) plus 10 % (v/v) pectinase dissolved in 40 % glycerol (from Aspergillus niger, Sigma-Aldrich) in 0.01 M citrate buffer, pH 4.8, at 37 °C for 60 min. Subsequently, the meristematic cells were removed from the root tip and squashed in 45 % (v/v) aqueous acetic acid. Coverslips were removed with CO₂, and the slides were air dried, aged for 1-2 days at room temperature, and then kept at -20 °C until use.

Design of the GISH experiments

To analyze the degree of genomic homology between A. glabrata and diploid species with different genomes/subgenomes (A, E₂, E₃, K and R), single and double GISH experiments were performed. Firstly, single GISH experiments were designed to determine which of the diploid species shared the greatest genomic homology with A. glabrata and thus reduce the number of possible combinations of double GISH experiments. For this purpose, gDNA of each A. glabrata variety was used as probe and hybridized to chromosomal preparations of the ten diploid species here assayed (Table I). Chromosomal preparations of the genetically distant A. pusilla (sect. Heteranthae, Am genome) were also included as a negative control of hybridization. Subsequently, the hybridization patterns of at least six metaphases from different individuals of each taxon were compared according to the distribution (from few localized dots to uniformly dispersed), location (proximal, interstitial or distal) and intensity (weak to strong) of the hybridization signals on the chromosomes, and different degrees of genomic hybridization were determined.

Based on the results of single GISH experiments and DNA sequence similarity, the species that showed the most uniform and brightest hybridization patterns and lowest genetic distance were selected to develop genomic probes for double GISH experiments. Also, the karyotype landmarks of the diploid species compared to those in the tetraploid (Ortiz et al. 2017) were considered. Arachis duranensis Krapov. & W.C. Greg. was included as a representative of the A genome despite its moderate genomic affinity revealed in the single GISH experiments, because it showed the lowest genetic distance in the cpDNA sequence analysis.

Double GISH experiments were performed onto the chromosomes of both varieties of A. glabrata and included two differentially labeled gDNA probes corresponding to diploid species with different genome/subgenomes (A and E₂, A and E₃, E₂ and E₃) and Salmon sperm DNA to block highly repetitive sequences.

Probe labeling and GISH

The gDNAs of the species selected were labeled with digoxigenin-11-dUTP (Roche) or biotin-16-dUTP (Roche) by nick translation. To reduce experimental artifacts due to poor labeling, firstly, each gDNA probe was checked by dot blot. Probes were fixed onto a H+ nitrocellulose membrane and then checked to produce similar colorimetric signal after detection with antibodies conjugated with alkaline phosphate and NBT/BCIP (Moscone et al. 1996) at different concentrations. Only those that produced similar colorimetric signal in the dilution series were used for the GISH experiments. Probes that passed the dot blot experiment were hybridized onto the chromosomes of the same species as a second control. The pretreatment of slides, chromosome and probe denaturation, conditions for the in situ hybridization (hybridization mixes containing gDNA probes at a concentration of 2.5-3.5 ng/µl and unlabeled sonicated DNA of Salmon sperm as blocking agent), post-hybridization washing, blocking, and indirect detection with fluorochrome-conjugated antibodies were performed according to Moscone et al. (1996) and Seijo et al. (2007). Briefly, the first set of antibodies consisted of anti-biotin produced in goat and monoclonal anti-digoxigenin conjugated to fluorescein isothiocyanate (FITC) produced in mouse, and the second set consisted of anti-goat conjugated to tetramethyl-rodamine isothiocyanate (TRITC) produced in rabbit and anti-mouse conjugated to FITC produced in sheep (all from Sigma-Aldrich). The hybridization mixture and the first post-hybridization wash contained 60% formamide in 2×SSC (saline sodium citrate buffer) at 37 °C, which resulted in a stringency that allowed sequences with 80-85% identity to remain hybridized. Finally, the preparations were counterstained and mounted with Vectashield medium (Vector Laboratories) containing 2 mg/ml of 4,6-diamino-2-phenyl-indole (DAPI, Sigma-Aldrich). Counterstaining with DAPI revealed a C-banding-like pattern, with major heterochromatic bands fluorescing more intensely (cf. Seijo et al. 2004).

Fluorescence microscopy and image acquisition

Chromosomes were viewed and photographed with a Leica (Heerbrugg, Switzerland) DMLB fluorescence microscope equipped with a computer-assisted Leica DC 250 digital camera system. Red, green, and blue images were captured in black and white using appropriate filters for TRITC, FITC, and DAPI excitation, respectively. Digital images were combined, and then the color balance, brightness, and contrast were processed uniformly across the image.

RESULTS

Single GISH experiments using A. glabrata gDNA as probe on the chromosomes of different diploid Arachis species

As a first approach to gain insights into the genomic relationships between the gDNA of A. glabrata and diploid Arachis species, single GISH analyses were performed. The experiments consisted in hybridizing labeled gDNA from both varieties of A. glabrata onto the chromosomes of the diploid species selected for this study. A total of 20 GISH experiments were performed (two probes × 10 species). The experiments showed various types of localized and well-defined signals (including interstitial and proximal regions and rDNA loci) and dispersed hybridization along whole chromosomes. Similar GISH patterns were obtained using the gDNA probes of both varieties of A. glabrata onto the metaphases of the diploid species. Representative somatic metaphases of the 10 diploid Arachis species probed with A. glabrata var. glabrata gDNA (red fluorescence) are shown in Figures 1 and 2. A summary of the hybridization patterns is shown in Table III.

Figure 1
Representative somatic metaphases of diploid Arachis species of the sections Heteranthae, Rhizomatosae and Arachis after single GISH experiments using gDNA probe from A. glabrata (red) and DAPI staining (gray): (a, b) A. pusilla, (c, d) A. burkartii, (e, f) A. batizocoi, (g, h) A. duranensis. The white arrows point to the satellites, which are attached with dotted lines to the proximal regions of their respective chromosomal arms. Pair A9 of A. duranensis is indicated by asterisks in Figure 1g. Scale bar = 3 µm.

Figure 2
Representative somatic metaphases of diploid Arachis species of the sections Procumbentes and Erectoides after single GISH experiments using gDNA probe from A. glabrata (red) and DAPI staining (gray): (a, b) A. lignosa, (c, d) A. rigonii, (e, f) A. appressipila, (g, h) A. hermannii, (i, j) A. major, (k, l) A. paraguariensis subsp. capibarensis. The white arrows point to the satellites, which are attached with dotted lines to the proximal regions of their respective chromosomal arms. Scale bar = 3 µm.

Table III
Summary of the semiquantitative hybridization patterns after single GISH experiments using A. glabrata gDNA as probes onto the chromosomes of different diploid Arachis species.

Chromosome preparations	Genome	A. glabrata gDNA probe			Figures
		Only 18-26S rDNA loci	Mostly proximal and interstitial regions*	Dispersed onto all chromosomes*
Sect. Heteranthae
A. pusilla	Am	6 sites	-	-	1a-b
Sect. Rhizomatosae
A. burkartii	R	2 sites	Very weak	-	1c-d
Sect. Arachis
A. batizocoi	K	-	Weak (except pK09)	-	1e-f
A. duranensis	A	-	Moderate (except A10)	-	1g-h
Sect. Procumbentes
A. lignosa	E3	-	-	Moderate	2a-b
A. rigonii	E3	-	-	Strong	2c-d
A. appressipila	E3	-	-	Strong	2e-f
Sect. Erectoides
A. hermannii	E2	-	-	Strong	2g-h
A. major	E2	-	-	Strong	2i-j
A. paraguariensis subsp. capibarensis	E2	-	-	Strong	2k-l

• *Different degrees of hybridization are indicated as weak, moderate and strong according to the brightness intensity observed. Lack of or very low hybridization signals are indicated by a dash (-). In all cases the pericentromeric DAPI + bands did not show hybridization under the experimental conditions used here. p: short arm.

The single GISH experiments on the A. pusilla chromosomes (Am genome) using A. glabrata gDNA probes revealed only six clear hybridization signals (Figures 1a and 1b) located at the 18-26S rDNA loci described for the species (Silvestri et al. 2020). Similarly, the hybridization onto the metaphases of A. burkartii (R genome) revealed two strong signals corresponding to the larger 18-26S rDNA loci of the satellite chromosomes. Additionally, very weak and dispersed hybridization was observed mostly in the proximal and interstitial regions of this rhizomatous diploid species (Figures 1c and 1d).

Within the species of the section Arachis, weak hybridization was observed onto the chromosomes of A. batizocoi Krapov. & W.C. Greg. (K genome), except for the heterochromatic pericentromeric regions, some distal regions and the short arms of the sm K9 pair (Figures 1e and 1f). Moderate and uniform signals along the proximal and interstitial regions of 18 chromosomes of A. duranensis (A genome) were detected. The A9 pair showed very weak hybridization (Figures 1g and 1h).

All the species of the sections Erectoides (E₂ subgenome) and Procumbentes (E₃ subgenome) showed a uniform hybridization pattern along all the chromosomes (Figure 2). Among them, A. lignosa (Chodat & Hassl.) Krapov. & W.C. Greg. showed hybridization with moderate intensity (Figures 2a and 2b). The most uniform and intense hybridization pattern on the entire length of the chromosomes (except on the heterochromatin of centromeric regions) was observed in A. rigonii Krapov. & W.C. Greg. and A. appressipila Krapov. & W.C. Greg. of the E₃ subgenome and in A. hermannii Krapov. & W.C. Greg., A. major Krapov. & W.C. Greg. and A. paraguariensis subsp. capibarensis Krapov. & W.C. Greg. of the E₂ subgenome (Figures 2c-l).

Identification of diploid species for double GISH experiments by nuclear and plastid DNA sequence data

The amplification of the ITS sequence data produced a fragment of 587 bp in length. Sixty-nine variable sites (11.75%) were detected after alignment of the sequences isolated from 12 taxa. The UPGMA dendrogram (Figure 3a) showed that A. lignosa (E₃ subgenome), A. rigonii (E₃ subgenome) and A. paraguariensis subsp. capibarensis (E₂ subgenome) were more closely related to the two A. glabrata varieties and that almost all the other species, which were depicted as single branches in the tree, were more distantly related. Both chloroplast regions, trnT–S (1023 bp) and trnT–Y (948 bp), were concatenated into a single alignment for the 12 taxa studied. The aligned sequences contained 1971 characters, with 47 variable sites (2.38%). The varieties of A. glabrata differed in one single nucleotide substitution. The UPGMA dendrogram (Figure 3b) showed A. pusilla in a distant individual branch. The other species grouped into two major clusters. The first one included the two varieties of A. glabrata closely associated with A. duranensis (A genome), and A. batizocoi (K genome), and with A. burkartii (R genome), A. major (E₂ subgenome), and A. hermannii (E₂ subgenome) associated more distantly. The second cluster included A. paraguariensis subsp. capibarensis (E₂ subgenome) and the three remaining species of the section Procumbentes (E₃ subgenome).

Figure 3
UPGMA dendrograms of Arachis species based on the sequences of ITS (a) and two non-coding regions (trnT–S, trnT–Y) of the cpDNA (b) datasets. The genomic constitution of each taxa is indicated in parentheses.

Double GISH experiments using gDNA from diploid species as probes on A. glabrata chromosomes

The results of the single GISH experiments suggested that three species of the section Erectoides (A. hermannii, A. major and A. paraguariensis subsp. capibarensis, all with E₂ subgenome), two species of the section Procumbentes (A. rigonii and A. appressipila, with E₃ subgenome), and the more distantly A. duranensis (section Arachis, with A genome) were the diploid species with the highest degree of genomic affinity with A. glabrata. These diploids constituted the initial set of candidate species for further double GISH experiments to investigate the genomic constitution of the two taxonomic varieties of A. glabrata.

The selection of diploid species for double GISH was refined considering the species having the most intense and uniform hybridization patterns in the single GISH experiments (Table III) and the highest genetic similarity with A. glabrata in the cluster analyses of the plastid (A. duranensis) and nuclear (A. paraguariensis, A. rigonii) DNA sequences (Figure 3). Additionally, the diploid A. paraguariensis subsp. capibarensis and A. rigonii were selected because they share a larger number of chromosomal markers with A. glabrata than the other species of the sections Erectoides and Procumbentes (Ortiz et al. 2017, Table I and Figure 4).

Figure 4
Scheme showing the idiograms and the main chromosomal similarities and differences between A. glabrata and the three diploid species tested in the double GISH experiments.

Differently labeled probes of gDNA were used in three combinations - A. duranensis with A. rigonii, A. duranensis with A. paraguariensis subsp. capibarensis, and A. paraguariensis subsp. capibarensis with A. rigonii - for double GISH experiments. Hybridizations of all the probes assayed were similarly dispersed in all the 40 chromosomes, and no difference of intensity was observed among the four chromosome sets (Figure 5 and Supplementary Material – Figure S1) of any of the two varieties of A. glabrata. Representative somatic metaphases of A. glabrata var. glabrata probed with gDNA of the three combinations of diploid species are shown in Figure 5.

Figure 5
Representative somatic metaphases of tetraploid A. glabrata after double GISH. DAPI staining (gray) was used to highlight the heterochromatic bands and to stain euchromatin in Figs. a, b, and c after double GISH using gDNA probes of d: A. duranensis (green) and A. rigonii (red), e: A. duranensis (green) and A. paraguariensis subsp. capibarensis (red), f: A. paraguariensis subsp. capibarensis (green) and A. rigonii (red). The white arrows point to the satellites, which are attached with dotted lines to the proximal regions of their respective chromosomal arms. Scale bar = 3 µm.

Although the probes of the different species assayed showed similar distribution of the hybridization dots along the chromosomes (except for their centromeric DAPI heterochromatic bands), differences in the intensity of brightness were observed among the probes. In the two cases, when gDNA of A. duranensis (A genome) was simultaneously hybridized with gDNA of A. rigonii (E₃ subgenome) and A. paraguariensis subsp. capibarensis (E₂ subgenome), the gDNA of the former (in green, Supplementary Material – Figures S1d and S1e) hybridized less intensely and more sparsely than that of the E genome species (in red, Supplementary Material – Figures S1g and S1h). As a result, in the merged picture, the chromosomes of A. glabrata were observed as intense orange (Figures 5d and 5e). The only exceptions to this pattern were the interstitial regions, where all the probes showed intense hybridization. These regions appeared as more yellowish regions in the merged metaphases of A. glabrata (Figures 5d and 5e).

The hybridizations performed with probes of A. paraguariensis subsp. capibarensis (E₂ subgenome) and A. rigonii (E₃ subgenome) resulted in intense labeling of both probes onto the 40 chromosomes, except for their centromeric DAPI heterochromatic bands (Supplementary Material – Figure S1). However, the former probe (green fluorescence) hybridized more uniformly and with more intensity than the latter (in red, Supplementary Material – Figure S1), which was concentrated mainly in the interstitial regions (Supplementary Material – Figure S1). As a result of the merging of the hybridization with both probes, the metaphase chromosomes of A. glabrata were seen as yellow-green chromosomes (Figure 5f).

DISCUSSION

Morphological and taxonomic studies have placed all the rhizomatous Arachis species (three tetraploids and one diploid) within the taxonomic section Rhizomatosae (Krapovickas & Gregory 1994). However, the relationships between the diploid and tetraploid species have been called into question (Angelici et al. 2008, Bechara et al. 2010, Ortiz et al. 2017). Here, we present evidence that the diploid A. burkartii is not a parental of the tetraploid A. glabrata and that the most probable ancestors of this polyploid legume forage are species with the E₂ subgenome.

Arachis burkartii is not a genome donor of A. glabrata

The single GISH experiments using A. glabrata gDNA (without specific blocking DNA of any Arachis species) onto the chromosomes of A. burkartii clearly evidenced that the genomic sequences of the complements of these two species are largely different. The patterns of hybridization observed between these species of the section Rhizomatosae showed lower similarities than those detected among different genomes of the section Arachis (Seijo et al. 2007), suggesting that the genome of A. burkartii (R genome, Ortiz et al. 2017) is different from that of A. glabrata. Thus, the results also suggest that the taxonomic section as defined by Krapovickas & Gregory (1994) is not a natural group.

The fact that A. burkartii was distantly positioned from A. glabrata in the cpDNA and ITS rDNA dendrograms constructed here, as also observed in previous molecular analyses (Gimenes et al. 2002, Nobile et al. 2004, Angelici et al. 2008, Bechara et al. 2010, Friend et al. 2010), show that A. burkartii is very distant from both A. glabrata varieties. The single GISH experiments clearly demonstrated a very low global sequence similarity between A. burkartii and A. glabrata. The karyotypes of these two species also differ, mainly in the number and position of the rDNA and in the pattern of heterochromatic bands (Ortiz et al. 2017). All these results clearly demonstrate that A. burkartii is not a genome donor of A. glabrata.

Differences similar to those found between A. burkartii and A. glabrata were considered for the arrangement of species of the section Arachis in different genomes (Robledo & Seijo 2010). The fact that the hybridization pattern of A. glabrata gDNA onto the metaphase of A. burkartii was similar to that observed onto the chromosomes of the distant A. pusilla (Am genome) supports the existence of a large genomic differentiation between A. glabrata and A. burkartii. This genome and karyotype differentiation may explain the genetic isolation between these two species, as noted by the lack of success of numerous crossing attempts under experimental (Gregory & Gregory 1979, Krapovickas & Gregory 1994) conditions. Therefore, our results support the assignment of the R genome (Ortiz et al. 2017) only for A. burkartii, and not to the tetraploid A. glabrata.

Identification of alternative candidates as diploid genome donors of A. glabrata

After discarding A. burkartii as a genome donor of A. glabrata, the second aim of this study was to identify diploid species with sequence affinity to the chromosomes of this tetraploid species. Among them, A. batizocoi (K genome) was evaluated because artificial hybrids have been obtained between this species and A. glabrata (Krapovickas & Gregory 1994). However, single GISH assays revealed that A. glabrata gDNA only produced dispersed and very tiny signals along the metaphase chromosomes of A. batizocoi, evidencing a low genomic affinity between these species. This low hybridization was somewhat expected because this species presents large karyotypic differences (Robledo & Seijo 2010, Ortiz et al. 2017) with A. glabrata, and the hybrids obtained have less than 1% of stained pollen (Gregory & Gregory 1979). The cytogenetic results are also in complete agreement with the distance dendrograms based on cpDNA and ITS rDNA here presented and with previous phylogenies based on DNA sequences (Bechara et al. 2010, Friend et al. 2010). Thus, although A. batizocoi presents certain degree of cross-compatibility with A. glabrata, our results do not support this diploid species as a genome donor of A. glabrata.

All the other diploid species here evaluated as potential genome donors having the A, E₂ and E₃ genomes/subgenomes were better candidates as progenitors of A. glabrata than the two species formerly analyzed. In all these diploids, the gDNA probe of A. glabrata hybridized along the euchromatic portion of all (or most) of their chromosomes. The absence of hybridization in the heterochromatic DAPI⁺ regions is an expected result in GISH experiments of Arachis species. This phenomenon could be attributed to the high condensation of heterochromatin that inhibits the accessibility of the probe to the target sequences under the hybridization conditions usually used for GISH (Seijo et al. 2007) and/or to the lack of homology of the satellite elements that compose the heterochromatic bands in different species (Samoluk et al. 2019).

Among these potential genome donors, the single GISH experiments using gDNA of A. glabrata as probe showed that A. duranensis (A genome) was the one that presented the lowest intensity of the hybridization signals. This showed that the genomes differ largely in the nuclear sequences, mainly in the repetitive ones. In addition, although A. duranensis was the most genetically similar species at the level of cpDNA sequences analyzed here, the ITS rDNA dendrogram showed a great genetic distance between them. These results eliminate A. duranensis as a potential genome donor of A. glabrata.

The species of the sections Procumbentes and Erectoides, despite being distantly related in the cpDNA cluster analysis, showed the highest genome affinities with A. glabrata in the ITS rDNA dendrogram constructed. This is in agreement with previous studies in which they also appeared very closely related in analyses based on RAPD markers (Dos Santos et. al. 2003, Nóbile et al. 2004). Consistently with the ITS rDNA dendrogram, the Procumbentes and Erectoides species showed the highest intensity of hybridization in GISH experiments with A. glabrata, although with different degrees of sequence homology. Among them, A. lignosa (E₃ subgenome) showed the weakest hybridization, which evidenced a large genomic differentiation with A. glabrata. The most uniform and intense hybridization observed in all the other diploid species tested in single GISH experiments showed a higher degree of homology between the genome of any of these diploids and that of A. glabrata.

The analysis of mitotic metaphases showed that the chromosomes of the species belonging to the section Procumbentes have SAT chromosomes type 9 (pair #10) and a chromosome pair with subtelomeric DAPI⁺ bands (A. rigonii and A. appressipila), which were not found in A. glabrata (Ortiz et al. 2017). By contrast, the species of the section Erectoides have the most similar pattern of chromosome markers expected for the genome donor of A. glabrata (Ortiz et al. 2017, Table I). Among them, A. paraguariensis subsp. capibarensis is the only taxa that has SAT chromosomes type 3 and one pair of 18-26S rDNA sites like those observed in A. glabrata. The other subspecies, A. paraguariensis subsp. paraguariensis was previously discarded as a genome donor of A. glabrata mainly because of having five pairs of 18-26S rDNA sites and SAT chromosomes type 4 (Ortiz et al. 2017). Thus, the results of the single and double GISH analyses, together with the chromosome and ITS rDNA sequence data, support the Erectoides species and, particularly A. paraguariensis subsp. capibarensis, as the best candidate as genome donor of A. glabrata.

Genomic constitution of A. glabrata evaluated by double GISH

To gain further insights into the genome constitution of A. glabrata and its genome donor/s, double GISH experiments were performed hybridizing gDNA of the most probable candidate diploid species onto the chromosomes of A. glabrata. This technique has been formerly very useful for genome discrimination of the AABB allopolyploids A. hypogaea and A. monticola (Seijo et al. 2007, 2018), as well as in polyploids of other plant genera (Yang et al. 2017, Marques et al. 2018, Wang et al. 2019). Here, to perform the double GISH experiments, we selected two of the diploid species (A. rigonii and A. paraguariensis) that had shown the most brightful and uniform hybridization signals with A. glabrata gDNA in single GISH experiments and the lowest genetic distance in ITS rDNA and cpDNA analyses. Arachis duranensis was used as a negative control of low but uniform hybridization onto the chromosomes.

The double GISH experiments revealed a similar pattern of hybridization in all the chromosomes of both A. glabrata varieties despite the gDNA of diploid species used as probes. The probe derived from A. duranensis showed a similar low affinity in the four complements of the tetraploid regardless of whether it was co-hybridized with gDNA of species with the E₂ or E₃ subgenomes. Similarly, the gDNA of the E₂ and E₃ subgenomes species hybridized homogeneously and with high intensity in the four complements of A. glabrata despite the gDNA used for the co-hybridizations. These results are compatible with the patterns expected for autopolyploids like Avena (Leggett & Markhand 1995) or allopolyploids derived from species with very similar genomes like Miscanthus (Hodkinson et al. 2002).

Different reports have proposed A. glabrata as an autopolyploid species (Singh 1985, Singh & Simpson 1994). Meiotic analysis in different accessions of A. glabrata has shown 0-8 quadrivalents and, on this base, we have previously postulated that different populations may have varied degrees of diploidization (Ortiz et al. 2011). Other authors, however, have postulated this species as an EERR allopolyploid (Bechara et al. 2010) originated by crossing between one species from Erectoides group (including the species of the sections Trierectoides, Erectoides and Procumbentes) and one species of the section Rhizomatosae with a genome constitution different from that of A. burkartii (Gregory & Gregory 1979, Bechara et al. 2010). However, our GISH experiments revealed a high degree of similarity in the sequence composition of the four chromosome sets of A. glabrata, despite the probe used in the experiments. These results support the autopolyploid origin of A. glabrata. Alternatively, if different diploid species had been involved in its origin, they must have had a very similar genome sequence, especially at the repetitive level and also a similar karyotype structure as that observed among the Erectoides species studied here (Ortiz et al. 2017). Accordingly, we suggest an E₂E₂E₂E₂ genome constitution for A. glabrata.

CONCLUSIONS

The results obtained from the GISH experiments evidence that the tetraploid A. glabrata is constituted by four identical or very similar chromosome complements. The similar pattern of genomic hybridization observed in both varieties of this species suggests that the same diploid species participated in their origin. These results also confirm that 1) the R genome of the diploid A. burkartii is not a genome donor of A. glabrata, 2) the species with E₂ subgenome have the highest degree of genomic homology with A. glabrata and the most similar karyotypes, and 3) among the species tested, A. paraguariensis subsp. capibarensis showed the highest brightness in all the double GISH experiments using DNA of diploid species as probes onto A. glabrata chromosomes and also in single GISH experiments using A. glabrata as probe onto the chromosomes of diploid species.

Thus, our results increase the knowledge about the genomic relationships of A. glabrata with diploid species that showed different degrees of crossability and other species selected for this study. We envision that the data here provided enlarge the germplasm sources useful for breeders to increase the genetic variability of A. glabrata and for the selection of diploid parents for the genetic improvement of the existing A. glabrata commercial cultivars.

ACKNOWLEDGMENTS

This work was supported by grants the Secretaría General de Ciencia y Técnica de la Universidad Nacional del Nordeste (PI No. 18P005 and PI No.16P003) and the Agencia Nacional de Promoción Científica y Tecnológica (PICT No. 2015-2802).

SUPPLEMENTARY MATERIAL

Figure S1.

Table SI.

REFERENCES

• Angelici CMLCD, Hoshino AA, Nóbile PM, Palmieri DA, Valls JFM, Gimenes MA & Lopes CR. 2008. Genetic diversity in section Rhizomatosae of the genus Arachis (Fabaceae) based on microsatellite markers. Genet Mol Biol 31: 79-88.
• Bechara MD, Moretzsohn, MC, Palmieri DA, Monteiro JP, Bacci M, Martins J & Gimenes MA. 2010. Phylogenetic relationships in genus Arachis based on ITS and 5.8S rDNA sequences. BMC Plant Biol 10: 255.
• Bertioli DJ ET AL. 2019. The genome sequence of segmental allotetraploid peanut Arachis hypogaea. Nat Genet 51: 877-884.
• Bertioli DJ, Abernathy B, Seijo G, Clevenger J & Cannon SB. 2020. Evaluating two different models of peanut’s origin. Nat Genet 52: 557-559.
• Chester M, Leitch AR, Soltis PS & Soltis DE. 2010. Review of the application of modern cytogenetic methods (FISH/GISH) to the study of reticulation (Polyploidy/Hybridisation). Genes 1: 166-192.
• Dos Santos VSE, Gimenes MA, Valls JFM & Lopes CR. 2003. Genetic variation within and among species of five sections of the genus Arachis L. (Leguminosae) using RAPDs. Genet Resour Crop Evol 50: 841-848.
• Doyle JJ & Doyle JL. 1987. Isolation of DNA from fresh plant tissue. Focus 12: 13-15.
• Fernández A & Krapovickas A. 1994. Cromosomas y evolución en Arachis (Leguminosae). Bonplandia 8: 187-220.
• French EC, Prine GM & Blount AR. 2006. Perennial peanut: An alternative forage of growing importance. Circ. SS-AGR-39. Florida Agric. Exp. Stn., Gainesville.
• French EC, Prine GM, Ocumpaugh WR & Rice RW. 1994. Regional experience with forage Arachis in the United States. In: Kerridge PC & Hardy B (Eds), Biology and agronomy of forage Arachis, CIAT, Cali, p. 169-186.
• Friend SA, Quandt D, Tallury SP, Stalker HT & Hilu KW. 2010. Species, genomes, and section relationships in the genus Arachis (Fabaceae): A molecular phylogeny. Plant Syst Evol 290: 185-199.
• Gimenes MA, Lopes CR & Valls JFM. 2002. Genetic relationships among Arachis species based on AFLP. Genet Mol Biol 25: 349-353.
• Grabiele M, Chalup L, Robledo G & Seijo G. 2012. Genetic and geographic origin of domesticated peanut as evidenced by 5S rDNA and chloroplast DNA sequences. Plant Syst Evol 298: 1151-1165.
• Gregory WC & Gregory MP. 1979. Exotic germplasm of Arachis L. interspecific hybrids. J Heredity 70: 185-193.
• Gregory WC, Gregory MP, Krapovickas A, Smith BW & Yarbrough JA. 1973. Structures and genetic resources of peanuts. In: Wilson CT (Ed), Peanuts Culture and Uses, Amer Peanut Res. and Educ. Assoc., Stillwater, Oklahoma, p. 47-133.
• Hodkinson TR, Chase MW, Takahashi C, Leitch IJ, Bennett MD & Renvoize SA. 2002. The use of dna sequencing (ITS and trnL-F), AFLP, and fluorescent in situ hybridization to study allopolyploid Miscanthus (Poaceae). Am J Bot 89: 279-286.
• Jahnavi MR & Murty UR. 1985. A preliminary pachytene analysis of two species of Arachis L. Theor Appl Genet 70: 157-165.
• Krapovickas A & Gregory WC. 1994. Taxonomía del género Arachis (Leguminosae). Bonplandia 8: 1-186.
• Kumar S, Stecher G & Tamura K. 2016. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol Evol 33: 1870-1874.
• Lavia GI, Fernández A & Seijo JG. 2008. Cytogenetic and molecular evidences on the evolutionary relationships among Arachis species. In: Sharma AK & Sharma A (Eds), Plant genome: biodiversity and evolution, vol 1E, Science Publishers, Calcutta, p. 101-134.
• Lavia GI, Ortiz AM, Robledo G, Fernández A & Seijo JG. 2011. Origin of triploid Arachis pintoi Krapov. and W.C. Gregory (Leguminosae) by autopolyploidy evidenced by FISH and meiotic behavior. Ann Bot 108:103-111.
• Leggett JM & Markhand GS. 1995. The genomic structure of Avena revealed by GISH. In: Brandham PE & Bennett MD (Eds), Kew Chromosome Conference IV, Royal Botanic Gardens, Kew, p. 133-139.
• Liu QL, Ge S, Tang HB, Zhang XL, Zhu GF & Lu BR. 2006. Phylogenetic relationships in Elymus (Poaceae: Triticeae) based on the nuclear ribosomal internal transcribed spacer and chloroplast trnL-F sequences. New Phytol 170: 411-420.
• Marques A ET AL. 2018. Origin and parental genome characterization of the allotetraploid Stylosanthes scabra Vogel (Papilionoideae, Leguminosae), an important legume pasture crop. Ann Bot 122: 1143-1159.
• Mavrodiev EV, Chester M, Santiago VNS, Visger CJ, Rodriguez R, Alfonso S, Baldini RM, Soltis PS & Soltis DE. 2015. Multiple origins and chromosomal novelty in the allotetraploid Tragopogon castellanus (Asteraceae). New Phytol 206: 1172-1183
• Moscone EA, Matzke MA & Matzke AJM. 1996. The use of combined FISH/GISH in conjunction with DAPI counterstaining to identify chromosomes containing transgene inserts in amphidiploid tobacco. Chromosoma 105: 231-236.
• Muir JP, Butler TJ, Ocumpaugh WR & Simpson CE. 2010. ‘Latitude 34’, a perennial peanut for cool, dry climates. J Plant Reg 4: 106-108.
• Mullenix MK, Sollenberger LE, Wallau MO, Blount AR, Vendramini JMB & Silveira ML. 2016. Herbage Accumulation, Nutritive Value, and Persistence Responses of Rhizoma Peanut Cultivars and Germplasm to Grazing Management. Crop Science 56: 907-915.
• Nóbile PM, Gimenes MA, Valls JFM & Lopes CR. 2004. Genetic variation within and among species of genus Arachis, section Rhizomatosae. Genet Resour Crop Ev 51: 299-307.
• Ortiz AM, Robledo G, Seijo G, Valls JFM & Lavia GI. 2017. Cytogenetic evidences on the evolutionary relationships between the tetraploids of section Rhizomatosae and related diploid species (Arachis, Leguminosae). J Plant Res 130: 791-807.
• Ortiz AM, Seijo JG, Fernández A & Lavia GI. 2011. Meiotic behavior and pollen viability of tetraploid Arachis glabrata and A. nitida species (Section Rhizomatosae, Leguminosae): implications concerning their polyploid nature and seed set production. Plant Syst Evol 292: 73-83.
• Peñaloza A & Valls JFM. 2005. Chromosome number and satellite chromosome morphology of eleven species of Arachis (Leguminosae). Bonplandia 14: 65-72.
• Prine GM, Dunavin LS, Glennon RJ & Roush RD. 1986. Arbrook rhizoma peanut: A perennial forage legume. Circ. S-332. Florida Agric Exp Stn, Gainesville.
• Prine GM, Dunavin LS, Glennon RJ & Roush RD. 1990. Registration of ‘Arbrook’ rhizoma peanut. Crop Science 30:7 43-744.
• Prine GM, Dunavin LS, Moore JE & Roush RD. 1981. Florigraze rhizoma peanut- a perennial forage legume. Circ S-275. Florida Agric Exp Stn, Gainesville.
• Prine GM, French EC, Blount AR, Williams MJ & Quesenberry KH. 2010. Registration of Arblick and Ecoturf rhizoma peanut germplasms for ornamental or forage use. J Plant Regist 4: 145-148.
• Pucciariello O, Ortiz AM, Fernández A & Lavia GI. 2013. Análisis cromosómico del híbrido Arachis pintoi x A. repens (Leguminosae) mediante citogenética clásica y molecular. Bonplandia 48: 111-119.
• Quesenberry KH, Blount AR, Mislevy P, French EC, Williams MJ & Prine GM. 2010. Registration of ‘UF Tito’ and ‘UF Peace’ Rhizoma Peanut Cultivars with High Dry Matter Yields, Persistence, and Disease Tolerance. J Plant Regist 4: 17-21.
• Raman VS. 1981. Nature of chromosome pairing in allopolyploids of Arachis and their stability. Cytologia 46: 307-321.
• Robledo G & Seijo G. 2010. Species relationships among the wild B genome of Arachis species (section Arachis) based on FISH mapping of rDNA loci and heterochromatin detection: a new proposal for genome arrangement. Theor Appl Genet 121: 1033-1046.
• Robledo G, Lavia GI & Seijo G. 2009. Species relations among wild Arachis species with the A genome as revealed by FISH mapping of rDNA loci and heterochromatin detection. Theor Appl Genet 118: 1295-1307.
• Samoluk SS, Chalup LMI, Chavarro C, Robledo G, Bertioli DJ, Jackson SA & Seijo G. 2019. Heterochromatin evolution in Arachis investigated through genomewide analysis of repetitive DNA. Planta 249: 1405-1415.
• Santana SH & Valls JFM. 2015. Arachis veigae (Fabaceae), the most dispersed wild species of the genus, and yet taxonomically overlooked. Bonplandia 24: 139-150.
• Seijo GJ, Atahuachi M, Simpson CE & Krapovickas A. 2021. Arachis inflata: A New B Genome species of Arachis (Fabaceae). Bonplandia 30: 169-174.
• Seijo JG, Kovalsky EI, Chalup LMI, Samoluk SS, Fávero A & Robledo GA. 2018. Karyotype stability and genome-specific nucleolar dominance in peanut, its wild 4× ancestor, and a synthetic AABB polyploid. Crop Science 58: 1671-1683.
• Seijo JG, Lavia GI, Fernández A, Krapovickas A, Ducasse D & Moscone EA. 2004. Physical mapping of 5S and 18-25S rRNA genes evidences that Arachis duranensis and A. ipaënsis are the wild diploid species involved in the origin of A. hypogaea (Leguminosae). Am J Bot 91: 1294-1303.
• Seijo JG, Lavia GI, Fernández A, Krapovickas A, Ducasse D, Bertioli DJ & Moscone EA. 2007. Genomic relationships between the cultivated peanut (Arachis hypogaea, Leguminosae) and its close relatives revealed by double GISH. Amer J Bot 94: 1963-1971.
• Shaw J, Lickey EB, Beck JT, Farmer SB, Liu W, Miller J, Siripun KC, Winder CT, Schilling EE & Small RL. 2005. The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. Am J Bot 92: 142-166.
• Silvestri MC, Ortiz AM & Lavia GI. 2015. rDNA loci and heterochromatin positions support a distinct genome type for ‘x = 9 species’ of section Arachis (Arachis, Leguminosae). Plant Syst Evol 301: 555-562.
• Silvestri MC, Ortiz AM, Robledo Dobladez GA & Lavia GI. 2020. Chromosome diversity in species of the genus Arachis, revealed by FISH and CMA/DAPI banding, and inferences about their karyotype differentiation. An Acad Bras Cienc 92: e20191364. https://doi.org/10.1590/0001-3765202020191364.
  » https://doi.org/10.1590/0001-3765202020191364
• SINGH AK. 1985. Cytogenetic analysis of wild species of Arachis. Proyect report (1978-1982). ICRISAT, Patancheru, India.
• Singh AK & Simpson CE. 1994. Biosystematics and genetic resources. In: Smartt J (Ed). The Groundnut Crop: A scientific basis for improvement. Chapman & Hall, London, p. 96-137.
• Smartt J & Stalker HT. 1982. Speciation and cytogenetics in Arachis. In: Pattee HE & Young CT (Eds), Peanut science and technology, Am Peanut Res and Educ Assoc, Yoakum, p. 21-49.
• Smartt J, Gregory WC & Gregory MP. 1978. The genomes of Arachis hypogaea. 1. Cytogenetic studies of putative genome donors. Euphytica 27: 665-675.
• SNEATH PHA & Sokal RR. 1973. Numerical Taxonomy. Freeman, San Francisco.
• Sokal RR & Michener CD. 1958. A statistical method for evaluating systematic relationships. Univ Kans Sci Bull 38: 409-1438.
• Stalker HT. 1991. A new species section Arachis of peanuts with d genome. Am J Bot 78:630-637.
• TAMURA K, NEI M & KUMAR S. 2004. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc Natl Acad Sci USA 101: 11030-11035.
• VALLS JFM. 1996. Variability in genus Arachis and potential forage uses. In: Springer TL & Pittman RN (Eds), Identifying Germplasm for Successful Forage Legume-Grass Interactions. Proceedings of the Symposium of the Crop Science Society of America. American Society Agronomy, Seattle, p. 15-27.
• Valls JFM, Costa LC & Custodio A. 2013. A novel trifoliolate species of Arachis (Fabaceae) and further comments on the taxonomic section Trierectoides. Bonpalndia 22: 91-97.
• Valls JFM & Simpson CE. 2005. New species of Arachis (Leguminosae) from Brazil, Paraguay and Bolivia. Bonplandia 14: 35-64.
• Valls JFM & Simpson CE. 2017. A new species of Arachis (Fabaceae) from Mato Grosso, Brazil, related to Arachis matiensis. Bonplandia. 26: 143-149.
• Wang L ET AL. 2019. Genome constitution and evolution of Elytrigia lolioides inferred from Acc1, EF-G, ITS, TrnL-F sequences and GISH. BMC Plant Biol 19: 158.
• White TJ, Bruns TD, Lee SB & Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M et al. (Eds), PCR Protocols: A Guide to Methods and Applications, San Diego: Academic Press, p. 315-322.
• Yang C, Zhang H, Chen W, Kang H, Wang Y, Sha L, Fan X, Zeng J & Zhou Y. 2017. Genomic constitution and intergenomic translocations in the Elymus dahuricus complex revealed by multicolor GISH. Genome 60: 510-517.
• Zhang L, Yang X, Tian L, Chen L & Yu W. 2016. Identification of peanut (Arachis hypogaea) chromosomes using a fluorescence in situ hybridization system reveals multiple hybridization events during tetraploid peanut formation. New Phytol 211: 1424-1439.

Publication Dates

• Publication in this collection
  17 Apr 2023
• Date of issue
  2023

History

• Received
  02 Feb 2021
• Accepted
  11 May 2021