O Polimorfismo no códon 98 do gene de galectina-3 não está associado a tumores benignos e malignos de tiróide

Polymorphism on codon 98 of the galectin-3 gene are not associated to benign and nalignant thyroid tumors

Resumos

Galectina-3 é uma proteína multifuncional altamente expressa em câncer de tiróide. O gene de galectina-3 (LGALS3) apresenta vários candidatos a SNPs anotados, no entanto a relação entre estes SNPs e variações fenotípicas específicas relevantes à saúde não foi avaliada. Neste estudo, investigamos SNPs do LGALS3 e uma possível associação destes com a tumorigênese tiroidiana. A presença de SNPs do LGALS3 em linhagens de carcinoma de tiróide (WRO, NPA, TPC-1, ARO), tecidos tiroidianos de 55 pacientes com diagnóstico de bócio multinodular ou carcinoma papilífero e linfócitos do sangue periférico de 45 indivíduos saudáveis foi avaliada por seqüenciamento e SSCP. A análise da seqüência codificadora do LGALS3 mostrou que o sítio T98P apresenta uma grande variação genotípica, visto que observamos os padrões homozigoto (AA ou CC) e heterozigoto (AC). Em linhagens de carcinoma de tiróide, o genótipo da NPA no sítio T98P do LGALS3 é CC, enquanto TPC-1, WRO e ARO são AC. As freqüências genotípicas do T98P do LGALS3 observadas em bócio multinodular (AC= 67%, AA= 23%, CC= 10%) e carcinoma papilífero (AC= 68%, AA= 20%, CC= 12%) foram semelhante à freqüência observada na população controle (AC= 60%, AA= 24%, CC= 16%). Em conclusão, não observamos associação entre o genótipo T98P do LGALS3 e o fenótipo de tumor benigno ou maligno de tiróide.

Câncer de tiróide; Galectina-3; LGALS3; Polimorfismo de um único nucleotídeo; Seqüenciamento; Polimorfismo conformacional de simples fita


Galectin-3 is a multifunctional protein highly expressed in thyroid cancer. The galectin-3 gene (LGALS3) has several annotated candidates SNPs, however the relationship between galectin-3 SNPs and specific phenotypic variations relevant to health has not been evaluated. In this study, we investigated SNPs in the galectin-3 gene and a putative association with thyroid tumorigenesis. The presence of LGALS3 SNPs in thyroid carcinoma cell lines (NPA, TPC-1, WRO, ARO), thyroid tissues of 55 patients with multinodular goiter or papillary carcinoma diagnosis and lymphocytes of peripherical blood of 45 healthy individuals was evaluated by sequencing and SSCP. The analysis of LGALS3 coding sequence showed that the T98P site presents a great genotypic variation, since we observed both homozygous (AA or CC) and heterozygous (AC) patterns. In thyroid carcinoma cell lines, the genotype of NPA in the LGALS3 T98P site is CC, while TPC-1, WRO and ARO are AC. The genotypic frequency of T98P SNP observed in multinodular goiter (AC= 67%; AA= 23%; CC= 10%) and papillary carcinoma (AC= 68%; AA= 20%; CC= 12%) were similar to the frequency observed in the control population (AC= 60%, AA= 24%, CC= 16%). In conclusion, no association between LGALS3 T98P genotype and the phenotype of the benign or malignant thyroid tumor was observed.

Thyroid cancer; Galectin-3; LGALS3; Single nucleotide polymorphism (SNP); Sequencing; Single-strand conformation polymorphism (SSCP)


ARTIGO ORIGINAL

O Polimorfismo no códon 98 do gene de galectina-3 não está associado a tumores benignos e malignos de tiróide

Polymorphism on codon 98 of the galectin-3 gene are not associated to benign and nalignant thyroid tumors

Luciane MartinsI; Suzana Garcia LeoniI; Celso U.M. FrigugliettiII; Laura Sterian WardIII; Marco Aurélio V. KulcsarII; Edna Teruko KimuraI

IDepartamento de Biologia Celular e do Desenvolvimento, Instituto de Ciências Biomédicas, Universidade de São Paulo

IIDepartamento de Cirurgia de Cabeça e Pescoço, Faculdade de Medicina da Universidade de Santo Amaro (UNISA)

IIILaboratório de Genética Molecular do Câncer, Departamento de Medicina, Universidade Estadual de Campinas, Campinas, SP

Endereço para correspondência

RESUMO

Galectina-3 é uma proteína multifuncional altamente expressa em câncer de tiróide. O gene de galectina-3 (LGALS3) apresenta vários candidatos a SNPs anotados, no entanto a relação entre estes SNPs e variações fenotípicas específicas relevantes à saúde não foi avaliada. Neste estudo, investigamos SNPs do LGALS3 e uma possível associação destes com a tumorigênese tiroidiana. A presença de SNPs do LGALS3 em linhagens de carcinoma de tiróide (WRO, NPA, TPC-1, ARO), tecidos tiroidianos de 55 pacientes com diagnóstico de bócio multinodular ou carcinoma papilífero e linfócitos do sangue periférico de 45 indivíduos saudáveis foi avaliada por seqüenciamento e SSCP. A análise da seqüência codificadora do LGALS3 mostrou que o sítio T98P apresenta uma grande variação genotípica, visto que observamos os padrões homozigoto (AA ou CC) e heterozigoto (AC). Em linhagens de carcinoma de tiróide, o genótipo da NPA no sítio T98P do LGALS3 é CC, enquanto TPC-1, WRO e ARO são AC. As freqüências genotípicas do T98P do LGALS3 observadas em bócio multinodular (AC= 67%, AA= 23%, CC= 10%) e carcinoma papilífero (AC= 68%, AA= 20%, CC= 12%) foram semelhante à freqüência observada na população controle (AC= 60%, AA= 24%, CC= 16%). Em conclusão, não observamos associação entre o genótipo T98P do LGALS3 e o fenótipo de tumor benigno ou maligno de tiróide.

Descritores: Câncer de tiróide; Galectina-3; LGALS3; Polimorfismo de um único nucleotídeo; Seqüenciamento; Polimorfismo conformacional de simples fita

ABSTRACT

Galectin-3 is a multifunctional protein highly expressed in thyroid cancer. The galectin-3 gene (LGALS3) has several annotated candidates SNPs, however the relationship between galectin-3 SNPs and specific phenotypic variations relevant to health has not been evaluated. In this study, we investigated SNPs in the galectin-3 gene and a putative association with thyroid tumorigenesis. The presence of LGALS3 SNPs in thyroid carcinoma cell lines (NPA, TPC-1, WRO, ARO), thyroid tissues of 55 patients with multinodular goiter or papillary carcinoma diagnosis and lymphocytes of peripherical blood of 45 healthy individuals was evaluated by sequencing and SSCP. The analysis of LGALS3 coding sequence showed that the T98P site presents a great genotypic variation, since we observed both homozygous (AA or CC) and heterozygous (AC) patterns. In thyroid carcinoma cell lines, the genotype of NPA in the LGALS3 T98P site is CC, while TPC-1, WRO and ARO are AC. The genotypic frequency of T98P SNP observed in multinodular goiter (AC= 67%; AA= 23%; CC= 10%) and papillary carcinoma (AC= 68%; AA= 20%; CC= 12%) were similar to the frequency observed in the control population (AC= 60%, AA= 24%, CC= 16%). In conclusion, no association between LGALS3 T98P genotype and the phenotype of the benign or malignant thyroid tumor was observed.

Keywords: Thyroid cancer; Galectin-3; LGALS3; Single nucleotide polymorphism (SNP); Sequencing; Single-strand conformation polymorphism (SSCP)

GALECTINA-3 É UMA PROTEÍNA monomérica de 30 kDa que pertence à crescente família de lectinas animais, as galectinas. Galectina-3 tem sido associada à transformação maligna e metástase em vários tecidos (1). Na tiróide, estudos mostram que o bloqueio anti-sense de galectina-3 é capaz de reverter o fenótipo maligno em linhagem celular de carcinoma papilífero (NPA), sugerindo um importante papel desta proteína na tumorigênese tiroidiana (2). Além disso, vários autores mostraram uma correlação entre a expressão da proteína galectina-3 e o câncer de tiróide, sugerindo sua utilização como um marcador molecular no diagnóstico de câncer (3-7). Por outro lado, o potencial de galectina-3 como um marcador capaz de distinguir lesões benignas de câncer de tiróide ainda é controverso, uma vez que mostramos que galectina-3 também pode estar expressa em tumores benignos (8). Desta forma, embora a expressão de galectina-3 tenha sido amplamente estudada na tiróide para fins diagnósticos, até o momento muito pouco é conhecido sobre o seu papel funcional e seu envolvimento na gênese do câncer de tiróide.

O estudo de variações genéticas como o SNP (do inglês Single Nucleotide Polimorphism) tem auxiliado na compreensão de fatores que influenciam na suscetibilidade a doenças genéticas complexas como o câncer (9). Existem evidências de que o SNP do TGFBR1, denominado TGFBR1*6A, pode aumentar o risco de câncer de ovário, mama e cólon (10). Na tiróide, o estudo de SNPs de genes relacionados à função oncogênica, supressão tumoral e função tiroidiana tem contribuído para o entendimento da gênese e predisposição ao câncer. O SNP G691S do RET tem sido associado ao aumento do risco de desenvolver carcinoma papilífero (11). Além disto, uma função de modulação genética no desenvolvimento de carcinoma medular de tiróide tem sido atribuída a outros SNPs deste mesmo gene (12). O SNP no códon 72 do TP53 tem sido associado ao aumento do risco de desenvolver câncer de célula folicular de tiróide (carcinoma folicular e papilífero), e este risco aumenta ainda mais quando associado a fatores ambientais, tais como tabagismo, álcool e medicamentos (13). Um SNP no FAS, embora silencioso, foi associado ao carcinoma papilífero, mas não a outras patologias da tiróide (14). No gene da tiroglobulina, estudos sugerem que a variação polimórfica deste gene exerce um efeito direto no risco de desenvolver carcinomas foliculares de tiróide (15).

O gene da galectina-3 em humanos, o LGALS3, está localizado no lócus 14q21-22 e transcreve para um mRNA de 1,1 kb com 6 éxons e 5 introns (16). Vários SNPs situados em regiões codificadoras e não-codificadoras do LGALS3 estão anotados nos bancos de dados públicos de Single Nucleotide Polimorphism do NCBI (http://www.ncbi.nlm.nih.gov/entrez/ query. fcgi?CMD=search&DB=snp). Dentre os polimorfismos descritos para o LGALS3, o SNP T98P é o melhor caracterizado, uma vez que suas freqüências genotípica e alélica já foram estudadas em populações na América do Norte, Ásia e África (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Snp&dopt=GEN&list_uids=4652).

Embora a expressão de galectina-3 tenha sido associada ao câncer de tiróide, uma relação entre SNPs do LGALS3 e o câncer ainda não foi investigada. Neste estudo, investigamos o padrão de SNPs no LGALS3 em tumores de tiróide pelo método de seqüenciamento e expandimos esta análise para o SNP T98P do LGALS3 usando o método de SSCP.

MATERIAL E MÉTODOS

Material biológico

Linhagens celulares de tiróide

As linhagens celulares de tiróide humana, carcinoma papilífero (NPA e TPC-1), carcinoma folicular (WRO) e carcinoma anaplásico (ARO) foram cedidas pelo Dr. James A. Fagin (Division of Endocrinology, The University of Cincinnati, Cincinnati, Ohio, USA). As células foram cultivadas até a semiconfluência em meio RPMI 1640 suplementado com 10% de Soro Bovino Fetal (SBF) (CultiLab, Campinas, SP, Brasil), e mantidas em estufa a 37°C em ambiente com 95% O2 e 5% de CO2.

Tecidos tumorais de tiróide

Neste estudo foram incluídos 55 pacientes do Departamento de Cirurgia de Cabeça e Pescoço da Faculdade de Medicina da Universidade de Santo Amaro (UNISA), São Paulo, SP. As amostras de tecidos tiroidianos frescos preservados em RNA Later (Ambion, Austin, TX) e tecidos tiroidianos emblocados em parafina foram provenientes de pacientes com diagnóstico pré-estabelecido de BMN (n= 30) e carcinoma papilífero (n= 25). Este projeto foi aprovado pelo Comitê de Ética em Pesquisa da UNISA (nº121/2003, Registro CEP UNISA 142/2003) e do Instituto de Ciências Biomédicas da USP (nº 419/CEP, 2003), Universidade de São Paulo.

População controle

A população controle foi constituída de 45 indivíduos saudáveis (masculinos= 21 e femininos= 24) com idade entre 20–56 ± 32 anos, sem história de doença tiroidiana prévia, exposição à radiação e antecedentes de malignidade. As amostras de sangue periférico destes indivíduos foram coletadas no Hemocentro da Universidade Estadual de Campinas (UNICAMP). Este projeto foi aprovado pelo Comitê de Ética em Pesquisa da Universidade Estadual de Campinas (nº 072/98).

Extração de RNA e DNA

Extração de RNA

O RNA total foi extraído de amostras de tecidos tiroidianos (BMN= 21 e CP= 14) e linhagens celulares (WRO, NPA, TPC-1 e ARO), utilizando reagente TRIZOL® (Invitrogen™, Carlsbad, CA, USA) conforme as especificações do fabricante.

Extração de DNA de blocos de parafina

O DNA foi extraído de cortes de tecidos tiroidianos fixados em formol e emblocados em parafina. Áreas de tumor foram selecionadas. O tecido foi digerido com um tampão de lise comercial (Gentra Systems, Inc., Minneapolis, MN, USA) e proteinase K (1,8 mg/ml) a 55°C por 16 h. Em seguida, as proteínas foram precipitadas com NaCl 5M e o DNA foi isolado com isopropanol 100% na presença de Glicogênio.

Extração de DNA de linfócitos do sangue periférico

O DNA genômico foi extraído de leucócitos do sangue periférico dos 45 doadores voluntários usando um protocolo padrão Fenol-Clorofórmio-Proteinase (13).

Transcrição reversa e PCR

Transcrição reversa

A síntese do DNA complementar foi gerada por transcrição reversa (RT) em uma reação contendo: 3 µg de RNA total, 200 ng de Random primer, 200 U de M-MLV-reverse transcriptase, 1 mM de dNTP mix, 10 U de inibidor de RNase em um volume final de 20 µl. A reação foi incubada a 21°C por 10 min, 42°C por 30 min e 99°C por 10 min (8).

Reação em cadeia da polimerase

O cDNA foi amplificado por reação em cadeia da polimerase (PCR) utilizando 2,5 U de Taq DNA polimerase (InvitrogenTM), 1,5 mM de MgCl2, 0,2 mM de dNTP mix e 30 pmol de primers sense e anti-sense, para um volume final de 50 µl. Os primers foram construídos com base na seqüência de mRNA da galectina-3 humana (GenBank: AB006780), sense A: 7AGCACCTCCTCGCCAGCA24 (éxon 1) ou B: 77TGATGCGTTATCTGGGTCTG96 (éxon 3) e anti-sense: C: 787GCACTGGTGAGGTCTATGTC768 (éxon 6), abrangendo cerca de 780 pb do mRNA de galectina-3. A reação foi realizada em 32 ciclos de 94°C por 35 seg, 60°C por 30 seg, 72°C por 45 seg, seguido de extensão a 72°C por 7 min, em um termociclador GeneAmp PCR System 9700 (Applied Biosystems, Foster, CA, USA).

Análise de polimorfismos no gene de galectina-3

Seqüenciamento direto

Os produtos do PCR de 781 pb e 711 pb foram purificados, amplificados usando primers A, B ou C em uma reação contendo deoxinucleotídeos marcados (ET terminator) e, em seguida, levados ao seqüenciador multicapilar MegaBace1000 (Molecular Dynamics, Inc., Sunnyvale, CA, USA) (8). A similaridade das seqüências obtidas foi comparada ao banco de dados do genoma humano usando programa BLASTNT 2.2 (17), e os SNPs foram identificados após o alinhamento das seqüências usando programa Clustalx (18).

Single-Strand Conformation Polymorphism (SSCP)

A região polimórfica do LGALS3 em amostras de cDNA e de DNA foi amplificada por PCR usando primers sense 315GCCTACCCATCTTCTGGACA334 (éxon 3) e anti-sense 542GAAGCGTGGGTTAAAGTGGA523 (éxon 5) e sense 272ACCTGCACCTGGAGTCTACC291 (éxon 3) e anti-sense AAGCCCTCTGCATGTCAAGT (intron 3), respectivamente. Uma alíquota do produto amplificado de 228 pb ou 170 pb proveniente de amostras de cDNA ou DNA, respectivamente, foi diluída 1:3 em formamida 95%, 60 mM NaOH, 10 mM EDTA, 0,1% de bromofenol blue, 0,1% de xilene-cianol, desnaturado a 95°C por 5 minutos. A migração diferencial das fitas de cDNA (228 pb) e DNA (170 pb) após desnaturação foi obtida nas seguintes condições: para amostras de cDNA a eletroforese foi realizada em gel 0,8% MDETM (FMC BioProducts, Rockland, ME, USA) em solução TBE 0,6%, 180 V por 16 horas, enquanto que para amostras de DNA a eletroforese foi realizada em gel 0,7% MDETM (FMC BioProducts) contendo 10% de glicerol em solução de TBE 0,6%, 180V por 20 horas. Após coloração do gel com SYBR®Gold (Molecular Probes, Inc., Eugene, OR), o padrão de migração das fitas de cDNA foi visualizado usando um software ImageQuant acoplado a um sistema de captura de imagem Typhoon 8600 (Molecular Dynamics) sensível a SYBR.

Análise estatística

A distribuição dos genótipos para o SNP T98P do LGALS3 (AC, AA e CC) foi comparada entre os casos de carcinoma papilífero, bócio multinodular e controle usando teste c2. A hipótese de uma associação entre o padrão SNP e o risco de desenvolver tumor benigno ou maligno foi testada pelo teste exato de Fisher, usando um programa estatístico GraphPad V2. 0.5a. Uma possível associação entre fenótipo maligno e cada um dos genótipos (AC, AA, CC) foi calculada por Odds Ratio (OR) com intervalo de confiança (IC) de 95%. Os valores de p< 0,05 foram considerados estatisticamente significantes.

RESULTADOS

A análise de SNPs em toda a extensão da seqüência codificadora de galectina-3 expressa em tecidos tumorais benignos (n= 10) e malignos (n= 10) de tiróide humana, mostrou a presença dos SNPs P64H (éxon 3), T98P (éxon 3), R183K (éxon 5) e Q201H (éxon 6), e ausência de SNPs nos códons Y54H (éxon 3) (TT= 1,0) e Q220X (éxon 6) (CC= 1,0). Dentre os SNPs observados por seqüenciamento, o códon 98 apresentou grande variação entre as freqüências genotípicas (Benignos AC= 0,29, AA= 0,71, CC= 0,00 vs. Malignos AC= 0,00, AA= 0,625, CC= 0,375), comparado aos códons 64 (Benignos CA= 0,14, CC= 0,86, AA= 0,00 vs. Malignos CA= 0,00, CC= 0,875, AA= 0,125), 183 (Benignos GA= 0,09, GG= 0,82, AA= 0,09 vs. Malignos GA= 0,00, GG= 1,00, AA= 0,00) e 201 (Benignos AT= 0,09, AA= 0,91, TT= 0,00 vs. Malignos AT= 0,18, AA= 0,73, TT= 0,09).

A análise específica do SNP T98P do LGALS3 foi avaliada em 55 pacientes com doença tiroidiana (BMN= 30 e CP= 25) e na população controle (n= 45) por SSCP. O SNP T98P situa-se no éxon 3 do gene da galectina-3 humana (346-nt, GenBank: AB006780), onde observamos uma transversão A®C da primeira base no códon 98, resultando na substituição do aminoácido treonina (Thr) para uma prolina (Pro) (figura 1). Este SNP foi observado tanto em heterozigose (AC) quanto em homozigose para o alelo A (AA) ou para o alelo C (CC). O padrão de migração das fitas de cDNA ou DNA com genótipo AC, AA e CC é mostrado na figura 1B e 1C. Em linhagens celulares de carcinoma de tiróide, o genótipo de NPA é CC, enquanto TPC-1, WRO e ARO são AC. Em tecidos tiroidianos, o genótipo de pacientes com diagnóstico de carcinoma papilífero foi AC em 68% dos casos, AA em 20% e CC em 12% (tabelas 1 e 2, figura 2), enquanto o genótipo de pacientes com bócio multinodular foi AC em 67% dos casos, AA em 23% e CC em 10% (tabelas 1 e 3 , figura 2). Na população controle, o genótipo foi AC em 60% dos casos analisados, AA em 24% e CC em 16% (tabela 1, figura 2). Considerando estes resultados, não houve associação significativa entre o genótipo (AC, AA, CC) e o fenótipo de doença benigna ou maligna da tiróide quando comparado à população controle (c2= 0,801, p= 0,938). O risco relativo de desenvolver carcinoma papilífero de tiróide não foi associado ao genótipo AA (OR= 0,722; 95% IC= 0,213 a 2,443; p= 0,764) nem CC (OR= 0,681; 95% IC= 0,154 a 2,998; p= 0,728) quando comparado à população controle. Além disso, o risco relativo de desenvolver carcinoma papilífero também não foi associado ao genótipo AA (OR= 0,927; 95% IC= 0,528 a 1,627; p= 1,000) nem CC (RR= 1,081; 95% IC= 0,460 a 2,539; p= 1,000) quando comparado à doença tiroidiana benigna (BMN).




  • DISCUSSÃO

    Após o seqüenciamento completo do genoma humano foram identificados cerca de 1,4 milhões de SNPs, sendo que aproximadamente 60.000 estão situados na região codificante dos genes (19). SNPs situados na seqüência codificadora podem afetar a função ou a eficiência da proteína e, assim, modular a resposta a drogas e suscetibilidade a doenças (9,19). Neste estudo, observamos que os SNPs nos códons 64, 98, 183 e 201 do LGALS3 estão presentes em tumores benignos e malignos de tiróide. Dentre estes, o SNP do códon 98 apresentou uma maior variação genotípica entre as amostras de tumores benignos e malignos. O SNP do códon 98 de galectina-3 ocasiona a substituição do aminoácido prolina (não-polar) para uma treonina (polar não-iônico) no domínio N-terminal da proteína. Alteração deste tipo, não-conservativa, que acarreta na substituição de um aminoácido por outro com propriedades químicas diferentes, apresenta uma maior probabilidade de produzir mudanças na estrutura e função da proteína (19). Embora a participação da região N-terminal de galectina-3 na sua função biológica não seja totalmente compreendida, sugere-se que este domínio seja responsável pela localização celular de galectina-3 e um sítio de interação com outras proteínas, modulando assim as múltiplas funções de galectina-3 na célula (20). Por outro lado, não sabemos se o SNP do códon 98 de galectina-3 tem relevância estrutural e funcional, pois a estrutura cristalográfica do domínio N-terminal de galectina-3 não está determinada.

    Em linhagens celulares de tiróide, o genótipo para o SNP T98P do LGALS3 observado em NPA é CC, enquanto os genótipos de TPC-1, WRO, ARO são AC, sugerindo que não existe associação entre o genótipo e diferentes tipos histológicos de carcinoma tiroidiano. Além disto, o estudo de amostras de tecido tiroidiano mostrou que a proporção de heterozigotos e as freqüências alélicas observadas nas amostras de BMN (AC= 0,67, alelo A= 0,56 e alelo C= 0,44) e carcinomas papilíferos (AC= 0,68, alelo A= 0,54, alelo C= 0,46) são semelhantes às observadas na população controle (AC= 0,60, alelo A= 0,54, alelo C= 0,46). Interessante notar que a proporção de heterozigotos e a freqüência alélica observada neste estudo são semelhantes às observadas na população norte-americana de Utah, USA (AC= 0,517, alelo A= 0,525 e alelo C= 0,475) quando comparada à população japonesa de Tokyo, Japão (AC= 0,386, alelo A= 0,580 e alelo C= 0,420), chinesa de Beijing, China (AC= 0,422, alelo A= 0,589 e alelo C= 0,411), e africana da Nigéria, África (AC= 0,085, alelo A= 0,042 e alelo C= 0,958) (http://www.ncbi.nlm.nih.gov/entrez/ query.fcgi?cmd=Retrieve&db=Snp&dopt=GEN&list_uids=4652, 15/12/2005).

    Embora a função de galectina-3 não esteja totalmente compreendida, a expressão de galectina-3 foi amplamente avaliada em neoplasias tiroidianas, sendo considerada um promissor marcador molecular para diferenciar lesão folicular benigna de maligna (3-6). O estudo de SNPs tem contribuído na identificação e compreensão de genes que influenciam o risco de desenvolver câncer (9-15). Desta forma, SNP do LGALS3 poderia estar implicado na predisposição ou gênese do câncer de tiróide. Neste estudo, constatamos que não há associação entre os diferentes genótipos do SNP T98P do LGALS3 e o fenótipo de tumor benigno ou maligno de tiróide. Entretanto, estudos adicionais ainda são necessários para estabelecer se outros SNPs (P64H, R183K e Q201H) podem estar associados ao câncer de tiróide. Além disto, a caracterização da função de galectina-3 na tiróide, ainda desconhecida, poderá esclarecer a relevância do SNP T98P no papel biológico de galectina-3 na célula folicular tiroidiana.

    AGRADECIMENTOS

    Agradecemos ao apoio da Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) e ao Conselho Nacional de Pesquisa (CNPq). LM — FAPESP: 02/12722-3, SGL — CNPq: 571451/2001-2 e ETK — CNPq: 302917/2003-9.

  • Endereço para correspondência:
    Edna Teruko Kimura
    Departamento de Biologia Celular e do Desenvolvimento, Instituto de Ciências Biomédicas, Universidade de São Paulo
    Av. Prof. Lineu Prestes 1524, 4º andar, sala 414
    05508-000 São Paulo, SP
    Fax: (11) 3091-7402
    E-mail:
  • Recebido em 30/03/05

    Revisado em 13/01/06 e 12/05/06

    Aceito em 23/06/06

    • 1. Liu FT, Patterson RJ, Wang JL. Intracellular functions of galectins. Biochim Biophys Acta 2002;1572(2-3):263-73.
    • 2. Yoshii T, Inohara H, Takenaka Y, Honjo Y, Akahani S, Nomura T, et al. Galectin-3 maintains the transformed phenotype of thyroid papillary carcinoma cells. Int J Oncol 2001;18(4):787-92.
    • 3. Xu XC, el-Naggar AK, Lotan R. Differential expression of galectin-1 and galectin-3 in thyroid tumors. Potential diagnostic implications. Am J Pathol 1995;147(3):815-22.
    • 4. Inohara H, Honjo Y, Yoshii T, Akahani S, Yoshida J, Hattori K, et al. Expression of galectin-3 in fine-needle aspirates as a diagnostic marker differentiating benign from malignant thyroid neoplasms. Cancer 1999;85(11):2475-84.
    • 5. Bartolazzi A, Gasbarri A, Papotti M, Bussolati G, Lucante T, Khan A, et al. Application of an immunodiagnostic method for improving preoperative diagnosis of nodular thyroid lesions. Lancet 2001;357(9269):1644-50.
    • 6. Nascimento MCPA, Bisi H, Alves VAF, Longatto-Filho A, Kanamura CT, Medeiros-Neto G. Differential reactivity for galectin-3 in Hürthle cell adenomas and carcinomas. Endocr Pathol 2001;2:275-9.
    • 7. Saggiorato E, Aversa S, Deandreis D, Arecco F, Mussa A, Puligheddu B, et al. Galectin-3: presurgical marker of thyroid follicular epithelial cell-derived carcinomas. J Endocrinol Invest 2004;27(4):311-7.
    • 8. Martins L, Matsuo SE, Ebina KN, Kulcsar MA, Friguglietti CU, Kimura ET. Galectin-3 messenger ribonucleic acid and protein are expressed in benign thyroid tumors. J Clin Endocrinol Metab 2002;87(10):4806-10.
    • 9. Erichsen HC, Chanock SJ. SNPs in cancer research and treatment. Br J Cancer 2004;90(4):747-51.
    • 10. Kaklamani VG, Hou N, Bian Y, Reich J, Offit K, Michel LS, et al. TGFBR1*6A and cancer risk: a meta-analysis of seven case-control studies. J Clin Oncol 2003;21(17):3236-43.
    • 11. Stephens LA, Powell NG, Grubb J, Jeremiah SJ, Bethel JA, Demidchik EP, et al. Investigation of loss of heterozygosity and SNP frequencies in the RET gene in papillary thyroid carcinoma. Thyroid 2005;15(2):100-4.
    • 12. Baumgartner-Parzer SM, Lang R, Wagner L, Heinze G, Niederle B, Kaserer K, et al. Polymorphisms in exon 13 and intron 14 of the RET protooncogene: genetic modifiers of medullary thyroid carcinoma? J Clin Endocrinol Metab 2005;90(11):6232-6.
    • 13. Granja F, Morari J, Morari EC, Correa LAC, Assumpção LVM, Ward LS. Proline homozygosity in codon 72 of p53 is a factor of susceptibility for thyroid cancer. Cancer Lett 2004;210:151-7.
    • 14. Basolo F, Giannini R, Faviana P, Fontanini G, Patricelli Malizia A, Ugolini C, et al. Thyroid papillary carcinoma: preliminary evidence for a germ-line single nucleotide polymorphism in the Fas gene. J Endocrinol 2004;182:479-84.
    • 15. Matakidou A, Hamel N, Popat S, Henderson K, Kantemiroff T, Harmer C, et al. Risk of non-medullary thyroid cancer influenced by polymorphic variation in the thyroglobulin gene. Carcinogenesis 2004;25(3):369-73.
    • 16. Cooper DN. Galectinomics: finding themes in complexity. Biochim Biophys Acta 2002;1572(2-3):209-31.
    • 17. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997;25(17):3389-402.
    • 18. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 1997;25:4876-82.
    • 19. Guttmacher AE, Collins FS, Drazen, JM. Genomic medicine: Articles from the New England Journal of Medicine Baltimore: The Johns Hopkins University Press, 2004
    • 20. Gong HC, Honjo Y, Nangia-Makker P, Hogan V, Mazurak N, Bresalier RS, et al. The NH2 terminus of galectin-3 governs cellular compartmentalization and functions in cancer cells. Cancer Res 1999;59(24):6239-45.

    Endereço para correspondência: Edna Teruko Kimura Departamento de Biologia Celular e do Desenvolvimento, Instituto de Ciências Biomédicas, Universidade de São Paulo Av. Prof. Lineu Prestes 1524, 4º andar, sala 414 05508-000 São Paulo, SP Fax: (11) 3091-7402 E-mail: etkimura@usp.br

    Datas de Publicação

    • Publicação nesta coleção
      08 Jan 2007
    • Data do Fascículo
      Dez 2006

    Histórico

    • Aceito
      23 Jun 2006
    • Revisado
      12 Maio 2006
    • Recebido
      30 Mar 2005
    Sociedade Brasileira de Endocrinologia e Metabologia Rua Botucatu, 572 - conjunto 83, 04023-062 São Paulo, SP, Tel./Fax: (011) 5575-0311 - São Paulo - SP - Brazil
    E-mail: abem-editoria@endocrino.org.br