Accessibility / Report Error

Bases para um programa de controle da artrite encefalite caprina em rebanho leiteiro

[Bases for a program of control of caprine arthritis encephalite in dairy flock]

RESUMO

Objetivou-se avaliar um programa de controle da artrite encefalite caprina (AEC), por meio de testes diagnósticos sensíveis, separação de mãe e cria após o parto e medidas de manejo, com o intuito de formar rebanho livre do vírus. Utilizou-se um total de 47 cabritos da raça Saanen, mantidos isoladamente até o resultado dos primeiros testes de reação em cadeia de polimerase nested (PCR nested) e Western Blotting (WB), com base na coleta de sangue no momento do nascimento (M0). No PCR nested, quatro animais foram positivos, no M0, e foram eutanasiados. Posteriormente, os demais 43 cabritos foram submetidos à coleta de sangue aos 60 (M60) e 270 (M270) dias de vida para realização de novos testes de WB e PCR nested, que não detectaram animais positivos. Pode-se afirmar que a metodologia adotada neste estudo foi efetiva no controle da doença, nas fases de aleitamento e pós-aleitamento, e que a combinação do sistema de manejo, a fim de propiciar diminuição de risco de transmissão horizontal, com técnicas de diagnóstico mais apuradas, como o WB e a PCR nested, é relevante para elaboração de plano estratégico de controle da enfermidade.

Palavras-chave:
manejo; lentivírus; caprino

ABSTRACT

We aimed to evaluate a program to control Caprine Arthritis Encephalitis (CAE), using diagnostic tests, separation of the mother and postpartum and other management measures, in order to form a free flock of the virus. We used a total of 47 Saanengoats in isolation until the results of the first nested Polymerase Chain Reaction (nested PCR) and Western Blotting (WB) tests, based on blood collection at the time of birth (M0). In the nested PCR, 4 animals were positive, at M0, and were eliminated. Later, the other 43goats were submitted to blood collection at 60 (M60) and 270 (M270) days of life to perform new tests of WB and nested PCR, which did not detect positive animals. We can affirm that the methodology adopted in this study was effective in the control of the disease, in the phase of breastfeeding and post-breastfeeding, and that the combination of the management system, which allows a reduction of risk of horizontal transmission, with more accurate diagnostic techniques, such as WB and nested PCR, is relevant for the elaboration of a strategic plan for the disease control.

Keywords:
management; lentivirus; caprine

INTRODUÇÃO

A artrite encefatite caprina (AEC) é enquadrada como uma das lentiviroses de pequenos ruminantes (LVPR) e tem como agente etiológico um vírus da família Retroviridae, subfamília Orthoretovirinae, gênero Lentivirus (International Committee on Taxonomy of Viruses, 2017), conhecido como o vírus da AEC ou CAEV. As medidas de controle e erradicação da AEC são complexas, onerosas e laboriosas, principalmente pela ocorrência de animais infectados assintomáticos, pela detecção tardia de animais soropositivos, pela inexistência de vacinas eficazes, pela presença de animais nos rebanhos falso-negativos e pela ampla disseminação da enfermidade nos rebanhos, principalmente em rebanhos leiteiros (Lara, 2008LARA, M.C.C.S.H. Artrite-encefalite dos caprinos (CAE). 2008. Available in: http://www.infobibos.com/Artigos/2008_4/artrite/index.htm. Accessed in: 16 Feb. 2015.
http://www.infobibos.com/Artigos/2008_4/...
). Por essas razões, a importância do diagnóstico precoce é ressaltada (Pinheiro et al., 2003PINHEIRO, R.R.; CHAGAS, A.C.S.; ANDRIOLI, A.; ALVES, F.S.F. Viroses de pequenos ruminantes. Sobral: Embrapa Caprinos, 2003. 30p. (Documentos, n.46)).

Uma medida de controle e acompanhamento do status sanitário do rebanho é a realização de testes sorológicos para diagnosticar a AEC. Esses devem ser preferencialmente repetidos a cada semestre, devendo ser realizados em animais com mais de quatro meses de idade (Souza, 2014SOUZA, T.S. Transmissão interespécies de lentivírus de caprinos para ovinos. 2014. 123f. Tese (Doutorado em Ciência Animal nos Trópicos) - Universidade Federal da Bahia, Salvador, BA.). No entanto, mesmo com a realização periódica de testes sorológicos, a presença de animais falso-negativos no rebanho é um grande entrave para a consolidação de programas de controle da enfermidade (Castro et al., 2002CASTRO, R.S.; LEITE, R.C.; AZEVEDO, E.O. et al. Soroconversão e sororeatividadede cabras leiteiras naturalmente expostas ao vírus da Atrite encefalite caprina no Brasil. Ciênc. Rural, v.32, p.603-607, 2002.). Por isso, há a necessidade do uso de testes diretos, como a reação em cadeia de polimerase (PCR) (Konishi et al., 2011KONISHI, M.; NAGURA, Y.; TAKEI, N.; FUJITA, M. Combined eradication strategy for CAE in a dairygoat farm in Japan. Small Ruminant Res., v.99, p.65-71, 2011.), que é capaz de estabelecer um diagnóstico precoce e ampliar a sensibilidade de detecção de animais positivos (Pinheiro et al., 2012PINHEIRO, R.R.; ANDRIOLI, A.; SIDER, L.H. et al. Lentiviroses em pequenos ruminantes: principais métodos de diagnóstico. Sobral: Embrapa Caprinos e Ovinos, 2012. 42p. (Comunicado Técnico, n.107).).

Considerando-se que não há tratamento nem vacina para essa enfermidade (Callado et al., 2001CALLADO, A.K.C.; CASTRO, R.S.; TEIXEIRA, M.F.S. Lentivírus de pequenos ruminantes (CAEV e MAEDI-VISNA): revisão e perspectivas. Pesqui. Vet. Bras., v.21, p.87-97, 2001.), é importante impedir a disseminação do CAEV nos rebanhos, mediante a realização periódica de testes de diagnóstico, os quais são essenciais para a implantação e a manutenção de programas de controle (Pinheiro et al., 2003PINHEIRO, R.R.; CHAGAS, A.C.S.; ANDRIOLI, A.; ALVES, F.S.F. Viroses de pequenos ruminantes. Sobral: Embrapa Caprinos, 2003. 30p. (Documentos, n.46)). O objetivo deste estudo foi avaliar um programa de controle da AEC, a partir da utilização de testes diagnósticos sensíveis, da separação de mãe e cria imediatamente após o nascimento e de outras medidas de manejo, com o intuito de formar rebanhos livres do vírus.

MATERIAL E MÉTODOS

Esta pesquisa foi realizada após submissão dos protocolos experimentais e aprovação pela Comissão de Ética no Uso de Animais (Ceua) da Universidade Estadual Vale do Acaraú, com o número de protocolo 014.12. Os cabritos utilizados neste estudo foram provenientes de um rebanho leiteiro pertencente à Embrapa Caprinos e Ovinos, localizada no município de Sobral, região semiárida do sertão nordestino. No rebanho era adotado um programa de controle da enfermidade, no qual os animais eram submetidos aos testes de imunodifusão em gel de ágar (IDGA), ensaio imunoenzimático (ELISA) e Western Blotting (WB) quadrimestralmente, sendo separados em grupos de animais soropositivos e soronegativos conforme o diagnóstico. As cabras eram divididas em grupos distintos, de forma a ocorrer três estações de parição no rebanho anualmente. O sistema de acasalamento adotado no rebanho é a monta natural controlada, sendo as cabras soronegativas cobertas por reprodutores soronegativos e as cabras soropositivas por reprodutores soropositivos. Os animais soronegativos foram obtidos de dois resultados negativos seguidos, nas três provas de diagnóstico (IDGA, ELISA e WB).

Neste estudo, acompanhou-se um período de parição de cabritos da raça Saanen em agosto de 2013. Todos os procedimentos dos partos foram rigorosamente assistidos, realizando-se a separação imediata dos animais recém-nascidos das mães, no intuito de não permitir nenhum contato entre ambos. Todos os animais utilizados como progenitores foram soronegativos para AEC.

Imediatamente após o nascimento, foi coletada uma amostra de sangue dos 47 cabritos para realização dos testes de WB e reação em cadeia de polimerase nested (PCR nested). A coleta de sangue ocorreu antes de os animais mamarem o colostro termicamente tratado (56°C, por 60 minutos). Todos os cabritos permaneceram isolados individualmente até o resultado dos exames. Os animais que tiveram resultados positivos, em pelo menos um dos testes, foram eutanasiados, e somente os animais negativos, nos dois testes, foram agrupados, formando-se, assim, um rebanho, que foi acompanhado até os 270 dias de idade. Salienta-se que esse rebanho permaneceu totalmente isolado dos demais animais da fazenda no decorrer da pesquisa.

Durante todo o estudo, realizaram-se três coletas de sangue, sendo a primeira no nascimento (M0), a segunda aos 60 dias (M60) e a terceira aos 270 dias de idade (M270). A coleta foi realizada por meio da venipunção da jugular, usando-se tubos tipo Vacutainer® de 10mL, com EDTA e sem anticoagulante. As amostras de sangue foram encaminhadas ao Laboratório de Imunodiagnóstico da Embrapa Caprinos e Ovinos, onde aquelas sem anticoagulante foram centrifugadas a 3000g, e os soros obtidos armazenados e congelados a -20°C até a realização do teste de WB.

As amostras de sangue com anticoagulante foram centrifugadas a 1500g, para obtenção das camadas de leucócitos, que foram tratadas com cloreto de amônio, segundo metodologia de Karanikolaou et al. (2005KARANIKOLAOU, K.; ANGELOPOULOU, K.; PAPANASTASOPOULOU, M. et al. Detection of small ruminant lentiviruses by PCR and serology tests in field samples of animals from greece. Small Ruminant Res., v.58, p.181-187, 2005.). A extração de DNA realizou-se por meio da metodologia de Grimberg et al. (1989GRIMBERG, J.; NAWOSCHIK, S.; BELLUSCIO, L. et al. A simple and eficiente non-organic procedure for the isolation ofgenomic DNA from blood. Nucleic Acids Res., v.17, p.8390, 1989.). A quantificação e a avaliação da qualidade do DNA extraído foram realizadas por leitura da espectrofotometria a 260 e 280nm. Na sequência, as amostras foram armazenadas a -20ºC até o momento da realização do teste de PCR nested.

Para a realização da PCR nested, os iniciadores desenhados foram: CAEV1 = 5’CAAGCAGCAGGAGGGAGAAGCTG3’; CAEV2=5’TCCTACCCCCATAATTTGATCCAC3 (posição genômica 1249 - 1226) descritos por Barlough et al. (1994BARLOUGH, J.; EAST, N.; ROWE, J.D. et al. Double-nested polymerase chain reaction for detection of caprine arthritis-encephalitis virus proviral DNA in blood, milk, and tissues of infectedgoats. J. Virol. Methods, v.50, p.101-114, 1994.), resultando na amplificação de um fragmento de DNA de 296pb. O produto dessa amplificação foi, então, reamplificado com iniciadores internos CAEV3=5’GTTCCAGCAACTCGAAACAGTAGCAA TG-3’ (posição genômica 997 - 1024) e CAEV4 = 5’ACCTT TCTGCTTCTTCATTTAATTTCCC 3’ (posição genômica 1181 - 1154), a fim de obter-se um fragmento-alvo final de 185pb (Rimstad et al., 1993RIMSTAD, E.; EAST, N.E.; TORTEN, M. et al. Delayed seroconversion following naturally acquired caprine arthritis-encephalitis virus infection ingoats. Am. J. Vet. Res., v.54, p.1858-1862, 1993.). As reações de PCR foram realizadas em volume total de 50µL, contendo 10mM de Tris-HCl (pH 8,0), 50mM de KCl, 1,5mM de MgCl2, 100µM de cada dNTP (dATP, dGTP, dCTP, dTTP), 20pmoles de cada iniciador, 2,0 U Taq DNA polimerase e 3µL do DNA molde. Os ciclos foram constituídos de uma desnaturação inicial a 94°C, por 5min, e 35 ciclos com desnaturação a 94°C, por 5min, hibridização a 63°C, por 1min, e extensão a 72°C, por 45 segundos. Realizou-se uma extensão final de 72ºC, por 7min (Andrioli et al., 2006ANDRIOLI, A.; SOUZA, K.C.; PINHEIRO, R.R.; SOUSA, F.M.L. Protocolos para extração do DNA-proviral e PCR do lentivírus caprino em sangue. Sobral: Embrapa, 2006. 5p. (Comunicado Técnico, n.72)).

Para leitura dos resultados da PCR, realizou-se eletroforese em gel de agarose 2%, corado com brometo de etídio. Em todas as corridas, foram utilizados controles negativos (células de MSC não infectadas), controles positivos (células de MSC infectadas) e os controles de reagentes (H2O bidestilada, autoclavada, livre de DNAse) (Andrioli et al., 2006ANDRIOLI, A.; SOUZA, K.C.; PINHEIRO, R.R.; SOUSA, F.M.L. Protocolos para extração do DNA-proviral e PCR do lentivírus caprino em sangue. Sobral: Embrapa, 2006. 5p. (Comunicado Técnico, n.72)). As amostras amplificadas por PCR foram purificadas após eletroforese em gel de agarose de baixo ponto de fusão ("low melting point") a 1%, por meio do kit de extração, conforme instruções do fabricante.

O teste de WB seguiu o protocolo de Pinheiro et al. (2011PINHEIRO, R.R.; BRITO, R.L.L.; RODRIGUES, A.S. et al. Protocolo de immunoblotting para diagnóstico da Artrite-encefalite caprina. Sobral: Embrapa Caprinos e Ovinos, 2011. 4p. (Comunicado Técnico, n.122).), realizando-se eletroforese SDS-PAGE com géis de concentração e separação a 4% e 12,5%, respectivamente. Em seguida, ocorreu a transferência passiva das proteínas contidas no gel para a membrana de nitrocelulose (Protan® - 0,45µm - Amersham Cat. nº 10600002). A membrana foi previamente bloqueada com PBS Tween a 0,3%. O imunodiagnóstico foi realizado com diluições de soro de 1:50 e conjugado rabbit anti-goat IgG peroxidase (Sigma® Cat. A5420) de 1:15000. A revelação das bandas de proteína ocorreu ao abrigo da luz, com os substratos 4-cloro-1-naftol e 3,3’ diaminobenzidina (DAB), com H2O2 a 30% e a reação inibida com adição de água destilada. Realizou-se estatística descritiva dos dados na forma de porcentagem simples, para demonstrar as quantidades de animais detectados como positivos e negativos, para cada teste diagnóstico realizado.

RESULTADOS E DISCUSSÃO

Neste estudo, um total de 47 animais foi inicialmente utilizado. Destes, 8,5% (4/47) foram positivos no M0, no teste de PCR nested, e eutanasiados. No M60 e no M270, nenhum dos 43 animais foi positivo pela técnica de PCR nested. Durante todo o experimento, o teste sorológico utilizado (WB) não detectou animais soropositivos (Tab. 1).

Tabela 1
Valores reais e percentuais de positividade e negatividade para os testes de diagnóstico da AEC (Western Blotting e PCR nested) do momento do nascimento (M0), aos 60 dias (M60) e aos 270 dias de vida (M270)

O isolamento individual dos cabritos, imediatamente após o nascimento, e a retirada dos animais infectados (PCR positivo) possivelmente tenham evitado a disseminação do vírus. A técnica de PCR vem sendo utilizada com sucesso na detecção de LVPR, possuindo alta sensibilidade e especificidade (Zanoni et al., 1990ZANONI, R.; PAULI, L.T.; PETERHANS, E. Detection of caprine arthritis-encephalitis- and maedi-visna viruses using the polymerase chain reaction. Experientia, v.46, p.316-319, 1990.). Wagter et al. (1998WAGTER, L.H.A.; JANSEN, A.; BLEUMINK-PLUYM, N.M.C. et al. PCR detection of lentiviralgag segment DNA in the white blood cells of sheep and goats. Vet. Res. Commun., v.22, p.355-362, 1998.) afirmaram que essa técnica é bastante versátil e foi adaptada para amostras sanguíneas, de leite, sêmen e de outros tecidos, porém, em se tratando de animais em estágios iniciais da doença, as amostras de sangue são mais eficientes para a detecção do DNA pró-viral. Além disso, a PCR apresenta vantagem sobre métodos sorológicos de detecção de infecção em animais com anticorpos colostrais (Zanoni et al., 1990).

Em infecções por LVPR, diagnosticadas pela técnica de PCR, são frequentemente encontrados animais negativos nos testes sorológicos (Rimstad et al., 1993RIMSTAD, E.; EAST, N.E.; TORTEN, M. et al. Delayed seroconversion following naturally acquired caprine arthritis-encephalitis virus infection ingoats. Am. J. Vet. Res., v.54, p.1858-1862, 1993.), o que demonstra uma menor sensibilidade desses métodos em comparação ao teste molecular (Cardinaux et al., 2013CARDINAUX, L.; ZAHNO, M.L.; DEUBELBEISS, M. et al. Virological and phylogenetic characterization of attenuated small ruminant lentivirus isolates eluding efficient serological detection. Vet. Microbiol., v.162, p.572-581, 2013.). Segundo Wagter et al. (1998WAGTER, L.H.A.; JANSEN, A.; BLEUMINK-PLUYM, N.M.C. et al. PCR detection of lentiviralgag segment DNA in the white blood cells of sheep and goats. Vet. Res. Commun., v.22, p.355-362, 1998.), a técnica de PCR é capaz de detectar a infecção em 88,3% de ovinos e caprinos que são soropositivos e em 11% que são soronegativos na IDGA. No entanto, já foi demonstrada uma menor sensibilidade da técnica de PCR em comparação aos testes sorológicos (ELISA e IDGA), mesmo esse teste indicando animais infectados antes da soroconversão (Zanoni et al., 1996ZANONI, R.G.; CORDANO, P.; NAUTA, I.M.; PETERHANS, E. PCR for the detection of lentiviruses from small ruminants. Schweiz. Arch. Tierheilkd., v.138, p.93-98, 1996.). A baixa carga viral no sangue é um grande desafio para a detecção de vírus pela PCR.

Além disso, como foi mostrado em cabras experimentalmente infectadas com CAEV, pode ocorrer variação da carga viral, podendo existir diferenças de resultados entre indivíduos (Zhang et al., 2000ZHANG, Z.; WATT, N.J.; HOPKINS, J. et al. Quantitative analysis of maedi-visna virus DNA load in peripheral blood monocytes and alveolar macrophages. J. Virol. Methods, v.86, p.13-20, 2000.). Outrossim, uma diminuição no nível de sensibilidade da técnica de PCR foi demonstrada pelo tipo de amostra biológica utilizado no teste (Extramiana et al., 2002EXTRAMIANA, B.; GONZALES, L.; JUSTE, R.A. Evaluation of a PCR technique for the detection of Maedi-Visna proviral DNA in blood, milk and tissue samples of naturally infected sheep. Small Ruminant Res., v.44, p.109-118, 2002.). Esses autores evidenciaram níveis de detecção de 83,5% para leucócitos no sangue periférico, 66,7% nas células do leite e 88% nos tecidos. Observaram, ainda, que a técnica de PCR apresentou uma especificidade de até 100% quando comparada com a IDGA. Karanikolaou et al. (2005KARANIKOLAOU, K.; ANGELOPOULOU, K.; PAPANASTASOPOULOU, M. et al. Detection of small ruminant lentiviruses by PCR and serology tests in field samples of animals from greece. Small Ruminant Res., v.58, p.181-187, 2005.), demonstraram que a uso da técnica de PCR em diferentes amostras biológicas manteve a especificidade em 100%.

Quanto ao fato da ocorrência de nascimento de animais positivos para a infecção, Cavalcante et al. (2013CAVALCANTE, F.R.A.; ANDRIOLI, A.; PINHEIRO, R.R. et al. Detecção do vírus da Artrite Encefalite Caprina por nested PCR e nested RTPCR em ovócitos e fluído uterino. Arq. Inst. Biol., v.80, p.381-386, 2013.) demonstraram a presença do pró-vírus em ovócitos e no fluido uterino de três animais infectados experimentalmente, que reagiam negativamente às provas sorológicas. Isso pode ter ocorrido neste estudo, uma vez que os animais utilizados como progenitores eram soronegativos para AEC, no entanto poderiam abrigar o vírus no sistema reprodutor, e não na corrente sanguínea, favorecendo a transmissão intrauterina.

Já foi demonstrado que animais positivos representam uma importante fonte de infecção do vírus da AEC para animais sadios em um rebanho (East et al., 1993EAST, N.E.; ROWE, J.D.; DAHLBERG, J.E. et al. Modes of transmission of caprine arthritis-encephalitis virus infection. Small Ruminant Res., v.10, p.251-262, 1993.). O isolamento de animais imediatamente após o parto e a eliminação dos positivos, diagnosticados por meio de testes sorológicos e/ou moleculares, são fundamentais para um controle efetivo dessa enfermidade. Essas medidas previnem a transmissão vertical e horizontal da doença, impossibilitando a contaminação dos animais nascidos negativos (Konishi et al., 2011KONISHI, M.; NAGURA, Y.; TAKEI, N.; FUJITA, M. Combined eradication strategy for CAE in a dairygoat farm in Japan. Small Ruminant Res., v.99, p.65-71, 2011.).

O isolamento individual dos cabritos foi muito importante, pois um comportamento muito comum nessa fase de vida dos animais e que favorece a ocorrência da transmissão horizontal relaciona-se ao hábito de cabritos jovens ficarem aglomerados e simularem o movimento de sucção de leite em diversas partes do corpo de outros animais, favorecendo a troca de secreções (Gufler et al., 2007GUFLER, H.; GASTEINER, J.; LOMBARDO, D.; STIFTER, E. et al. Serological study of small ruminant lentivirus ingoats in Italy. Small Ruminant Res., v.73, p.169-173, 2007.). Souza et al. (2015SOUZA, K.C.; ANDRIOLI, A.; SIDER, L.H. et al. Detecção de sequências do DNA proviral do vírus da Artrite Encefalite Caprina em saliva. Acta Sci. Vet., v.43, p.1266, 2015.) já comprovaram a presença do CAEV na saliva, o que reforça a hipótese da transmissão entre animais, principalmente nessa faixa etária, por ocasião do comportamento descrito acima. A adoção de testes diagnósticos no momento do nascimento, associados à separação dos animais positivos, possivelmente pode ter bloqueado essa rota de transmissão do CAEV.

O sucesso parcial de vários programas de controle da AEC indica que os testes disponíveis para diagnóstico dessa doença e as medidas de contenção comumente adotadas são úteis para reduzir a prevalência da infecção (Peterhans et al., 2004PETERHANS, E.; GREENLAND, T.; BADIOLA, J. et al. Routes of transmission and consequences of small ruminant lentiviruses (SRLVs) infection and eradication schemes. Vet. Res., v.35, p.257-274, 2004.), mas não para a sua erradicação. Pérez et al. (2013PÉREZ, M.; MUÑOZ, J.A.; BIESCAS, E. et al. Successful Visna/maedi controla highly infected ovine dairy flock using serologic segregation and management strategies. Prev. Vet. Med., v.112, p.423-427, 2013.), Rodrigues et al. (2018RODRIGUES, A.S.; PINHEIRO, R.R.; BRITO, R.L.L. et al. Avaliação de um controle estratégico da artrite encefalite caprina em rebanho caprino leiteiro. Arq. Bras. Med. Vet. Zootec., v.70, p.139-146, 2018.) e Tavella et al. (2018TAVELLA, A.; BETTINI, A.; CEOL, M. et al. Achievements of an eradication programme against caprine arthritis encephalitis virus in South Tyrol, Italy. Vet. Rec., v.182, p.1-5, 2018.), com a implementação de programas estratégicos de controle das LVPR em ovinos e caprinos, conseguiram reduzir significativamente os níveis de animais soropositivos e eliminar os sintomas clínicos no rebanho, mas não conseguiram zerar a incidência sorológica.

Um caso de sucesso na erradicação do CAEV foi obtido por Konishi et al. (2011KONISHI, M.; NAGURA, Y.; TAKEI, N.; FUJITA, M. Combined eradication strategy for CAE in a dairygoat farm in Japan. Small Ruminant Res., v.99, p.65-71, 2011.), por meio de um programa de erradicação do vírus da AEC, similar ao deste estudo, o qual consistiu em diversas medidas de manejo, como: separação imediata entre mãe e cria após o parto; fornecimento de colostro bovino; abate de animais positivos; segregação dos animais positivos e negativos; segregação de outros que tiveram contato com o rebanho com status positivo ou desconhecido; separação dos animais de forma a evitar o contato entre animais de diferentes idades; e uso de testes molecular e sorológico periodicamente.

Os resultados deste estudo mostraram um forte indicativo de que esse conjunto de estratégias de controle evitou a contaminação nos cabritos pelo vírus da AEC, pois, nos dois momentos (M60 e M270) e em ambos os testes (WB e PCR nested), nenhum dos 43 animais foi positivo. Entretanto, para confirmar o desaparecimento do vírus desse rebanho, seria necessária uma pesquisa com mais análises diagnósticas e um tempo mais prolongado, como foi descrito por Konishi et al. (2011KONISHI, M.; NAGURA, Y.; TAKEI, N.; FUJITA, M. Combined eradication strategy for CAE in a dairygoat farm in Japan. Small Ruminant Res., v.99, p.65-71, 2011.).

CONCLUSÃO

A metodologia adotada neste estudo foi efetiva no controle da doença, na fase de aleitamento e pós-aleitamento. Salienta-se que a combinação de medidas de manejo que propiciem diminuição de risco de transmissão horizontal, com técnicas de diagnóstico mais apuradas, como o Western Blotting e a PCR nested, é relevante para elaboração de plano estratégico de controle da enfermidade.

REFERÊNCIAS

  • ANDRIOLI, A.; SOUZA, K.C.; PINHEIRO, R.R.; SOUSA, F.M.L. Protocolos para extração do DNA-proviral e PCR do lentivírus caprino em sangue. Sobral: Embrapa, 2006. 5p. (Comunicado Técnico, n.72)
  • BARLOUGH, J.; EAST, N.; ROWE, J.D. et al. Double-nested polymerase chain reaction for detection of caprine arthritis-encephalitis virus proviral DNA in blood, milk, and tissues of infectedgoats. J. Virol. Methods, v.50, p.101-114, 1994.
  • CALLADO, A.K.C.; CASTRO, R.S.; TEIXEIRA, M.F.S. Lentivírus de pequenos ruminantes (CAEV e MAEDI-VISNA): revisão e perspectivas. Pesqui. Vet. Bras., v.21, p.87-97, 2001.
  • CARDINAUX, L.; ZAHNO, M.L.; DEUBELBEISS, M. et al. Virological and phylogenetic characterization of attenuated small ruminant lentivirus isolates eluding efficient serological detection. Vet. Microbiol., v.162, p.572-581, 2013.
  • CASTRO, R.S.; LEITE, R.C.; AZEVEDO, E.O. et al. Soroconversão e sororeatividadede cabras leiteiras naturalmente expostas ao vírus da Atrite encefalite caprina no Brasil. Ciênc. Rural, v.32, p.603-607, 2002.
  • CAVALCANTE, F.R.A.; ANDRIOLI, A.; PINHEIRO, R.R. et al. Detecção do vírus da Artrite Encefalite Caprina por nested PCR e nested RTPCR em ovócitos e fluído uterino. Arq. Inst. Biol., v.80, p.381-386, 2013.
  • EAST, N.E.; ROWE, J.D.; DAHLBERG, J.E. et al. Modes of transmission of caprine arthritis-encephalitis virus infection. Small Ruminant Res., v.10, p.251-262, 1993.
  • EXTRAMIANA, B.; GONZALES, L.; JUSTE, R.A. Evaluation of a PCR technique for the detection of Maedi-Visna proviral DNA in blood, milk and tissue samples of naturally infected sheep. Small Ruminant Res., v.44, p.109-118, 2002.
  • GRIMBERG, J.; NAWOSCHIK, S.; BELLUSCIO, L. et al. A simple and eficiente non-organic procedure for the isolation ofgenomic DNA from blood. Nucleic Acids Res., v.17, p.8390, 1989.
  • GUFLER, H.; GASTEINER, J.; LOMBARDO, D.; STIFTER, E. et al. Serological study of small ruminant lentivirus ingoats in Italy. Small Ruminant Res., v.73, p.169-173, 2007.
  • INTERNATIONAL Committee on Taxonomy of Viruses, 2017. Available in: <http://ictvonline.org/virusTaxonomy.asp>. Accessed in: 16 Jan. 2019.
    » http://ictvonline.org/virusTaxonomy.asp
  • KARANIKOLAOU, K.; ANGELOPOULOU, K.; PAPANASTASOPOULOU, M. et al. Detection of small ruminant lentiviruses by PCR and serology tests in field samples of animals from greece. Small Ruminant Res., v.58, p.181-187, 2005.
  • KONISHI, M.; NAGURA, Y.; TAKEI, N.; FUJITA, M. Combined eradication strategy for CAE in a dairygoat farm in Japan. Small Ruminant Res., v.99, p.65-71, 2011.
  • LARA, M.C.C.S.H. Artrite-encefalite dos caprinos (CAE). 2008. Available in: http://www.infobibos.com/Artigos/2008_4/artrite/index.htm Accessed in: 16 Feb. 2015.
    » http://www.infobibos.com/Artigos/2008_4/artrite/index.htm
  • PÉREZ, M.; MUÑOZ, J.A.; BIESCAS, E. et al. Successful Visna/maedi controla highly infected ovine dairy flock using serologic segregation and management strategies. Prev. Vet. Med., v.112, p.423-427, 2013.
  • PETERHANS, E.; GREENLAND, T.; BADIOLA, J. et al. Routes of transmission and consequences of small ruminant lentiviruses (SRLVs) infection and eradication schemes. Vet. Res., v.35, p.257-274, 2004.
  • PINHEIRO, R.R.; ANDRIOLI, A.; SIDER, L.H. et al. Lentiviroses em pequenos ruminantes: principais métodos de diagnóstico. Sobral: Embrapa Caprinos e Ovinos, 2012. 42p. (Comunicado Técnico, n.107).
  • PINHEIRO, R.R.; BRITO, R.L.L.; RODRIGUES, A.S. et al. Protocolo de immunoblotting para diagnóstico da Artrite-encefalite caprina. Sobral: Embrapa Caprinos e Ovinos, 2011. 4p. (Comunicado Técnico, n.122).
  • PINHEIRO, R.R.; CHAGAS, A.C.S.; ANDRIOLI, A.; ALVES, F.S.F. Viroses de pequenos ruminantes. Sobral: Embrapa Caprinos, 2003. 30p. (Documentos, n.46)
  • RIMSTAD, E.; EAST, N.E.; TORTEN, M. et al. Delayed seroconversion following naturally acquired caprine arthritis-encephalitis virus infection ingoats. Am. J. Vet. Res., v.54, p.1858-1862, 1993.
  • RODRIGUES, A.S.; PINHEIRO, R.R.; BRITO, R.L.L. et al. Avaliação de um controle estratégico da artrite encefalite caprina em rebanho caprino leiteiro. Arq. Bras. Med. Vet. Zootec., v.70, p.139-146, 2018.
  • SOUZA, K.C.; ANDRIOLI, A.; SIDER, L.H. et al. Detecção de sequências do DNA proviral do vírus da Artrite Encefalite Caprina em saliva. Acta Sci. Vet., v.43, p.1266, 2015.
  • SOUZA, T.S. Transmissão interespécies de lentivírus de caprinos para ovinos. 2014. 123f. Tese (Doutorado em Ciência Animal nos Trópicos) - Universidade Federal da Bahia, Salvador, BA.
  • TAVELLA, A.; BETTINI, A.; CEOL, M. et al. Achievements of an eradication programme against caprine arthritis encephalitis virus in South Tyrol, Italy. Vet. Rec., v.182, p.1-5, 2018.
  • WAGTER, L.H.A.; JANSEN, A.; BLEUMINK-PLUYM, N.M.C. et al. PCR detection of lentiviralgag segment DNA in the white blood cells of sheep and goats. Vet. Res. Commun., v.22, p.355-362, 1998.
  • ZANONI, R.; PAULI, L.T.; PETERHANS, E. Detection of caprine arthritis-encephalitis- and maedi-visna viruses using the polymerase chain reaction. Experientia, v.46, p.316-319, 1990.
  • ZANONI, R.G.; CORDANO, P.; NAUTA, I.M.; PETERHANS, E. PCR for the detection of lentiviruses from small ruminants. Schweiz. Arch. Tierheilkd., v.138, p.93-98, 1996.
  • ZHANG, Z.; WATT, N.J.; HOPKINS, J. et al. Quantitative analysis of maedi-visna virus DNA load in peripheral blood monocytes and alveolar macrophages. J. Virol. Methods, v.86, p.13-20, 2000.

Datas de Publicação

  • Publicação nesta coleção
    27 Nov 2020
  • Data do Fascículo
    Nov-Dec 2020

Histórico

  • Recebido
    05 Set 2019
  • Aceito
    04 Jun 2020
Universidade Federal de Minas Gerais, Escola de Veterinária Caixa Postal 567, 30123-970 Belo Horizonte MG - Brazil, Tel.: (55 31) 3409-2041, Tel.: (55 31) 3409-2042 - Belo Horizonte - MG - Brazil
E-mail: abmvz.artigo@gmail.com