Staphylococcus spp. and mecA gene in vaginal swabs of female dogs from Brazilian border regionsABSTRACT
The aim of this work was to investigate the presence of Staphylococcus spp. and the mecA gene in vaginal swabs of female dogs from border regions. Biological samples of the vaginal swab were collected from 60 healthy bitches residing in a shelter of a non-governmental organization in the municipalities of Umuarama (Paraná, Brazil) and Dionísio Cerqueira (Santa Catarina, Brazil). The samples were sown to isolate Staphylococcus spp. Antimicrobial sensitivity tests were performed using the agar diffusion disc methodology and the polymerase chain reaction to identify Staphylococcus aureus and search for the mecA gene. It was possible to isolate 29 (61.70%) Staphylococcus spp. Of these, 20 (68.96%) were identified as positive coagulase and nine (31.04%) as negative coagulase. The antimicrobials that showed the highest resistance index were tetracycline, tobramycin, sulfazotrim and cefoxitin and oxacillin. No sample was detected as Staphylococcus aureus and only one isolate was positive for the presence of the mecA gene. It can be concluded that healthy bitches have Staphylococcus spp. resistant to methicillin, mediated by the mecA gene, in addition to this unique health problem, Staphylococcus bacteria can compromise the reproductive efficiency of bitches and lead to the death of newborn animals.
Keywords:
bacteria; bacterial resistance; reproductive bacterial disorders; stray dogs
RESUMO
O objetivo deste trabalho foi investigar a presença de Staphylococcus spp. e do gene mecA em swabs vaginais de cadelas provenientes de regiões de fronteira. Foram coletadas amostras biológicas de swab vaginal de 60 cadelas saudáveis, residentes em abrigos de uma organização não governamental situados nos municípios de Umuarama (Paraná, Brasil) e Dionísio Cerqueira (Santa Catarina, Brasil). As amostras foram semeadas para o isolamento de Staphylococcus spp. Testes de sensibilidade a antimicrobianos foram realizados pelo método de difusão em discos em ágar, além da reação em cadeia da polimerase para a identificação de Staphylococcus aureus e a detecção do gene mecA. Foi possível isolar 29 (61,70%) Staphylococcus spp. Desses, 20 (68,96%) foram identificados como coagulase-positivos e nove (31,04%) como coagulase-negativos. Os antimicrobianos que apresentaram maior índice de resistência foram tetraciclina, tobramicina, sulfazotrim, cefoxitina e oxacilina. Nenhuma amostra foi identificada como Staphylococcus aureus, e apenas um isolado foi positivo para o gene mecA. Conclui-se que cadelas saudáveis podem carrear Staphylococcus spp. resistentes à meticilina, mediada pelo gene mecA. Além de representarem um problema de saúde única, bactérias do gênero Staphylococcus podem comprometer a eficiência reprodutiva das cadelas e levar à morte de neonatos.
Palavras-chave:
bactérias; cães errantes; distúrbios bacterianos reprodutivos; resistência bacteriana
INTRODUCTION
The occurrence of Staphylococcus spp. in domestic animals is widespread, and the genus is often regarded as a commensal component of the healthy microbiota, predominantly colonizing mucosal surfaces (Santos et al., 2022; Nocera et al., 2025).
Antimicrobial resistance in Staphylococcus spp. represents a significant challenge, as controlling the dissemination of resistant strains becomes increasingly difficult. Therefore, combining species identification with the determination of antimicrobial resistance profiles provides essential tools for more accurate diagnoses, enabling the assessment of the prevalence of these staphylococci as etiologic agents of infection and supporting the development of effective strategies to control the spread of resistant isolates (Coelho et al., 2007).
The presence of multidrug-resistant Staphylococcus spp. in the microbiota of healthy animals may contribute to treatment inefficacy, an increase in the occurrence of diseases, and secondary infections (Santos et al., 2022; Nocera et al., 2025). Among the potential issues are reproductive disorders in female dogs (Golińska et al., 2021; Jagódka et al., 2023; Leps et al., 2024).
Reproductive disorders in female dogs encompass a broad spectrum of conditions that interfere with normal fertility, gestation, parturition, or neonatal survival. These disorders may arise from hormonal imbalances, congenital abnormalities, or infectious agents capable of disrupting reproductive physiology. Many infections can contribute to the development of reproductive disturbances in canines. Microorganisms may directly impair fetal development by crossing the placental barrier, and they may also compromise pregnancy through the release of placental toxins and the induction of inflammatory responses, ultimately disrupting gestational progression and fetal viability (Beaudu-Lange et al., 2021; Golińska et al., 2021; Jagódka et al., 2023; Leps et al., 2024).
Due to its reproductive importance, the objective of this work was to investigate the presence of Staphylococcus spp. and the mecA gene in vaginal swabs of female dogs from border regions.
ETHICAL ASPECTS
This study was approved by the Research Ethics Committee Involving Animal Experimentation (CEPEEA) of the Universidade Paranaense (UNIPAR) under protocol 37765/2020.
MATERIAL AND METHODS
The study was carried out in the municipalities, which belong to the Brazilian border region, Umuarama, State of Paraná, located in the northwest of the state, at a distance of 110 km from Paraguay, and Dionísio Cerqueira, located on the border of the far northwest of Santa Catarina with Paraná and 5.8 km from the border with Argentina.
Biological samples were collected from November 2019 and January 2020 from female dogs aged between 6 months to 15 years and weight over 2kg, in addition to not showing any clinical signs that indicated a specific disease at the time of collection. These female dogs were collected by a non-governmental organization (NGO) that protects animals in the state of Paraná (PR) and by different residences of animal protectors in Santa Catarina (SC) that house rescued animals. In both places the practice of donating these animals is frequent.
For the collection of the vaginal swab of the female dogs, they were contained by the tutors, and, when necessary, a muzzle was used. Initially, there was a previous external cleaning with paper towels, and a sterile swab containing AIMES + activated carbon (CopanTransystem ©, Italy) was used, which was introduced into the vagina by performing rotational movements to collect biological material.
The vaginal swabs were packed in polystyrene boxes with recyclable ice and sent immediately to the Laboratory of Preventive Veterinary Medicine and Public Health of the Postgraduate Program in Animal Science with an Emphasis on Bioactive Products of the Universidade Paranaense (UNIPAR) for the accomplishment of the laboratory techniques.
The swabs were introduced individually into tubes containing 3mL of Brain Heart Infusion (BHI) medium and incubated in a greenhouse at 37°C for 24 hours. After this period, the cultures obtained were sown by streaking on plates containing Mannitol Salt Agar and incubated at 37°C for 24 hours to isolate gram-positive aerobic bacteria. The predominant colonies on each plate were isolated and grown in a BHI medium, incubated at 37°C for 24 hours, and then stored in 10% glycerol at -20°C.
Each isolate was subjected to analysis of macroscopic characteristics, Gram stain, and biochemical tests (Koneman and Allen, 2008). Gram-positive catalase-positive cocci were subjected to coagulase testing for classification into coagulase-positive Staphylococcus or negative coagulase Staphylococcus.
The susceptibility tests to antimicrobials were performed using the agar diffusion disc methodology according to the criteria established by the Clinical Laboratory and Standards Institute (Clinical…, 2018). Isolated colonies were seeded in the BHI medium for overnight growth. On the day of the experiments, the bacterial inoculum was standardized according to the 0.5 McFarland standard, and the bacterial suspension was inoculated into plates containing Mueller-Hinton agar with the aid of a swab. Subsequently, the disks impregnated with antimicrobials were placed and the plates incubated (37°C/18-24h). The inhibition halos were measured (mm) and the results obtained were recorded.
For Gram-positive bacteria the following antimicrobials were tested: Amoxicillin (10µg), amikacin (10µg), ampicillin (10µg), cefotaxime (30µg), cefoxitin (30µg), ceftiofur (30µg), ceftriaxone (30µg), ciprofloxacin (05µg), chloramphenicol (30µg), enrofloxacin (05µg), gentamycin (10µg), imipenem (10µg), meropenem (10µg), sulfazotrim (25µg), tetracycline (30µg), tobramycin (10µg), and oxacillin (01µg).
The polymerase chain reaction (PCR) was performed for coagulase-positive Staphylococcus (CPS) samples to verify which of these isolates were Staphylococcus aureus. The DNA was extracted with the Purelink Genomic DNA Kit (Invitrogen, Carlsbad, California, USA) according to the information of the manufacturer and the reactions were performed using the Sa442-1 primer (5’-AAT CTT TGT CGG TAC ACGATA TTC TTC ACG-3’) and the Sa442-2 primer (5’-CGT AAT GAGATT TCA GTA GAT AAT ACA ACA-3') following the methodology of (Martineau et al., 1998). For DNA amplification, the Applied Biosystems thermocycler was used, model Veriti™ 96-Well Thermal Cycler.
The amplification of the products was visualized by electrophoresis on a 2% agarose gel stained with GelRed (Uniscience, Osasco, São Paulo, BR) using a 100 bp molecular marker and the products were visualized as a single band of 241bp.
The DNA of Staphylococcus spp. isolates classified as resistant and with intermediate resistance to cefoxitin and oxacillin were extracted using the Purelink Genomic DNA Kit (Invitrogen, Carlsbad, California, USA) according to the information of the manufacturer and the PCR reactions were performed using Platinum Supermix (Invitrogen, Carlsbad, California, USA); primer mecA1 (AAAATCGATGGTAAAGGTTGG) and mecA2 (AGTTCTGCAGTACCGGATTTG) at 5 µM; Isolate DNA and free nuclease water totaling 25 µL. For the amplification, the thermocycler of the brand Thermo, model Px2 Thermal Cycler was used under the parameters described by (Murakami et al., 1991).
The amplification of the products was visualized by electrophoresis in 2% agarose gel stained with GelRed (Uniscience, Osasco, São Paulo, BR), and the products were visualized as a single band of 533 bp.
RESULTS
Samples of vaginal swabs were collected from 60 female dogs, 30 from the municipality of Umuarama (PR), 30 from the municipality of Dionísio Cerqueira (SC), Mixed-Breed (MB), with ages ranging from six months to 15 years.
It was possible to isolate 47 samples from 35 female dogs (58.33%) characterized as gram-positive, however, only 29 (61.70%) were identified as Staphylococcus catalase positive. From these, 20 (68.96%) were identified as positive coagulase, and nine (31.04%) as negative coagulase.
Of the 29 samples identified as Staphylococcus spp., 21 (72.42%) were from the municipality of Umuarama (PR) and eight (27.58%) from the municipality of Dionísio Cerqueira (SC) (Table 1).
Resistance profile of Staphylococcus spp. isolates from vaginal swabs of 21 female dogs from Umuarama (PR) and eight from Dionísio Cerqueira (SC), both considered border regions. The animals were aged from six months to 15 years, weighed over 2 kg, and showed no clinical signs indicative of any specific disease at the time of collection, Umuarama, 2026
From the municipality of Umuarama (PR), the antimicrobials that showed the highest resistance index were tetracycline (71.43%), amoxicillin (47.62%), and tobramycin and oxacillin (both with 42.86%). On the other hand, the antimicrobials that showed the highest levels of sensitivity were imipenem and meropenem (both with 95.24%), amikacin, ceftiofur, and ceftriaxone (both with 90.48%).
In turn, in the municipality of Dionísio Cerqueira (SC), the antimicrobials that showed the highest resistance index were tobramycin (62.50%), sulfazotrim (sulfamethoxazole/trimethoprim) (50.00%), and cefoxitin and oxacillin (both with 37.50%). The antimicrobials that showed the highest levels of sensitivity were amikacin and chloramphenicol (both with 100%), ceftriaxone, ciprofloxacin, enrofloxacin, imipenem, and meropenem (both with 87.50%).
No sample was identified as Staphylococcus aureus.
In nine samples, simultaneous resistance to the antimicrobials cefoxitin and oxacillin was found, six from Umuarama (PR) and three from Dionísio Cerqueira (SC) and from these samples in only one (11.11%) the DNA was amplified by 533 bp, confirming the presence of the mecA gene.
DISCUSSION
Often, pets, dogs and cats mainly, are considered family members and this close contact can bring a potential public health problem with the sharing of resistant staph species that can be sources of different infections (Santos et al., 2022). In a study by Ishihara et al. (2014), in 71 veterinary clinics in the city of Hokkaido, Japan, the prevalence of methicillin-resistant Staphylococcus aureus was 22.9% among veterinarians, 10% among veterinary technicians, and 2% among those responsible for animals and from the results from this study, we can infer that it is likely that people and animals can share the same profile of bacterial resistance.
The genus Staphylococcus spp. is commonly reported on the skin, oral and nasal mucosa of healthy carriers and is also associated with infections that affect both humans and animals (Peton and Le Loir, 2014). In dogs, the presence of this microorganism present in the vaginal bacterial flora of healthy female has been described, as the study by Carneiro et al. (2005), who detected Staphylococcus spp. as the most prevalent microorganism (76.19%), which corroborates the results of this study, where Staphylococcus spp. was detected in 61.70% of the samples.
When evaluating the vaginal and uterine bacterial microbiota of bitches with pyometra, Carneiro et al. (2005), observed that in 71.42% of the cases Staphylococcus spp. was the most commonly found microorganism, followed by Escherichia coli (71.42%) and Streptococcus spp. (57.14%). These results show that Staphylococcus spp., besides being present in the vaginal bacterial flora of healthy female dogs, is also present in females with pyometra, possibly being the causative agent of this infection.
In the female reproductive system, a staphylococcal infection can severely affect all reproductive phases, fertilization, conception, pregnancy, childbirth, as well as postpartum. Staphylococcus spp. infections are highly associated with infertility outcomes, pregnancy loss in women and greatly increase the risk of sexually transmitted infections (Dutta et al., 2020), a situation that can be extrapolated most likely to females of different animal species.
It is important to know that the immune/inflammatory response can disrupt normal reproductive functioning in animals and humans, the hypothalamic-pituitary-gonadal axis is the main endocrine regulating axis of reproduction and bacterial pathogenic factors induce the release of cytokines and other pro-inflammatory mediators, which may affect the hypothalamus in the release of the gonadotropin-regulating hormone - GnRH (Dutta et al., 2020). Infection with Staphylococcus spp., whether local or systemic, can induce potent immune/inflammatory actions that can have significant consequences on the hypothalamic-pituitary-gonadal axis, on ovarian physiology, implantation, and on placental and fetal development (Spandorfer et al., 2001).
Bacterial diseases are the second most common cause of neonatal diseases and losses in dogs, bacterial colonization can occur in the first days of life and become commensal or have mild or clinically not apparent symptoms (Münnich and Küchenmeister (2014). Rota et al. (2011), isolated and identified, through molecular biology, Staphylococcus pseudointermedius in 13 of 27 dead offspring. In seven puppies, Staphylococcus pseudointermedius was the only bacterium identified and the causative agent of septicemia, being isolated in the milk of the mother of six dead puppies and identified in the vaginal flora of the mother of a dead puppy.
In humans, the main risk factors for infection in newborns include characteristics such as birth weight, gestational age, degree of immune development, duration of hospitalization, use of invasive procedures, and exposure to the hospital environment and the multidisciplinary team. There is still the possibility that many newborns will be colonized and infected with methicillin-resistant strains, which represents a clinically serious problem because the antimicrobials used to control infections have become ineffective (Riboli et al., 2017).
The irrational use of antimicrobials is a current problem, especially in developing countries where there is the sale of antimicrobials without retaining a prescription (Bennadi, 2014), which can promote the development of microbial resistance with serious implications for One Health (Beyene and Tesega, 2014). This statement can be confirmed by the study Zielke et al. (2018), carried out at Hospital de Clínicas Veterinárias of Universidade de Pelotas (HCV/UFPEL) in which 11% of dogs were using antimicrobials without the proper prescription from a veterinarian.
Among the antimicrobials tested in this study, those that showed the highest resistance index in the municipality of Umuarama (PR) were tetracycline (71.43%), amoxicillin (47.62%), and tobramycin and oxacillin (both with 42.86%). In Dionísio Cerqueira (SC), the antimicrobials that showed the highest resistance index were tobramycin (62.50%), sulfazotrim (Sulfamethoxazole/Trimethoprim) (50.00%), and cefoxitin and oxacillin (both with 37.50%). Thus, the resistance profile detected in this study probably indicates the possible clinical prescription of the drugs described above by the veterinarians in the respective municipalities or even their incorrect use. In either situation, the importance of requesting and subsequently performing the antibiogram before the therapeutic institution is evident, since antimicrobials, when used correctly, prevent multi-resistant bacteria from multiplying and spreading, in addition to being more effective during the treatment of the animal.
A situation that calls our attention regarding One Health is the molecular confirmation of 22.22% for the mecA gene, which characterizes resistance to methicillin and/or oxacillin, a situation that is phenotypically observed in the two municipalities of this study. The importance of this result is that the presence of bacteria with potential for multidrug resistance that could be transmitted horizontally to men and animals was found (Rota et al., 2011) and the limitation of the use of the respective antimicrobials can affect the efficiency of the therapy instituted for the animal providing greater damage to its health.
The biological samples of this work are from two municipalities located in different border regions and these regions are places that have characteristics that favor the dissemination of antimicrobial resistance since the traffic of men and different species of animals are constant and high, often providing unnoticed transmissions of microorganisms from one place to another and also between different species of animals, which most likely will make it possible to alter the susceptibility patterns to specific antimicrobials and may be exposed and disseminated to other locations.
CONCLUSION
In view of the results presented in this work, it can be concluded that healthy female dogs have methicillin-resistant Staphylococcus spp., mediated by the mecA gene and that the close contact between humans and animals contributes to the horizontal transmission of multiresistant bacteria. In addition to this public health problem, bacteria of the genus Staphylococcus can compromise the reproductive efficiency of animals and lead to the death of newborn animals. Future studies are essential to identify the other species of Staphylococcus involved in these samples to elucidate the epidemiology of these microorganisms.
ACKNOWLEDGMENTS
To UNIPAR, to the National Council for Scientific and Technological Development (CNPq) CP 12/2017 - Research Productivity Grants and the Araucária Foundation (CP 10/2018 Pro-Equipment Program - Protocol: 51176.543.48325.29102018 and CP 09/2016 Institutional Program of Basic and Applied Research-Protocol: 47661.491.48325.12122016) and for the financing granted to this research, to CAPES for the concession of the PROSUP school fee and PNPD scholarship.
REFERENCES
- BEAUDU-LANGE, C.; LACAZE, A.; CHASTANT-MAILLARD, S. et al Prevalence of reproductive disorders including mammary tumors and associated mortality in female dogs. Vet. Sci., v.8, p.184, 2021.
- BENNADI, D. Self-medication: a current challenge. J. Basic Clin. Pharm., v.5, p.19, 2014.
- BEYENE, T.; TESEGA, B. Rational veterinary drug use: its significance in public health. J. Vet. Med. Anim. Health, v.6, p.302-308, 2014.
- CARNEIRO, A.P.; TONIOLLO, G.H.; SCHOCKEN-ITURRINO, R.P. Avaliação microbiológica da flora vaginal e do corpo uterino de cadelas (Canis familiaris) submetidas a ovariossalpingohisterectomia. Ars Vet., v.21, p.361-367, 2005.
- CLINICAL AND LABORATORY STANDARDS INSTITUTE. Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals 4.ed. Wayne: CLSI, 2018. 134p.
- COELHO, S.M.O.; MORAES, R.A.M.; SOARES, L.C. et al Mapeamento do perfil de resistência e detecção do gene mecA em Staphylococcus aureus e Staphylococcus intermedius oxacilina-resistentes isolados de espécies humanas e animais. Ciênc. Rural, v.37, p.195-200, 2007.
- DUTTA, S.; SENGUPTA, P.; IZUKA, E. et al Staphylococcal infections and infertility: mechanisms and management. Mol. Cell. Biochem., v.474,p.473-488, 2020.
- GOLIŃSKA, E.; TOMASZEWSKA, E.; RYCHLIK, A. et al The vaginal microflora changes in various stages of the estrous cycle of healthy female dogs and the ones with genital tract infections. BMC Vet. Res., v.17, p.8, 2021.
- ISHIHARA, K.; SAITO, M.; SHIMOKUBO, N. et al Methicillin-resistant Staphylococcus aureus carriage among veterinary staff and dogs in private veterinary clinics in Hokkaido, Japan. Microbiol. Immun., v.58, p.149-154, 2014.
- JAGÓDKA, D.; KOWALSKA, M.; WLAZŁAK, K. et al Vaginal aerobic bacteria of healthy bitches and those with fertility problems. Pol. J. Vet. Sci., v.26, p.733-739, 2023.
- KONEMAN, E.W.; ALLEN, S.D. Diagnóstico Microbiológico: texto e atlas em cores. Buenos Aires: Médica Panamericana, 2008. 1696p.
- LEPS, A.S.; SMITH, K.; JONES, P. et al The canine vaginal flora: a large-cohort retrospective study. Vet. Sci., v.11, p.55, 2024.
- MARTINEAU, F.; PICARD, F.J.; ROY, P.H. et al Species-specific and ubiquitous-DNA-based assays for rapid identification of Staphylococcus aureus J. Clin. Microbiol., v.36, p.618-623, 1998.
- MÜNNICH, A.; KÜCHENMEISTER, U. Causes, diagnosis, and therapy of common diseases in neonatal puppies in the first days of life. Reprod. Domest. Anim., v.49, p.64-74, 2014.
- MURAKAMI, K.; MINAMIDE, W.; WADA, K. et al Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. J. Clin. Microbiol., v.29, p.2240-2244, 1991.
- NOCERA, F.P.; DE MARTINO, L.; CORTESE, L. et al Occurrence and antimicrobial resistance profiles of Staphylococcus spp. strains isolated from healthy stray dogs. Vet. Med. Sci., v.11, p.e70599, 2025.
- PETON, V.; LE LOIR, Y. Staphylococcus aureus in veterinary medicine. Infect. Genet. Evol., v.21, p.602-615, 2014.
- RIBOLI, D.F.M.; BARBOSA, T.A.; CUNHA, M.L.R.S. Staphylococcus aureus infections in newborns. In: CUNHA, M.L.R.S. (Ed.). Staphylococcus aureus: infections, treatment and risk assessment. New York: Nova Biomedical, 2017. 135p.
- ROTA, A.; MILANI, C.; DRIGO, I. et al Isolation of methicillin-resistant Staphylococcus pseudintermedius from breeding dogs. Theriogenology, v.75, p.115-121, 2011.
- SANTOS, I.C.; BARBOSA, L.N.; SILVA, G.R. et al Pet dogs as reservoir of oxacillin and vancomycin-resistant Staphylococcus spp. Res. Vet. Sci., v.143, p.28-32, 2022.
- SPANDORFER, S.D.; NEUER, A.; GIRALDO, P.C. et al Relationship of abnormal vaginal flora, proinflammatory cytokines and idiopathic infertility in women undergoing IVF. J. Reprod. Med., v.46, p.806-810, 2001.
- ZIELKE, M.; CARVALHO, L.F.; SALAME, J.P. et al Avaliação do uso de fármacos em animais de companhia sem orientação profissional. Sci. Anim. Health, v.6, p.29-46, 2018.
