Effects of cannabis oil in oxidative stress and cytokine gene expression in canine atopic dermatitis

[Efeitos do óleo de cannabis no estresse oxidativo e expressão gênica de citocinas em cães com dermatite atópica]

ABSTRACT

Canine atopic dermatitis (CAD) affects up to 15% of the canine population and is highly relevant in small animal clinical practice. The endocannabinoid system (ECS) plays a key role in skin homeostasis, and its dysregulation has been implicated in the pathogenesis of certain dermatopathies. Considering the challenges of CAD treatment and emerging evidence of Cannabis benefits, this study aimed to evaluate the anti-inflammatory effect of broad-spectrum cannabidiol (CBD)-rich Cannabis oil in dogs with CAD. Dogs were randomly assigned to a treatment group receiving oral Cannabis oil or to a control group receiving olive oil for 60 days. The study assessed treatment efficacy by measuring mRNA expression of interleukins IL-6, IL-10, and IL-31, as well as oxidative stress markers in blood samples collected before and after treatment. Despite the theoretical background supporting cannabinoid use in dermatology, no statistically significant differences were found between the groups. Thus, oral administration of broad-spectrum CBD-rich Cannabis oil at 2.5mg/kg twice daily did not effectively reduce the gene expression of inflammatory and pruritogenic interleukins, nor did it enhance the expression of anti-inflammatory IL-10 or oxidative stress markers, compared to placebo. Further research is needed to clarify the potential role of cannabinoids in CAD management.

Keywords:
CAD; CBD; interleukin; oxidative stress; veterinary dermatology

RESUMO

A DAC está presente em quase 15% da população canina, sendo importante na clínica de pequenos animais. O sistema endocanabinoide (SEC) na pele revela uma influência direta na homeostase, e sua desregulação contribui para certas dermatopatias. Devido às dificuldades de tratamento e às evidências científicas sobre o benefício da cannabis, este estudo objetivou o efeito anti-inflamatório do óleo de cannabis no tratamento de DAC. Para isso, cães com DAC foram divididos em dois grupos: o grupo tratado com óleo de cannabis de amplo espectro rico em canabidiol (CBD) [óleo de cannabis via oral] e o grupo controle [azeite de oliva via oral] durante 60 dias. A avaliação de eficácia foi baseada na mensuração de RNAm de interleucinas (IL) 6, 10 e 31 e perfil de estresse oxidativo avaliados no sangue no pré- e pós-tratamento. Apesar do embasamento teórico, não houve resultados significativos obtidos entre os grupos utilizados. Dessa forma, conclui-se que a administração oral de óleo de cannabis amplo espectro, rico em CBD, na dosagem de 2,5mg/kg, duas vezes ao dia, não foi eficiente para redução da expressão gênica das IL inflamatória e pruriginosa, nem para o aumento da IL anti-inflamatória e do perfil do estresse oxidativo, quando comparado ao placebo.

Palavras-chave:
CBD; DAC; dermatologia veterinária; estresse oxidativo; interleucinas

INTRODUCTION

Canine atopic dermatitis (CAD) is a genetically determined syndrome characterized by chronic itching and inflammation (Gugliandolo et al., 2020; Hensel et al., 2015). Its pathogenesis is multifactorial, and although not fully understood, it is known to involve genetic predisposition, immune system alterations with skin inflammation, and defects in the skin barrier (Gugliandolo et al., 2020). Therefore, multimodal therapy is necessary to manage this disease, aiming to improve the skin barrier, modulate the immune system, and prevent allergies (Olivry et al., 2010).

The ECS has immunomodulatory actions, and its dysregulation is associated with various chronic inflammations (ANIL et al., 2022). The ECS is heavily involved in skin homeostasis, barrier formation, and regeneration, while its dysregulation favors the occurrence of diseases and disorders, including atopic dermatitis (Tóth et al., 2019). Current literature provides evidence that cannabinoids and cannabinoid-related receptors in specialized skin cells manipulate inflammation and suggest a new approach for treatment by regulating different mechanisms of atopic dermatitis (Chiocchetti et al., 2022).

Activation of Th2 cells leads to the production of interleukin (IL-31), which modulates keratinocyte differentiation, suppresses filaggrin expression, and enhances the expression of pro-inflammatory cytokines. This results in pruritus, mediated by receptors on sensory nerve fibers and diverse immune cells, including macrophages (Tamamoto-Mochizuke and Olivry, 2021). In canine atopic dermatitis lesions, IL-31 mRNA levels are elevated (Martel et al., 2017). The persistence of inflammation via Th2 and the dysfunction of the skin barrier contribute to chronic inflammation and the overproduction of reactive oxygen species (ROS). Oxidative stress will amplify the inflammatory response by regulating genes, encoding more pro-inflammatory cytokines (Bertino et al., 2020). To maintain the levels of RS under control, the enzyme superoxide dismutase (SOD) converts O₂ into H₂O₂, which is then converted into water, a reaction catalyzed by catalase (CAT) and/or glutathione (GSH) (Bertino et al., 2020). Lipid oxidation and thiol groups can also be altered during CAD activating intracellular mechanisms. Some evidence suggest cannabidiol can act in oxidative signaling due to free radical scavenging capacity (Pereira et al., 2021).

CB2 receptors are predominantly expressed in the immune system. In this context, the ECS is involved in regulating several transcription factors within these cells, influencing the expression of various immune-related proteins, including surface receptors, and acting as a general modulator of the immune response (Massi et al., 2006; Tanasescu and Constantinescu, 2023). The endocannabinoid anandamide (AEA) increases IL-10 production via CB2 receptors through different pathways, such as MAPK, and inhibits the ability of NF-κB to reach transcription sites in the DNA. At the same time, the phytocannabinoid CBD reduces oxidative conditions, preventing the formation of superoxide radicals (Rajesh et al., 2010) and also has been shown to increase mRNA levels of antioxidant enzymes (Pereira et al., 2021), mainly through interactions with receptors.

Given the strong relationship between the endocannabinoid system and skin homeostasis, this study aimed to evaluate the efficacy of high-CBD full-spectrum cannabis oil in dogs with atopic dermatitis by measuring concentrations of pro- and anti-inflammatory cytokines, and oxidative stress markers and more studies are recommended.

ETHICAL ASPECTS

This study was approved by the Ethics Committee for Animal Use and Experimentation of the Federal University of Santa Maria (CEUA/UFSM) (number 8656301121 - ID 003662) and was conducted in accordance with the ethical principles of the National Council for Animal Experimentation Control (CONCEA).

MATERIAL AND METHODS

We selected dogs diagnosed with atopic dermatitis who had flea control and had previously undergone at least four to six weeks of hypoallergenic diet without the disappearance of clinical signs, according to Favrot's criteria and conventional treatment for at least 30 days (Hensel et al., 2015).

The inclusion criteria included: a confirmed AD diagnosis, no concurrent diseases, medications such as oclacitinib and cyclosporine were discontinued three months before the start, and corticosteroids or other systemic treatment 30 days prior. Exclusion criteria encompassed: irregular flea control, presence of dental calculus, moderate-to-severe gingivitis, or any other concurrent disease. All dogs were not in a crisis or presenting with secondary infections. No specific CADESI values were required for inclusion or exclusion. Furthermore, there was no standardization regarding the use of shampoo for topical treatment or the type of diet, to reflect typical clinical practice.

The fourteen animals (table 1) were randomly assigned to Group 1 (G1), the treatment group with Cannabis oil, or Group 2 (G2), the control group treated with olive oil, both orally. The treatment oil used was a high cannabidiol (CBD) full-spectrum cannabis oil (50mg/mL) in a ratio of 21:1 (CBD:THC) from the Association of Medicinal Cannabis Patients (AMA+ME). The treatment consisted of administering 2.5mg/kg twice daily for 60 days. Evaluations were conducted before (T0) and after (T60) treatment. The frequency of baths, shampoos, and diets already used, whether therapeutic or not, were kept unchanged. The method of oil administration depended on the animal's acceptance of the cannabis oil, in general, the animals received the Cannabis directly into the mouth or mixed with a teaspoon of food (kibble and/or fruit).

Table 1
Demographic and clinical characteristics of dogs (n=14) diagnosed with canine atopic dermatitis (cAD), including sex, age, breed (Shih-tzu, Lhasa Apso, Dachshund, and Golden Retriever), and duration of disease. Animals were allocated into two groups: control group (olive oil, n=7) and cannabis oil-treated group (CBD-rich full-spectrum oil, n=7)

Group	Sex	Age	Breed	Age of disease
Control
Animal 1	Male	12 years	Shih-tzu	6 months
Animal 2	Female	1 year	Lhasa apso	9 months
Animal 3	Female	5 years	Shih-tzu	1 year
Animal 4	Female	1 year	Dachshund	10 months
Animal 5	Female	11 years	Shih-tzu	1 year
Animal 6	Male	7 years	Shih-tzu	3 years
Animal 7	Male	6 years	Dachshund	3 years
CBD
Animal 1	Female	8 years	Shih-tzu	6 months
Animal 2	Female	10 years	Shih-tzu	3 years
Animal 3	Male	6 years	Golden Retriever	1 year
Animal 4	Female	7 years	Shih-tzu	3 years
Animal 5	Female	8 years	Lhasa apso	2 years
Animal 6	Male	9 years	Shih-tzu	1 year
Animal 7	Male	11 years	Shih-tzu	3 years

To check the dermatological condition of each patient, refer to MARIGA et al. (2023) present CADESI-04 and itching degree (PVAS) before and after treatment.

Oxidative stress consists of an imbalance between oxidant and antioxidant species. In this study, oxidative stress markers such as GST, CAT, SOD, TBARS and TSH were analyzed in whole blood or serum (Fig. 1) to evaluate whether cannabidiol modulate oxidative stress in atopic dermatitis.

Figure 1
Distribution of oxidative stress markers (GST, TBARS, TSH, SOD, and CAT) in dogs (n=14) diagnosed with canine atopic dermatitis (CAD), including breeds such as Shih-tzu, Lhasa Apso, Dachshund, and Golden Retriever, comparing the cannabis oil-treated group (n=7) and the control group (n=7, olive oil). Measurements were performed before (T0) and after 60 days of treatment (T60). Values are expressed as mean ± SEM. No statistically significant differences were observed between groups for any oxidative stress marker (P>0.05). (GST = Glutathione S-transferase; TBARS = thiobarbituric acid-reactive substances; TSH = total thiol groups; SOD = superoxide dismutase; CAT = catalase).

GST, TBARS and TSH used serum, while CAT and SOD used blood. CDNB: 1-chloro 2, 4 dinitrobenzene, MDA: malondialdehyde, SH: thiol group, SOD: superoxide dismutase, CAT: catalase

Glutathione S-transferase (GST) constitutes a superfamily of enzymes that plays a role in the detoxification of endogenous and exogenous compounds that use GSH as a co-substrate (Huber et al., 2008). For the glutathione S-transferase (GST), in a 96-well plate, 20uL of serum sample are added in sextuplicate, followed by 20uL of Milli-Q water, 10uL of GST (100mM), and finally the system-formed by the exact mixture of 20 mL of 0.1 M TFK (100mM) pH 7.5, 0.0226g EDTA (2.5mM) 10.5mL of Milli-Q H2O. After leaving the plate for 5 minutes at 37 degrees Celsius, 10uL of CDNB (20mM) is pipetted onto all test samples and read in kinetic mode, λ=340nm, 30 minutes, 30 second intervals between readings (Hagib and Guengerich, 1974).

The thiobarbituric acid reactive substances (TBARS) assay is commonly utilized to measure lipid oxidation. The most common method is through a reaction of MDA with thiobarbituric acid (TBA) to produce a pink-colored dimeric compound. In this method, MDA, an end product of fatty acid peroxidation, reacts with TBA to form a colored complex. The TBARS was analyzed in serum according to Jentzsch et al. (1996). The serum (200μl) was incubated at 95ºC for 60min in acid medium containing 8.1% sodium dodecyl sulfate, 0.5 ml of acetic acid buffer (500mM, pH 3.4), and 0.6% TBA (Table 2). TBARS levels were measured at 532nm, and the absorbance was compared with the standard curve using malondialdehyde (Huber et al., 2008). The results were expressed in nanomoles of malondialdehyde per microgram of protein (nmol MDA/μg protein).

Table 2
Thiobarbituric acid reactive substances (TBARS) with serum, pipette the following quantities into test tubes, in order

	H2O	Orthophosphoric acid (0,2M)	Serum	TBA
Test (quadruplicate)	550 µL	1 mL	200 µL	250 µL
ORDER	1º	2º	3º	4º

• The thiol groups (TSH) were measured spectrophotometrically with ELLMAN’s reagent (Ellman, 1959). An aliquot of 40 μL of serum was added in 60uL of distilled water, 100uL of TFK (1M - pH 7.4). Afterwards 10uL of 10mM 5-5-dithio-bis (2-nitrobenzoic acid) (DTNB) was added. The reaction product was measured at 412 nm (Ellman, 1959). A standard curve using cysteine was added to calculate the content of thiol groups in samples and was expressed as μmol TSH/mL.

The superoxide (SOD) enzyme converts superoxide radical into hydrogen peroxide and molecular oxygen (O₂), while the catalase (CAT) and peroxidases convert hydrogen peroxide into water and in the case of catalase to oxygen and water (Weydert and Cullen, 2010). For superoxide dismutase (SOD), the samples with blood are diluted in a 1:20 ratio and the protein is read using the Comassie reagent. In a 96-well plate, pipette 4 different volumes of the sample (5uL, 10uL, 15uL, and 20uL) in quadruplicate, adding glycine buffer (50mM - pH 10.5) to close 200uL of volume in the well. The reading is carried out, first in end point mode at λ = 480 nm. After incubating the plate at 37 degrees Celsius for 5 minutes and in a dark environment, 10 µL of 60 mM adrenaline is added as quickly as possible to all test wells. The reading is carried out immediately in kinetic mode at λ=480nm for 5 minutes, with intervals of 10 seconds between each reading (McCord and Fridovich, 1969).

For catalase (CAT) analysis, the sample must be diluted 1:10 in saline, we measure the protein concentration to be used in the calculation. In the quartz cuvette we pipetted 668µL of TFK buffer (50mM - pH 7.0) at room temperature; 7 µL of the sample, the device was reset and after zeroing, we added 25uL of hydrogen peroxide diluted in the proportion 5mL of distilled water to 180uL of hydrogen peroxide P.A. Read immediately in kinetic mode at λ=240nm, with cycles: 10 and number of readings 11 (Nelson and Kiesow, 1972).

For interleukin analysis, PBMCs were isolated as follows. Briefly, after blood collection, 2mL of whole blood was diluted with an equal volume of 0.9% NaCl, followed by the addition of 3mL of Ficoll-Paque PREMIUM 1. Centrifugation was performed at 400×g for 15 minutes at room temperature. After centrifugation, the following layers were obtained: PBMCs, Ficoll-Paque, polymorphonuclear cells (PMNs), and erythrocytes. The PBMCs were collected and stored in cryotubes at −80°C for subsequent total RNA extraction.

Total RNA was extracted from PBMCs using Tri Reagent (BD), according to the manufacturer’s recommendations. After the RNA extraction, the quantification and estimation of RNA purity were performed using a Nanodrop spectrophotometer (Thermo Scientific, Waltham, MA, USA). The average RNA concentration of the samples was 157,36 ng/μl, minimum 22.9 ng/μl and maximum 386.5ng/μl; Absorbance 260/280 nm ratio mean 1.91, minimum 1.8, and maximum 2.01).

After quantification, the RNA was treated with DNAse Amplification Grade (Thermo Fisher, Waltham, MA, USA) for 15 minutes at 27˚C to degrade any DNA molecules. DNAse was inactivated with 1μl EDTA for 10 minutes at 65˚C. Reverse transcription was performed using iScript cDNA synthesis Kit (BioRad, Hercules, CA, USA) for 5 minutes at 25˚C followed by 30 minutes at 42˚C and 5 minutes at 85˚C. The cDNA synthesis was performed using 200ng of RNA in each sample.

Quantitative polymerase chain reaction (qPCR) was conducted in a thermocycler (BioRad, Hercules, CA, USA) using cDNA, forward and reverse canine specific primers, and SYBR fluorophore GoTaq1 Green Master Mix (Promega Corporation, Madison, USA). Samples were run in duplicate and the results of expression of all analyzed genes were expressed by ΔΔCq method, having the internal control gene (ACTB) as the reference gene. The genes assessed in this study were:

IL-6 (F: CTGGCAGGAGATTCCAAGGAT, R: TCTGCCAGTGCCTCTTTGC;

GenBank sequence NM_001003301), IL-10 (F: ACATCAAGAACCACGTGAACTCC, R: ACTCACTCATGGCTTTGTAGACACC;

GenBank sequence NM_001003077), IL-31 (F: ATGGATGCTCCTTCTACTCTGTAAACT, R: CAGGAAATGTTCTCAGGCTTAGC;

Genbank sequence NM_001165914.1), VEGF F: TGCGCCTATGGCAGGAGGAGAG, R: CGATCTCGTCAGGGTACTCCTGGAAG;

GenBank sequence NM_001003175.2), ACTB (F: TGCGTGACATCAAGGAGAAG, R: GGAATTCACTCATGCAGCAA;

GenBank sequence NM_001195845.3).

Descriptive statistics were performed for qualitative variables, including the calculation of frequencies (simple and relative), while measures of central tendency and variability were calculated for quantitative variables. The Shapiro-Wilk test was used to assess the normality of the data. When comparing two groups, the independent samples t-test or paired t-test was used for normally distributed data, and the Mann-Whitney U test or Wilcoxon signed-rank test was used for non-normally distributed data.

For the variables TBARS, GST, IL-6, IL-10, and IL-31, the Shapiro-Wilk test was rejected (p<0.05) and the Wilcoxon signed-rank test was used for Group 1 (control), while for the remaining variables TSH, SOD, and CAT, the paired t-test was used as normality was detected (p>0.05). For Group 2 (Cannabis), the Wilcoxon signed-rank test was used for the variables TBARS, TSH, CAT, IL-6, IL-10, and IL-31, and the paired t-test was used for the other variables (GST, SOD).

Regarding pre- and -post treatment tests, the independent samples t-test was performed for the variables TBARS, TSH, GST, SOD, and CAT, as normality was found in the data, and the Mann-Whitney U test was used for the variables IL-6, IL-10, and IL-31, as normality was not achieved.

For the analyses, the Statistical Package for the Social Sciences (SPSS) version 17.0 was used, with a significance level of 5% (p<0.05). All tests were conducted as two-tailed tests.

RESULTS

There was no statistical difference among the control and pre and post treatments to GST (p=0.2246), TBARS (p=0.7212), TSH (p=0.7627), SOD (p=0.7882) and CAT (0.9271) levels (figure 1 and table 3). Insufficient serum volume in one sample limited the analysis of CAT post-treatment concentrations in the treatment group.

Table 3
Individual oxidative stress markers (TBARS, TSH, GST, SOD, and CAT) measured in dogs (n=14) with canine atopic dermatitis (CAD), including breeds such as Shih-tzu, Lhasa Apso, Dachshund, and Golden Retriever, in the control group (olive oil, n=7) and cannabis oil-treated group (n=7), before (T0) and after 60 days of treatment (T60). Values are presented as mean, and no statistically significant differences were observed between treatments (P>0.05). (GST = Glutathione S-transferase; TBARS = thiobarbituric acid-reactive substances; TSH = total thiol groups; SOD = superoxide dismutase; CAT = catalase)

Group	n	TBARS (µmol)		TSH (µmol)		GST (mmol)		SOD (U)		CAT (U)
		Pre	Post	Pre	Post	Pre	Post	Pre	Post	Pre	Post
Control	1	0.78421	0.9511	2.59823	2.74486	333.401	554.747	30.056	28.2286	12.3625	**
	2	1.74781	0.71587	5.30367	2.49516	356.421	358.009	31.644	30.4248	24.9904	27.6665
	3	0.70938	1.1289	2.77795	3.28238*	404.399	506.385*	30.6962	28.0486	29.2066	17.3095
	4	0.7131	0.94617	3.64983	4.36559	360.975	376.152	30.5356	32.5754	15.7693	16.8921
	5	0.60136	0.64099	3.15261	3.13768	357.977	755.367	30.0909	31.1894	18.0806	12.0895
	6	1.04376	1.11017	3.13409	3.78031	346.502	352.918	30.5945	30.1121	17.7333	15.1305
	7	0.76196	1.10178	3.13615	3.79654	335.749	438.148	31.506	33.3308	14.4891	22.7313
Mean		0.757	0.942	3.393	3.371	356.489	477.389	30.7525	30.5585	18.947	18.636
P value =					0.2969			0.9656	0.01563	0.788	0.6454
CBD	1	0.66884	0.69438	3.08442	3.72348	300.175	472.419	29.4791	30.2396	17.2726	16.5049
	2	0.59395	0.61255	2.99384	2.92304*	353.695	408.548*	32.1046	34.3283*	28.7575	18.2596
	3	0.86726	0.9678	3.09898	4.2361	303.553	339.894	33.0177	32.215	16.426	13.0261
	4	1.0795	0.85289*	6.04083	2.85237*	455.872	441.996	29.9805	31.0952*	23.159	30.0823*
	5	0.59001	0.70661	3.29493	3.21848	389.773	308.881	29.7243	30.3239	14.5043	17.8689
	6	0.69374	1.86589	4.00329	2.55150	442.471	439.683	33.5601	26.3763	17.3806	15.0946
	7	0.81189	0.39209*	3.79419	3.38714*	568.803	385.939	31.3136	31.6196*	14.7987	21.6696*
Mean		0.757	0.870	3.758	3.270	402.048	399.622	31.3114	30.8854	18.899	18.9294
P value =					0.6875			0.4688	0.9558	0.7299	1.00

• *The data referred to as a positive response in the overall analysis framework. **No amount to dilute.

In the present study, no significant changes were observed in the levels of mRNA inflammatory (IL-6; p=0.5852), pruritic (IL-31; p=0.3603), and anti-inflammatory (IL-10; p=0.4695) interleukins (Fig. 2).

The pre- and post-treatment of each dog can be seen in Table 4.

Figure 2
Relative mRNA gene expression of interleukins IL-6, IL-10, and IL-31 in dogs (n=14) with canine atopic dermatitis (CAD), including breeds such as Shih-tzu, Lhasa Apso, Dachshund, and Golden Retriever, comparing the cannabis oil-treated group (n=7; 2.5mg/kg, BID, orally) and the control group (n=7; olive oil). Peripheral blood mononuclear cells (PBMCs) were analyzed by RT-qPCR before (T0) and after 60 days of treatment (T60). Results are presented as relative expression (mean ± SEM). No statistically significant differences were observed between groups (P>0.05).

Table 4
Individual mRNA gene expression levels of interleukins IL-6 (pro-inflammatory), IL-10 (anti-inflammatory), and IL-31 (pruritogenic) in dogs (n=14) with canine atopic dermatitis (CAD), including breeds such as Shih-tzu, Lhasa Apso, Dachshund, and Golden Retriever, in the control group (olive oil, n=7) and cannabis oil-treated group (n=7), before (T0) and after 60 days of treatment (T60). Values are expressed as mean relative expression. Asterisks (*) indicate individual responses considered positive within the overall analysis

Group	n	IL-6 (pg/mL)			IL-10 (pg/mL)		IL-31 (pg/mL)
		Pre	Post		Pre	Post	Pre	Post
Control	1	3.56	120.26		20.37	15.67	6.32	3.94
	2	10.21	120.26		29.14	15.67	4.13	20.19
	3	120.26	1.22*		15.67	35.25*	7.21	2.75*
	4	80.02	120.26		465.73	15.67	47.46	3.94
	5	5.55	120.26		72.89	15.67	37.92	3.94
	6	23.5	23.19		96.34	33.53	56.76	1.39
	7	120.26	120.26		324.6	15.67	128.19	3.94
Mean		51.91	89.39		146.39	21.02	41.14	5.72
P value =		0.5294			0.07813		0.07813
CBD	1	1	0,15		1	0,8	1	1,27
	2	144.47	78.05*		24.06	287.38*	16.02	31.41
	3	120.26	60.15		252.76	500.13	4.24	84.38
	4	120.26	0.2*		15.67	2.33	21.32	3.41*
	5	19.59	120.26		73.54	125.21	12.96	6.88
	6	6.33	120.26		21.36	15.67	6.72	3.94
	7	7.55	485.63		198.23	366.01*	18.95	12.7*
Mean		59.92	123.53		83.80	185,36	11,60	20.57
P value =		0.8125			0.2188		0.9375

• *The data referred to as a positive response in the overall analysis framework.

DISCUSSION

A body of research evidence indicates that CBD modifies redox balance by altering the level and activity of antioxidant molecules (Pereira et al., 2021). Martinelli et al. (2022) showed that higher concentrations of CBD have been shown to reduce lipid peroxidation markers and preserve antioxidant proteins. Rajesh et al. (2007) also reveals CBD reduces oxidative conditions, preventing the formation of superoxide radicals. It has also been shown to increase mRNA levels for SOD and certain variables responsible for the metabolism of superoxide radicals (Rajesh et al, 2010). Antioxidant and scavenger properties occur indirectly through several receptors (Atalay et al., 2020).

However, in the present study the oral use of cannabidiol did not alter the oxidative parameters evaluated (Fig. 1). The authors believed that the absence of results can be associated with the dosage used, and it should be noted that evaluating this directly on the skin would provide more reliable results. Additionally, the potential antioxidant action of olive oil, mainly through hydroxytyrosol, may have reduced the differences between the compared groups (Zoric et al., 2013).

While there is no consensus in the literature regarding oxidative stress and CAD, KAPUN (2012) demonstrated not only levels of malondialdehyde (MDA) and SOD in dogs affected by this syndrome but also values in healthy dogs. The MDA levels (µmol/L) found were 0.572±2.585 in atopic dogs compared to 0.477±1.298 in healthy dogs. In the present study, there was a variation in MDA levels (nmol/L) from 0.668±1.079 pre-treatment to 0.392±0.967 post-treatment with Cannabis oil. Although our results did not show significance in terms of TBARS (nmol MDA/mL) levels, Kapun et al. (2012) revealed that dogs with severe Canine Atopic Dermatitis Extent and Severity Index (CADESI) score exhibited increased levels of MDA in plasma, which may be correlated with elevated lipid peroxidation in CAD pathogenesis.

This study presents laboratory results as a complement to the work of Mariga et al. (2023). It is known that CBD can reduce the accumulation of ROS and damage to lipid membranes, preventing harm to cellular structure and DNA (Campos et al., 2016). Kapun et al. (2012) reported erythrocyte SOD values (U/gHGB) of 1341.1±2002.5 in atopic dogs, compared to 1349.0±2209.3 in healthy dogs. In the present study, there was a variation in SOD levels (U/mg protein) from 294.8±335.6 pre-treatment to 263.8±343.283 post-treatment with Cannabis oil. Even in different samples, similar to our study, Kapun et al. (2014; 2012), did not find significant values between SOD and CAD. Given that SOD is an erythrocytic enzyme, we can infer that its elevation in our control group is due to the absence of healthy dogs, as in the case of the first referenced literature.

Phyto-cannabinoids and polyphenols present in Cannabis sativa L. have been shown to impact redox balance by altering levels of oxidants and antioxidants (Pellati et al., 2018). Specific phytocannabinoids such as cannabigerol (CBG) can also mitigate oxidative stress, while terpenes like β-caryophyllene reduce ROS production through the NF-κB pathway, enhancing the synergistic effects of all substances in the plant (Gugliandolo et al., 2018). Although the specific phytocannabinoid profile of this oil is unknown, full-spectrum oils generally exhibit synergistic interactions among their constituents (Koltai et al., 2019). More studies are necessary, mainly focusing on the analysis of oxidative stress in the skin to verify whether cannabidiol can modulate oxidative stress and inflammatory conditions in CAD.

In atopic dermatitis, allergens, microorganisms, and secondary self-trauma due to itching, stimulate the release of cytokines important for inflammation from keratinocytes, which leads to alterations in corneodesmosomal function and protein junctions, further intensifying penetration and local inflammation (Gedon and Mueller, 2018). Loewinger et al. (2022) also found no difference in serum levels of IL-6 and IL-31 during four weeks of 2mg/kg CBD treatment in atopic dogs, but they found relief of pruritus. However, a group of researchers who synthesized molecules from CBD observed a significant inhibition of IL-6 levels compared to the control group (Lubschinski et al., 2022). A review article (Henshaw et al., 2021) revealed that CBD, CBG, or CBD:THC consistently reduced levels of the pro-inflammatory cytokine IL-6, particularly in a dose-dependent manner. The expression of CB2, GPR55, and TRPA1 in T cells indicates a therapeutic target for Cannabis, particularly in the involvement of these cells in the immune response of CAD, which results in a reduction in filaggrin production by keratinocytes, altering the function of the skin barrier (Combarros et al., 2020). In a study similar to ours (Mogi et al., 2022), eight dogs treated with THC-free CBD oil at a dosage of 0.07-0.25mg/kg twice daily for eight weeks showed discrepancies between plasma C-reactive protein concentration and clinical evaluation; however, this study did not have a control group to compare the obtained data. The antagonistic action of CBD on GRP55 appears to prevent inflammation and neuropathic pain through the overexpression of endocannabinoids and IL-10 (Sunda and Arowolo, 2020).

Herrmann et al. (2023) found no significance in the serum levels of IL-10 in untreated atopic dogs or healthy animals. Expanding on the findings of these authors, even when compared to healthy and conventionally medicated groups with oclacitinib, cyclosporine, and antigen immunotherapy, no significance was observed in IL-10 levels. Phytocannabinoids such as CBD (Al-Ghezi et al., 2019), CBG (Borrelli et al., 2013), and CBD+THC (Verrico et al., 2020) have an upregulating effect on the anti-inflammatory cytokine IL-10, although one CBD study reported no change in this cytokine (Britch et al., 2020), as our present research.

IL-31 has been associated with diseases characterized by severe pruritus, including CAD, and is also implicated in suppressing filaggrin differentiation (Tamamoto-Mochizuki and Olivry, 2021). Phytocannabinoids demonstrate a significant anti-inflammatory effect by reducing the release of pro-inflammatory interleukins, such as IL-31. However, the decrease in its expression by the anti-inflammatory action of THCV and CBGA was reversed by the blockade of the TRPV1 receptor by the binding of these phytocannabinoids and also by the inhibition of the cannabinoid degradation enzyme, MAGL (Tortolani et al., 2023).

There is a report (Bowen et al., 2020) of a significant increase in IL-31 gene expression in PBMCs in atopic dogs compared to healthy ones. In this study, no significance was found between the treated group and the control group. Tamamoto-Mochizuki and Olivry (2021) state in their work the difficulty and complexity of cytokines involved in CAD given the inconsistent results obtained involving IL-10 and IL-31. The values obtained in this study align with inconsistent outcomes in the complex assessment of CAD through interleukins.

In a brief individual analysis, we found that two patients from the Cannabis group (patients’ number 4 and 7) showed six positive responses out of the eight analyses performed, and other patients (number 2) met 5 of the 8 criteria. In contrast, in the control group, only one patient (number 3) showed improvement in 5 of the 8 criteria. Thus, we found that the patients in the cannabis group (3 out of 7) exhibited positive responses, meaning there was a decrease in mRNA expression of pro-inflammatory interleukins and oxidative molecules or an increase in mRNA expression of anti-inflammatory interleukins and antioxidant molecules. We recall that there was no significant difference between the groups and within the group itself, but the patients in the cannabis group showed more positive responses compared to the control group. The referenced data is identified (*) in Tables 3 and 4.

Although Cannabis can cause suppression of inflammation in healthy individuals, this effect may not be strong enough to alter the levels of inflammatory mediators in situations of highly dysfunctional inflammatory activation (Lima et al., 2021). It is essential to note the difficulty in managing CAD due to its multifactorial nature, requiring multimodal treatment for control. Therefore, even with the negative results obtained in the single therapy based on Cannabis, there is a suspicion of its possible positive effects when used in conjunction with conventional and integrative therapy.

The absence of findings in the different assessments conducted in this study can be mainly justified by the fact that the animals had dermatopathy, and these changes are primarily related to the dosage used. The small number of animals used is also important. Oral administration may reduce the bioavailability of phytocannabinoids, and the 2.5mg/kg dosage might not have been sufficient for an anti-inflammatory effect (Martins et al., 2022), this is because the analyses were conducted only at the mRNA level, rather than measuring the actual amount of interleukins present in the blood. We remind you that regarding interleukins, only mRNA measurement was performed, which may result in variations in the actual amount of interleukins present in the blood, even though Loewinger et al. (2022) also did not observe changes in the actual cytokines. Dixon et al. (2024) shows in vitro that cannabinoids have an immunosuppressive effect through suppression of IFN-γ in canine PBMCs. However, there is no suppression of IFN-γ at the mRNA level, nor for TNF-α.

Limitations of this study include the small number of animals, the short-term nature of the therapy, and impossibility of proteomic analysis of interleukins. However, despite the absence of significant findings in this study, Cannabis oil can still be a promising option due to its various forms of intervening in the pathophysiology of this disease.

CONCLUSION

Despite the lack of significance in evaluating atopic dermatitis by measuring interleukins and oxidative stress, it is worth highlighting the individuality of each animal in response to the dosage used since a highly positive result was obtained in the cannabis group. It is also believed that the difference observed in the current standardized dosage of cannabis oil used in this study diminishes when compared to the effects of olive oil due to its antioxidant properties. This study reveals that cannabis oil with a higher prevalence of CBD at a dosage of 2.5mg/kg does not demonstrate a therapeutic advantage compared to olive oil concerning the analyzed parameters. Therefore, we recommend conducting further clinical research to confirm or rule out potential therapeutic approaches to assess the control of dermatopathy in terms of interleukins and oxidative stress.

ACKNOWLEDGMENTS

We express our gratitude for the partnership with the Brazilian Association of Medicinal Cannabis Patients (AMA+ME) for the realization of this work and the support from the Brazilian Association for Therapeutic Cannabis Access (ABRAFLOR). We also thank the Coordination for the Improvement of Higher Education Personnel (CAPES) and the National Council for Scientific and Technological Development (CNPq) for funding this research.

REFERENCES

• AL-GHEZI, Z.Z.; RAGHUVANSHI, A.; MAHMOOD, S. et al Combination of cannabinoids, delta-9-tetrahydrocannabinol (THC) and cannabidiol (CBD), mitigates experimental autoimmune encephalomyelitis (EAE) by altering the gut microbiome. Brain Behav. Immun, v.82, p.25-35, 2019.
• ANIL, S.M.; SHARMA, M.C.; RICHARDSON, D. et al Medical cannabis activity against inflammation: active compounds and modes of action. Front. Pharmacol, v.13, p.908198, 2022.
• ATALAY, S.; LIU, J.; WU, J. et al Antioxidative and anti-inflammatory properties of cannabidiol. Antioxidants, v.9, p.21, 2020.
• BERTINO, L.; SIRACUSA, R.; D’AMICO, R. et al Oxidative stress and atopic dermatitis. Antioxidants, v.9, p.196, 2020.
• BORRELLI, F.; PAGANO, E.; CAPASSO, R. et al Beneficial effect of the nonpsychotropic plant cannabinoid cannabigerol on experimental inflammatory bowel disease. Biochem. Pharmacol, v.85, p.1306-1316, 2013.
• BOWEN, S.; GROSS, T.L.; ROSSI, C. et al Exploring the role of cytokines and chemokines in canine allergic skin disease. Vet. Dermatol, v.31, p.58, 2020.
• BRITCH, S.C.; WINNICKI, S.; KOLLER, B.H. et al Antinociceptive and immune effects of delta-9-tetrahydrocannabinol or cannabidiol in male versus female rats with persistent inflammatory pain. J. Pharmacol. Exp. Ther, v.373, p.416-428, 2020.
• CAMPOS, A.C.; MOREIRA, F.A.; GAIARSA, J.R. et al Cannabidiol, neuroprotection and neuropsychiatric disorders. Pharmacol. Res, v.112, p.119-127, 2016.
• CHIOCCHETTI, R.; GIULIANI, D.; FERRARI, A. et al Cannabinoid receptors in the inflammatory cells of canine atopic dermatitis. Front. Vet. Sci, v.9, p.987132, 2022.
• COMBARROS, D.; LLOYD, D.H.; LUTHER, P.B. Update on canine filaggrin: a review. Vet. Q, v.40, p.162-168, 2020.
• DIXON, S.; BORGES, N.; WILSON, S. et al Potential to use cannabinoids as adjunct therapy for dexamethasone: an in vitro study with canine peripheral blood mononuclear cell. Vet. Immunol. Immunopathol, v.269, p.110727, 2024.
• ELLMAN, G.L. Tissue sulfhydryl groups. Arch. Biochem. Biophys, v.82, p.70-77, 1959.
• GEDON, N.K.Y.; MUELLER, R.S. Atopic dermatitis in cats and dogs: a difficult disease for animals and owners. Clin. Transl. Allergy, v.8, p.41, 2018.
• GUGLIANDOLO, A.; PERATELLI, A.; CRUPI, R. et al In vitro model of neuroinflammation: Efficacy of cannabigerol, a non-psychoactive cannabinoid. Int. J. Mol. Sci., v.19, p.1992, 2018.
• GUGLIANDOLO, E.; SALICONE, A.; SIRACUSA, R. et al Canine atopic dermatitis: Role of luteolin as new natural treatment. Vet. Med. Sci, v.6, p.926-932, 2020.
• HAGIB, W.H., GUENGERICH, F.P. Glutathione S-transferases: The first enzymatic step in mercapturic acid formation. J. Biol. Chem, v.249, p.7130-7139, 1974.
• HENSEL, P.; SANTOS, L.; FARRIS, H. et al Canine atopic dermatitis: detailed guidelines for diagnosis and allergen identification. BMC Vet. Res, v.11, p.196, 2015.
• HENSHAW, F.R.; MILNER, R.; ZIMMET, P. et al The effects of cannabinoids on pro- and anti-inflammatory cytokines: A systematic review of in vivo studies. Cannabis Cannabinoid Res, v.6, n.3, 2021.
• HERRMANN, I.; ZIMMER, A.; VOLKOV, N. et al Long-term effects of ciclosporin and oclacitinib on mediators of tolerance, regulatory T-cells, IL-10 and TGF-B, in dogs with atopic dermatitis. Vet. Dermatol, v.24, p.107-114, 2023.
• HUBER, P.C.; NASCIMENTO, D.F.; SOUZA, S.P. Glutationa e enzimas relacionadas: papel biológico e importância em processos patológicos. Quim. Nova, v.31, p.1170-1179, 2008.
• JENTZSCH, A.M.; RICHARDSON, R.; SMITH, H. Improved analysis of malondialdehyde in human body fluids. Free Radic. Biol. Med., v.20, p.251-256, 1996.
• KAPUN, A.P.; BUTKOVIC, D.; PETERLIN, M. et al Oxidative stress markers in canine atopic dermatitis. Res. Vet. Sci, v.92, p.469-470, 2012.
• KAPUN, A.P.; PETERLIN, M.; BUTKOVIC, D. et al Vitamin E supplementation in canine atopic dermatitis: improvement of clinical signs and effects on oxidative stress markers. Vet. Rec, v.175, p.560, 2014.
• KOLTAI, H.; LORENZO, D.; TAMIR, A. Promoting cannabis products to pharmaceutical drugs. Eur. J. Pharm. Sci., v.132, p.118-120, 2019.
• LIMA, M.G.; PEREIRA, L.M.C.; LOUREIRO, F.A. et al Cannabis and inflammatory mediators. Eur. Addict Res, v.27, p.26-24, 2021.
• LOEWINGER, M.; HIRSCH, C.; BLAU, S. et al The effect of a mixed cannabidiol and cannabidiolic acid-based oil on client-owned dogs with atopic dermatitis. Vet. Dermatol., v.33, p.329-e77, 2022.
• LUBSCHINSKI, T.; ALMEIDA, V.B.; RODRIGUES, A.L. Effect of aryl-cyclohexanones and their derivatives on macrophage polarization in vitro Inflammation, v.45, n.4, 2022.
• MARIGA, C.; THALER, L.; BIZARRO, C.B. Dermatological evaluation in dogs with atopic dermatites treated with full-spectrum high cannabidiol oil: a pre study part 1. Front. Vet. Sci, v.10, p.1285384, 2023.
• MARTEL, B.C.; BENDTSEN, L.; THOMSEN, S.F. Translational animal models of atopic dermatitis for preclinical studies. Yale J. Biol. Med, v.90, p.389-402, 2017.
• MARTINELLI, G.; CORAZZA, M.; BRAGHINI, C.A. et al Cannabis sativa and skin health: dissecting the role of phytocannabinoids. Planta Med, v.88, p.492-506, 2022.
• MARTINS, A.; LEITE, C.; PEREIRA, J. et al Cannabis-based products for the treatment of skin inflammatory diseases: a timely review. Pharmaceuticals, v.15, p.210, 2022.
• MASSI, P.; SOLINAS. M.; CINQUINA, V. et al Cannabinoids, immune system and cytokine network. Curr. Pharm. Des, v.12, p.3135-3146, 2006.
• MCCORD, J.M.; FRIDOVICH, I. Superoxide dismutase: an enzymatic function for erythrocuprein (hemocuprein). J. Biol. Chem, v.244, p.6049-6055, 1969.
• MOGI, C.; SHIMIZU, T.; KATAOKA, Y. et al Effects of cannabidiol without delta-9-tetrahydrocannabinol on atopic dermatitis: a retrospective assessment of 8 cases. Can. Vet. J, v.63, p.423-426, 2022.
• NELSON, D.P.; KIESOW, L.A. Enthalpy of decomposition of hydrogen peroxide by catalase at 25 °C. Anal. Biochem, v.49, p.474-478, 1972.
• OLIVRY, T.; DEBOER, D.J.; FAVROT, C. et al Treatment of canine atopic dermatitis: clinical practice guidelines from the international task force on canine atopic dermatitis. Vet. Dermatol, v.21, p.233-248, 2010.
• PELLATI, F.; BRIGHENTI, V.; BERTELLI, D. et al Cannabis sativa L. and nonpsychoactive cannabinoids: their chemistry and role against oxidative stress, inflammation, and cancer. Biomed. Res. Int, v.2018, p.1691428, 2018.
• PEREIRA, S.R.; FERREIRA, N.R.; OLIVEIRA, M.B. et al Cannabidiol modulation of oxidative stress and signalling. Neuronal Signal, v.5, n.3, 2021.
• RAJESH, M.; HUNGUND, B.L.; HAROLD, L. et al Cannabidiol attenuates high glucose-induced endothelial cell inflammatory response and barrier disruption. Am. J. Physiol. Heart. Circ. Physiol, v.293, p.H610-H619, 2007.
• RAJESH, M.; RAO, D.V.; NADLER, J.L. et al Cannabidiol attenuates cardiac dysfunction, oxidative stress, fibrosis, and inflammatory and cell death signaling pathways in diabetic cardiomyopathy. J. Am. Coll. Cardiol, v.56, p.2115-2125, 2010.
• SUNDA, F.; AROWOLO, A. A molecular basis for the anti-inflammatory and antifibrosis properties of cannabidiol. FASEB J v.34, p.14083-14092, 2020.
• TAMAMOTO-MOCHIZUKI, C.; OLIVRY, T. IL-31 and IL-31 receptor expression in acute experimental canine atopic dermatitis skin lesions. Vet. Dermatol, v.32, p.631-e169, 2021.
• TANASESCU, R.; CONSTANTINESCU, C.S. Cannabinoids and the immune system: an overview. Immunobiology, v.215, p.588-597, 2010.
• TORTOLANI, D.; GOMEZ, L.A.; PELLEGRINI, M. et al Rare phytocannabinoids exert anti-inflammatory effects on human keratinocytes via the endocannabinoid system and MAPK signaling pathway. Int. J. Mol. Sci, v.24, p.2721, 2023.
• TÓTH, K.F.; ÁDÁM, D.; BÁTKAI, S. et al Cannabinoid signaling in the skin: therapeutic potential of the “c(ut)annabinoid” system. Molecules, v.24, p.918, 2019.
• VERRICO, C.D.; MILLS, C.; DANIELS, R. et al A randomized, double-blind, placebo-controlled study of daily cannabidiol for the treatment of canine osteoarthritis pain. Pain, v.161, p.2191-2202, 2020.
• WEYDERT, C.J.; CULLEN, J.J. Measurement of superoxide dismutase, catalase and glutathione peroxidase in cultured cells and tissue. Nat. Protoc, v.5, p.51-66, 2010.
• ZORIC, N.; HORVAT, I.; KOPJAR, N. et al Hydroxytyrosol expresses antifungal activity in vitro Curr. Drug. Targets, v.14, p.992-8, 2013.

• DATA AVAILABILITY STATEMENT
  The research data are available within the article itself.

Edited by

• Editor-chefe:
  Marcelo Resende de Souza

• Editor-científico:
  Antônio de Pinho Marques Jr.

Data availability

The research data are available within the article itself.

Publication Dates

• Publication in this collection
  17 Aug 2026
• Date of issue
  2026

History

• Received
  25 July 2025
• Accepted
  19 Mar 2026