Age-dependent expression of Pten and Smad4 genes in the urogenital system of Wistar rats¹

Abstract

PURPOSE:

To analyze Pten and Smad4 gene expression in the urogenital system of Wistar rats in differents ages.

METHODS:

Pten and Smad4 mRNA expression was assessed in the bladder, ventral prostate, testis, ovaries, and uterus by real-time PCR. Statistical analysis using the ANOVA (p<0.05).

RESULTS:

Pten levels showed a progressive age-dependent increase in the bladder (male and female) and prostate and were elevated in the ovaries of the middle-aged. In the uterus, no statistically significant differences were observed; in the testis, increased and decreased levels were seen in young adult and middle-aged rats, respectively. Smad4 expression was downregulated in the ovaries of the pubertal group but increased in the middle age group. In the uterus, Smad4 expression in the oldest group was higher than the others groups. In the testis, Smad4 expression steadily declined with age; in the prostate, it was higher in middle-aged rats than in younger rats. A similar trend was observed in the bladder of male and female middle-aged rats, compared with the pubertal group.

CONCLUSION:

The changes in phosphatase tensin homologue and Smad4 mRNA expression in Wistar rats appear to be associated with hormonal modifications in puberty and may be related to early follicular and testicular development.

Pten; Smad4; Urogenital system

Introduction

Cancer is the second most common cause of death worldwide. Annually, more than 12.7 million people are diagnosed with cancer and 7.6 million die of this condition. Between 1975 and 2000, the incidence of cancer doubled, and the incidence of cancer is expected to double again by 2020 and triple by 2030, when the cancer death rate is predicted to reach 17 million per year. Lung, breast, and colon cancers are the most commonly diagnosed cancers worldwide¹.

Multiple genes are related to the control of cellular proliferation and prevention of tumorigenesis. The Pten (phosphatase tensin homologue) gene encodes a protein phosphatase that functions as a tumor suppressor and is involved in various physiological processes, including cell proliferation, migration, survival, and apoptosis. Pten is a key regulator of a signaling pathway that controls cell division, mediates apoptosis, and prevents excessive cell growth². Since its discovery in 1997, Pten has been established as one of the most commonly mutated tumor suppressors in human cancer; deficiency of Pten enzymatic activity has been implicated in the development of gliomas and breast, endometrial, lung, and prostate cancers³. The PTEN gene has been shown to be mutated in 40-50% of gliomas and in up to 70% of prostate cancers⁴.

Smad4 belongs to a family of transcription factors that mediate the transforming growth factor (TGF)-beta signaling associated with cell proliferation and differentiation, angiogenesis, and extracellular matrix remodeling⁵. A recent study has shown that Pten and Smad4 together with Spp1 and cyclin D1 form a four-gene signature that is prognostic for recurrence and lethal metastasis in human prostate cancer. The Gleason grading scale has an accuracy of 60-70% in determining prostate cancer aggressiveness, whereas the prognostic accuracy of the four gene-based analyses reaches 83%. The combination of the four biomarkers and the Gleason score has a predictive accuracy of approximately 90% and can be applied to determine the aggressiveness of prostate cancer⁶. The expression of the Pten and Smad4 genes has been extensively investigated. However, only a few studies have reported the expression of these genes in the urogenital system. In this study, we evaluated the expression of the Pten and Smad4 genes in the urogenital organs of Wistar rats at different ages.

Methods

The study was approved by the Ethics Committee for the care and use of experimental animals of the State University of Rio de Janeiro (CEUA021/2012) and followed the principles set out in The Guide for the Care and Use of Laboratory Animals.

Wistar rats from the colony of the Urogenital Research Unit were kept in polypropylene boxes in a temperature-controlled (21°C ± 2°C) 12-h light-dark cycle (07:00 h-19:00 h) environment and received food and water ad libitum. The animals were divided into four age groups: pre-pubertal (21 days; 10 male and 5 female rats); pubertal (50 days; 10 male and 5 female rats); young adult (90 days; 10 male and 5 female rats) and middle-aged (180 days; 10 male and 9 female rats).

Puberty was determined on the basis of the vaginal opening in female rats and the separation of the foreskin in male rats. The animals were euthanized by intraperitoneal injection of sodium pentobarbital (30 mg/kg) and the bladder, testis, prostate, uterus, and ovaries were removed, fixed in liquid nitrogen, and stored at -80°C until analysis by real-time PCR (qPCR).

Real-time PCR

RNA was extracted from the tissues using Trizol^(r) reagent according to the protocol provided by the manufacturer (Life Technologies, Carlsbad, CA, USA). RNA concentration and purity were determined by the 260/280 nm absorbance ratio using a NanoDrop-1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). Total RNA (1 µg) was treated with DNase (Life Technologies) before being reverse-transcribed using the Superscript III enzyme (Life Technologies). The resulting cDNA was used as a template for qPCR analysis performed with specific Pten and Smad4 primers (Table 1) and SyBR Green reagent (Life Technologies) in the Bio-Rad CFX96 Real Time System (Bio-Rad Laboratories, Foster City, CA, USA). Relative mRNA expression was calculated by the delta-delta Ct method and normalized to that of beta-actin, which was used as a housekeeping gene. All reactions were performed in triplicate.

Table 1
Sequences of oligonucleotides used for analysis of Pten and Smad4 mRNA expression by qPCR.

Gene	Sequence
Pten: forward primer	ACACCGCCAAATTTAACTGC
Pten: reverse primer	TACACCAGTCCGTCCCTTTC
Smad4: forward primer	CCCATCCTGGACATTACTGG
Smad4: reverse primer	TACACCAGTCCGTCCCTTTC
β actina: forward primer	CTGTCCCTGTATCGCTCTGGTC
β actina: reverse primer	TGAGGTAGTCCGTCAGGTCCC

Statistical analysis

The data were tested for normality and homogeneity of the variance and have been presented as the mean ± standard deviation (SD). Differences among the groups were established by one-way analysis of variance (one-way ANOVA) followed by Bonferroni's post hoc test; p £ 0.05 was considered statistically significant. All analyses were performed using Prism version 5.00 for Windows (GraphPad Software, San Diego, CA, USA).

Results

Pten mRNA expression in the bladder of middle-aged male rats was increased by 95%, 91%, and 80% relative to animals from the pre-pubertal, pubertal, and young adult groups, respectively (Table 2). Pten mRNA levels were also significantly elevated by 95%, 96%, and 90% in the prostate of the oldest age group relative to that of the pre-pubertal, pubertal, and young adult groups, respectively (Table 2). In the testes, Pten mRNA expression increased by 45% in young adults relative to pre-pubertal animals, whereas the middle-aged male rats showed a 66% reduction in Pten mRNA levels relative to the young adult group (Table 2). Pten mRNA levels in the bladder were similar in female and male rats. The middle-aged group showed an increase of 83%, 82%, and 85% in Pten mRNA levels compared with the pre-pubertal, pubertal, and young adult groups, respectively (Table 2). Pten mRNA levels in the ovaries were increased by 78% in middle-aged rats relative to young adult rats (Table 2). However, no statistically significant difference was observed in uterine Pten mRNA expression among the age groups (Table 2).

Table 2
Pten and Smad4 gene expression in the urogenital organs of Wistar rats at different ages.

Pten	21 days	50 days	90 days	180 days	p value
Bladder male	0.59 ± 0.27	1.11 ± 1.48	2.66 ±2.83	13.21 ± 8.02a,b,c	0.0075
Testis	1.57 ±1.00	1.95 ± 0.48	2.88 ± 1.03a	0.97 ± 0.34c	0.0003
Prostate	0.88 ±0.66	0.67 ± 0.32	2.01 ± 1.83	19.56 ± 14.73a,b,c	0.0001
Bladder female	0.10 ± 0.04	0.10 ± 0.05	0.08 ± 0.03	0.58 ± 0.56a,b,c	0.0001
Ovaries	0.54 ± 0.53	0.83 ± 0.72	0.31 ± 0.15	1.40 ± 0.73c	0.0019
Uterus	0.19 ± 0.17	0.09 ± 0.04	0.25 ±0.21	0.24 ± 0.17	0.3701
Smad4	21 days	50 days	90 days	180 days	p value
Bladder male	0.21 ± 0.17	0.08 ± 0.04	0.22 ± 0.18	0.40 ± 0.23b	0.02
Testis	2.18 ± 1.51	0.14 ± 0.02a	0.37 ± 0.22a	0.10 ± 0.05a	0.0001
Prostate	0.22 ± 0.08	0.42 ± 0.30	0.20 ± 0.16	0.87 ± 0.42a,b,c	0.0001
Bladder female	0.25 ± 0.19	0.27 ± 0.13	0.27 ± 0.10	1.11 ± 0.58a,b,c	0.0016
Ovaries	0.67 ± 0.25	0.18 ± 0.05a	0.27 ± 0.19	1.02 ± 0.26b,c	0.001
Uterus	0.06 ± 0.04	0.18 ± 0.05	0.12 ± 0.19	1.03 ± 0.78a,b,c	0.0019

Smad4 expression in the bladder of middle-aged male rats was elevated by 78% compared to that in pubertal animals (Table 2). Similarly, in the prostate of the oldest age group, Smad4 mRNA levels increased by 74%, 51%, and 76% compared to those in the pre-pubertal, pubertal, and young adult groups, respectively (Table 2). However, in the testes, the highest Smad4 mRNA expression was observed for the youngest, pre-pubertal rats, whereas reductions of 93%, 83%, and 95% were detected for the pubertal, young adult, and middle-aged rats, respectively (Table 2). Bladder Smad4 mRNA levels in middle-aged females were higher than those in the pre-pubertal (77%), pubertal (75%), and young adult (75%) groups (Table 2). In the ovaries of the pubertal animals, Smad4 expression was reduced by 72% compared to that in the pre-pubertal group; however, the middle-aged group showed an 82% increase in Smad4 mRNA levels relative to the pubertal animals (Table 2). In the uterus, Smad4 expression in the oldest group was 94%, 82%, and 88% higher than that in the pre-pubertal, pubertal, and young adult groups, respectively (Table 2).

Data were reported as mean ± SD. The differences were tested by one-way analysis of variance (ANOVA) and the Bonferroni post hoc test, p <0.05. ^[a] indicates difference from 21 days; ^[b] indicates difference from 50 days; ^[c] indicates difference from 90 days.

Discussion

Pten and Smad4 have been identified as tumor suppressor factors, and deletions or mutations in their respective encoding genes have been associated with various neoplasms, including gastrointestinal polyps, melanoma, glioma, and prostate, bladder, breast, and ovarian cancers^{4 , 7 , 8}. Expression of Pten and Smad4 has been established as a prognostic factor for the development of metastatic prostate cancer⁶. In a murine model of prostate cancer, decreased Pten expression was positively associated with tumor aggressiveness⁹. Pten-knockout mice develop a broad spectrum of tumors, including tumors in the gastrointestinal tract, and thyroid glands, and prostate¹⁰.

Our study demonstrated that healthy cancer-free rats showed an age-dependent increase in Pten expression in the prostate and bladder, which may indicate increased control over cell proliferation with age and is consistent with the role of the Pten gene in the inhibition of cell growth, neoplasm development, and carcinogenesis².

Pten activity is also closely associated with the production of follicle-stimulating hormone (FSH). Acute stimulation of rat testicular Sertoli cells, required for male sexual development, by FSH has been found to increase Pten synthesis and enzymatic activity, thus identifying a new, Pten-dependent mechanism of regulating spermatogenesis¹¹. In rats, FSH plasma levels peak between 10 and 15 weeks and decline after this period¹², which agrees with our findings that, in rat testes, Pten expression increased with maturation from the pre-pubertal (21 days) to the young adult (90 days) stage, but then decreased in the older, middle-aged (180 days) group.

In the ovaries, Pten mRNA levels were higher in middle-aged rats than in young adults, thus presenting a pattern opposite to that of estrogen production, which is maximal in the proestrus stage (80-100 days)¹³ and declines after 180 days¹⁴. The negative correlation between estrogen levels and Pten expression has been confirmed in vitro by Noh et al.¹⁵ who showed that estrogen decreased Pten expression in breast cancer cells. A relationship between Pten expression and female hormonal status has been shown in estrogen-dependent human ovarian adenocarcinomas, where Pten is markedly downregulated⁷.

Smad4 mRNA expression was similar in the bladders of male and female rats. Islam et al.¹⁶ reported that Smad4 is expressed in all bladder layers and is important in the regulation of mouse bladder organogenesis. However, we found that Smad4 expression in the pre-pubertal rats was low and started to increase from puberty, reaching significantly increased levels in adulthood for both sexes. Given that Smad4 expression was negatively correlated with the progression of bladder carcinoma and the occurrence of metastases¹⁷, the increase in Smad4 levels in middle-aged rats may represent a regulatory mechanism for preventing uncontrolled cellular proliferation. Indeed, it is known that Wistar rats do not spontaneously develop cancer¹⁸.

Smad4 and Pten double-knockout mice have been shown to develop neoplasia during their lifetime¹⁹, confirming previous findings that genetic deletion of Smad4 results in the emergence of invasive, metastatic, and lethal prostate cancers⁶. In this study, we detected an increase in Smad4 mRNA levels in the prostate of the middle-aged rats, which may indicate a protective mechanism against cancer development in the aging prostate.

Smad4 has been shown to play a critical role in testicular development in pre-pubertal animals²⁰. The progressive reduction in the expression of Smad4 mRNA throughout the lifetime in the animals in the present study agrees with the findings of Narula et al.²¹ who observed that mice overexpressing Smad4 developed hyperplasia of Leydig cells, apoptosis of germ cells, spermatogenic arrest, and degeneration of the seminiferous tubules. Our present observation that Smad4 expression in the testis decreases with age is consistent with the role of Smad4 in spermatogenesis. The reduction in Smad4 mRNA levels in pubertal and young adult rats corresponded with an increase in testicular function.

In the female gonads, Smad4 gene expression was higher in pre-pubertal animals than in pubertal animals, suggesting involvement in the early phases of folliculogenesis and ovarian development^{22 , 23}. However, in contrast to male rats, middle-aged female rats demonstrated an increase in Smad4 mRNA expression in the reproductive organs (ovaries and uterus) relative to the pubertal and young adult groups. Given the role of Smad4 as a tumor suppressor²⁴, these changes may be indicative of the Smad4 related anti-proliferative mechanisms induced in aging female rats as reproductive activity declines²⁵.

Conclusion

The Smad4 may be a part of the regulatory mechanism controlling the initial development of the rat reproductive system, whereas the elevated expression of both Pten and Smad4 mRNA in aging animals may indicate the activation of antiproliferative events required for the protection of the urogenital system against age-related carcinogenic stimuli.

Acknowledgements

This research was supported by Brazilian agencies: CNPq, FAPERJ and CAPES.

References

• ¹
  Siegel R, Naishadham D, Jemal A. Cancer statistics. CA Cancer J Clin. 2013 Jan;63(1):11-30.
• ²
  Agarwal BB, Danda D, Gupta S, Gehlot P. Models for prevention and treatment of cancer: problems vs promises. Biochemical Pharmacol. 2009 Nov;78(9):1083-94.
• ³
  Li D, Sun H. TEP1 Encoded by a candidate tumor suppressor locus, is a novel protein tyrosine phosphatase regulated by transforming growth factor β1. Cancer Res. 1997 Jun;57(11):2124-9.
• ⁴
  Li J, Yen C, Liaw D, Podsypanina K, Bose S, Wang SI, Puc J, Miliaresis C, Rodgers L, McCombie R, Bigner SH, Giovanella BC, Ittmann M, Tycko B, Hibshoosh H, Wigler MH, Parsons R. PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science. 1997 Mar;275(5308):1943-7.
• ⁵
  Massagué J. TGFβ signalling in context. Nat Rev Mol Cell Biol. 2012 Oct;13(10):616-30.
• ⁶
  Ding Z, Wu CJ, Chu GC, Xiao Y, Ho D, Zhang J, Perry SR, Labrot ES, Wu X, Lis R, Hoshida Y, Hiller D, Hu B, Jiang S, Zheng H, Stegh AH, Scott KL, Signoretti S, Bardeesy N, Wang YA, Hill DE, Golub TR, Stampfer MJ, Wong WH, Loda M, Mucci L, Chin L, DePinho RA. SMAD4 dependent barrier constrains prostate cancer growth and metastatic progression. Nature. 2011 Feb;470(7333):269-73.
• ⁷
  Tanwar PS, Kaneko-Tarui T, Lee HJ, Zhang L, Teixeira JM. PTEN loss and HOXA10 expression are associated with ovarian endometrioid adenocarcinoma differentiation and progression. Carcinogenesis. 2013 Apr;34(4):893-901.
• ⁸
  Cordes I, Kluth M, Zygis D, Rink M, Chun F, Eichelberg C, Dahlem R, Fisch M, Höppner W, Wagner W, Doh O, Terracciano L, Simon R, Wilczak W, Sauter G, Minner S. PTEN deletions are related to disease progression and unfavourable prognosis in early bladder cancer. Histopathology. 2013 Nov;63(5):670-7.
• ⁹
  Wang S, Gao J, Lei Q, Rozengurt N, Pritchard C, Jiao J, Thomas GV, Li G, Roy-Burman P, Nelson PS, Liu X, Wu H. Prostate specific deletion of the murine Pten tumor suppressor gene leads to metastatic prostate cancer. Cancer Cell. 2003 Sept;4(3):209-21.
• ¹⁰
  Stambolic V, Tsao MS, Macpherson D, Suzuki A, Chapman WB, Mak TW. High incidence of breast and endometrial neoplasia resembling human Cowden syndrome in pten+/− mice. Cancer Res. 2000 Jul;60(13):3605-11.
• ¹¹
  Noguchi J, Yoshida M, Ikadai H, Imamichi T, Watanabe G, Taya K. Age-related blood concentrations of FSH, LH and testosterone and testicular morphology in a new rat sterile mutant with hereditary aspermia. J Reprod Fertil. 1993 Mar;97(2):433-9.
• ¹²
  Dupont J, Musnier A, Decourtye J, Boulo T, Lécureuil C, Guillou H, Valet S, Fouchécourt S, Pitetti JL, Nef S, Reiter E, Crépieux P. Fsh stimulated Pten activity accounts for the lack of FSH mitogenic effect in prepubertal rat Sertolli cels. Mol Cell Endocrinol. 2010 Feb;315(1-2):271-6.
• ¹³
  Marcondes FK, Bianchi FJ, Tanno AP. Determination of the estrous cycle phases of rats, some helpful considerations. Braz J Biol. 2002 Nov;62(4A):609-14.
• ¹⁴
  Crawford KA, Hirshfield AN, De Paolo LV. Correlation of age-associated increases in follicle stimulating hormone secretion with decreases in antral follicles: failure of progesterone-induced acyclicity to prevent these changes. Mech Ageing Dev. 1992 Jun;64(1-2):111-22.
• ¹⁵
  Noh EM, Lee YR, Chay KO, Chung EY, Jung SH, Kim JS, Youn HJ. Estrogen receptor induces down-regulation of Pten through PI3 kinase activation in breast cancer cells. Mol Med Rep. 2011 Mar-Apr;4(2):215-9.
• ¹⁶
  Islam SS, Mokhtari RB, Kumar S, Maalouf J, Arab S, Yeger H, Farhat WA. Spatio-temporal distribution of Smads and role of Smads/TGF-β/BMP-4 in the regulation of mouse bladder organogenesis. Plos One. 2013 Apr;8(4):e61340.
• ¹⁷
  Tang ZY, Yang LY, Zhang YJ, Peng KL, Qi L. Smad4 and TGF-beta1 expression and clinical significance in bladder transitional cell carcinoma. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2006 Jun;31(3):363-6.
• ¹⁸
  Russell PJ, Voeks DL. Prostate cancer methods and protocols. Methods Mol Med. 2003 Jul;81(1):89-112.
• ¹⁹
  Wu X, Gong S, Roy-Burman P, Lee P, Culig Z. Current mouse and cell models in prostate cancer research. Endocr Relat Cancer. 2013 Jun;20(4):R155-70.
• ²⁰
  Pangas SA, Li X, Umans L, Zwijsen A, Huylebroeck D, Gutierrez C, Wang D, Martin JF, Jamin SP, Behringer RR, Robertson EJ, Matzuk MM. Conditional deletion of Smad1 and Smad5 in somatic cells of male and female gonads leads to metastatic tumor development in mice. Mol Cell Biol. 2008 Jan;28(1):248-57.
• ²¹
  Narula A, Kilen S, Ma E, Kroeger J, Goldberg E, Woodruff TK. Smad4 overexpression causes germ cell ablation and leydig cell hyperplasia in transgenic mice. Am J Pathol. 2002 Nov;161(5):1723-34.
• ²²
  Miao ZL, Wang ZN, Cheng LQ, Zhang Y. Expression of Smad4 during rat ovarian development. Di Yi Jun Yi Da Xue Xue Bao. 2005 Feb;25(2):127-31.
• ²³
  Nagashima T, Kim J, Li Q, Lydon JP, DeMayo FJ, Lyons KM, Matzuk MM. Connective tissue growth factor is required for normal follicle development and ovulation. Mol Endocrinol. 2011 Oct;25(10):1740-59.
• ²⁴
  Malkoski SP, Wang XJ. Two sides of the story? Smad4 loss in pancreatic cancer versus head-and-neck cancer. FEBS Lett. 2012 Jul;586(14):1984-92.
• ²⁵
  Lassus H, Salovaara R, Aaltonen LA, Butzow R. Allelic analysis of serous ovarian carcinoma reveals two putative tumor suppressor loci at 18q22-q23 distal to Smad4, Smad2, and DCC. Am J Pathol. 2001 Jul;159(1):35-42.

• 1
  Research performed at Urogenital Research Unit, Department of Anatomy, State University of Rio de Janeiro (UFRJ), Brazil. Part of PhD degree thesis, Postgraduate Program in Pathophysiology and Surgical Sciences, UFRJ. Tutor: Francisco José Barcellos Sampaio.

Publication Dates

• Publication in this collection
  2014