Accessibility / Report Error

USO DE ESTREPTOMICINA NA ELIMINAÇÃO DA LEPTOSPIRÚRIA EM TOUROS (BOS TAURUS INDICUS) NATURALMENTE INFECTADOS PELO SOROVAR HARDJO

USE OF STREPTOMYCIN IN THE END OF LEPTOSPIRURIA IN SEROLOGICALLY REACTIVE BULLS (BOS TAURUS INDICUS)

RESUMO

O objetivo desse trabalho foi verificar a ação de marcas diferentes de estreptomicinas polivalentes para o tratamento da leptospirose bovina em dose única (25 mg de estreptomicina por kg de peso corpóreo). O trabalho foi realizado com 14 touros adultos sorologicamente reagentes para Leptospira interrogans sorovar Hardjo, com título mínimo de 800 e com cultivo positivo. Os animais foram separados em 2 grupos de acordo com a marca da estreptomicina utilizada no tratamento, grupo 1: estreptomicina A e grupo 2: estreptomicina B. Os bovinos controles não receberam nenhum tratamento. Foram obtidas amostras de sangue e urina dos animais tratados e controles nos dias -1, 0, 1, 2, 3, 5, 10, 15 e 25; considerando-se o dia do tratamento como dia 0. Na urina dos bovinos tratados e controle foi realizada a reação em cadeia da polimerase (PCR) e isolamento com inoculação em hamsters. Observou-se que a estreptomicina da marca A, em dose única de 25 mg/kg de peso corpóreo, conseguiu eliminar a leptospirúria no grupo de touros após 24h do tratamento. Já no grupo de touros tratados com a estreptomicina da marca B, foi constatado a leptospirúria entre 48h e 72h, após o tratamento. Em ambos os grupos tratados, a resposta sorológica apresentou uma variação da queda dos níveis dos títulos de anticorpos aglutinantes, sendo que embora a estreptomicina A tenha aparentemente apresentado um melhor desempenho quando comparada com as médias geométricas dos títulos do grupo tratado com a estreptomicina B as médias não diferiram entre si pelo Teste de Tukey (P > 0,05). Nos bovinos tratados a leptospirúria foi intermitente e a média geométrica dos títulos foi menor que a média geométrica dos títulos dos bovinos controles. A diferença do efeito da ação das diferentes marcas de estreptomicina está possivelmente na qualidade da matéria prima produzida pelos laboratórios.

PALAVRAS-CHAVE
Leptospira; bovinos; estreptomicina

ABSTRACT

The objective of this work was evaluated different marks of streptomycin for the treatment of bovine leptospirosis, in an only one dose of 25 mg for kg of corporeal weight. Thirty serologically reactive bulls for Leptospira interrogans serovar Hardjo were utilized. The bulls had a minimum antibody titer of 800 and were positive in the isolation from urine samples. The animals had been separated in 2 groups according with the streptomycin mark used in the treatment, group 1: streptomycin A and group 2: streptomycin B. The bovine controls had received any application from streptomycin. Samples of blood and urine of treated and controls bulls were collected in days -1, 0, 1, 2, 3, 5, 10, 15 and 25; considering the day of the treatment as day 0. A research for the detection of leptospira genetic material was realized in the urine of all bulls by PCR. It was observed that the streptomycin A ended leptospiruria in 24h after of the treatment. In the group of bulls treated with the streptomycin B, the end of leptospiruria was evidenced in 48h and 72h, after the treatment. In both treated groups, the serological reply presented a variation in the fall of antibodies titers, and streptomycin A was better in comparative performance with geométric means of the antibodies titers of the group that received streptomycin B, although by the Tukey Test the difference was no significant (P > 0.05). In the bovine controls the leptospiruria was intermittent and the average of the antibody titers of the treated bovines was lower than the average of the bovine controls, during all the experiments. The difference in the effect of different brands of streptomycin is possibly due to the quality of the substances produced in the laboratories.

KEY WORDS
Leptospira; bovine; streptomycin

INTRODUÇÃO

Nos bovinos as perdas econômicas produzidas pela leptospirose estão diretamente ou indiretamente relacionadas a aborto, queda na produção de leite, falhas reprodutivas e a custos relacionados à assistência veterinária, medicamentos, vacinas e testes laboratoriais (FAINE et al., 1999FAINE, S. Leptospira and leptospirosis. Melbourne: MedSci, 1999. 353p.), além de afetar significativamente o ciclo reprodutivo dos bovinos, e prejuízos com a elevação nos coeficientes de mortalidade dos rebanhos afetados.

A presença de Leptospira spp. em sêmen de touros, natural e experimentalmente infectados, já foi demonstrada, indicando a possibilidade de transmissão da leptospirose bovina pela monta natural ou pela inseminação artificial (SLEIGHT & WILLIAMS, 1961SLEIGHT, S.D. & WILLIAMS, J.A. Transmission of bovine leptospirosis by coition and artificial insemination. Journal of the American Veterinary Medical Association, v.138, p.151-152, 1961.; MAGAJEVSKI et al., 2004MAGAJEVSKI, F.S.; GIRIO, R.J.S.; MATHIAS, L.A.; RODRIGUES, L.H. Características do sêmen de touros sorologicamente reagentes a Leptospira interrognas sorovariedade hardjo. Revista Brasileira de Reprodução Animal, v.28, n.1, p.34-39, 2004.).

RODRIGUES et al. (2003)RODRIGUES, A.L.B.; GIRIO, R.J.S.; MAGAJEVSKI, F.S.; Estudo da sobrevivência da Leptospirainterrogans sorovar pomona em sêmen bovino experimentalmente contaminado. Revista Brasileira de Reprodução Animal, v.27, n.4, p.636-643, 2003. conseguiram demonstrar que o sorovar pomona pode manter sua virulência em amostras de sêmen que foram contaminadas com 5 x 106 leptospiras, após serem resfriadas a 4o C por 5h e diluídas sem antibiótico.

Quanto aos antibióticos, há relatos na literatura comprovando que as leptospiras podem suportar as concentrações empregadas no processo de congelamento, com ou sem redução em sua virulência (HOAG & BELL, 1955HOAG, W.G. & BELL, W.B. In vitro studies on the acetino of streptomycin upon five serotypes of leptospiragrown in two types of medium. American Journal of Veterinary Research, v.4, p.251–254, 1955.; BRYAN & BOLEY, 1975BRYAN, H. S.; BOLEY, L. E. STUDIES OF LEPTOSPIROSIS IN DOMESTIC ANIMALS. IV. SURVIVAL OF LEPTOSPIRA POMONA IN SEMEN EXTENDER. PROCEEDINGS OF THE AMERICAN VETERINARY MEDICAL ASSOCIATION, P.371, 1975.).

MIRAGLIA et al. (2003)MIRAGLIA, F.; Morais, Z.M.; Cortez, A.; Melville, P.A.; Marvullo, M.F.V.; Richtzenhain, L.J.; Visintin, J.A.; Vasconcellos, S.A. Comparison of four antibiotics for inactivating leptospires in bull semen diluted in egg yolk extender and experimentally inoculated with Leptospira santarosai serovar guaicura. Brazilian Journal of Microbiology, v.34, p.147-151, 2003., comparando a capacidade de quatro antibióticos, acrescidos ao diluidor de sêmen gema-citrato, concluiu que a associação penicilina e estreptomicina apresentou os melhores resultados na capacidade de destruir leptospiras, mas houve 2,0% (7/348) de cultivos positivos para leptospiras.

Nos Estados Unidos da América existe o "Certified Semen Services (CSS) Minimun Requirements for Disease Control of Semen Produced for Artificial Insemination", o qual determina um protocolo com os padrões mínimos para o monitoramento de saúde e doenças dos touros anteriormente à sua entrada, durante a quarentena e residência dos mesmos nas centrais de inseminação artificiais, a fim de evitar a transmissão de algumas doenças por meio do sêmen. No Brasil, o Colégio Brasileiro de Reprodução Animal recomenda que o animal que apresentar título igual ou superior a 100 na prova de soroaglutinação microscópica (SAM) somente poderá ser utilizado novamente para colheita de sêmen se for submetido ao tratamento com diidroestreptomicina ou estreptomicina na dose de 25 mg/kg de peso corpóreo, e apresentar resultado negativo na imunofluorescência direta da urina ou no cultivo em meio semi-sólido de Fletcher, após sete dias do último tratamento (BRASIL, 1979BRASIL, Ministério da Agricultura. Inscrição dos reprodutores doadores de sêmen. Capítulo IV: Da Inscrição dos Reprodutores Doadores de Sêmen, Seção III. Exigências Sanitárias. Instrução Normativa DFIMA nº 001/79, Brasília, p.2-22, 1979).

VAN EYS et al. (1989)VAN EYS, G.J.J.M.; GRAVEKAMP, C.; GERRITSEN, M.J.; QUINT, W.; CORNELISSEN, M.T.E.; TERSCHEGGET, J.; TERPSTRA, W.J. Detection of leptospiroses in urine by polymerase chain reaction. Journal of Clinical Microbiology, v.27, n.10, p.2258-262, 1989. concluíram em seus estudos que a sorologia não reflete necessariamente o estado de portador ou eliminador de leptospiras em bovinos. Embora a prova de SAM seja sensível, determinando o sorovar envolvido, algumas desvantagens podem ser observadas, entre elas, o fato de ser um teste indireto, não reconhecendo a presença de leptospira, mas sim a resposta imunológica do hospedeiro infectado, não indicando se a infecção é ativa (KEE et al., 1994KEE, S.; KIM, I.; CHOI, M.; CAANG, W. Detection of leptospiral DNA by PCR. Journal of Clinical Microbiology, v.32, n.4, p.1035-1039, 1994.).

Com a necessidade do desenvolvimento de métodos que oferecessem maior sensibilidade, especificidade e rapidez, técnicas de biologia molecular têm sido aplicadas para detectar leptospiras (GINGERAS et al., 1990GINGERAS, T.R.; RICHMAN, D.D.; KWOH, D.Y.; GUATELLI, J.C. Methodologies for in vitro nucleic acid amplification and their applications. Veterinary Microbiology, v.24, p.235-251, 1990.; PAUL, 1990PAUL, P. S. Applications of nucleic acid probes in veterinary infectious diseases. Veterinary Microbiology, v.24, p.409-417, 1990.).

O controle da leptospirose nos animais domésticos depende de um correto diagnóstico, de um tratamento apropriado e da implantação de medidas de manejo (HUHN et al., 1993HUHN, R. G.; HANSON, L. E.; KILLINGER, A. H.; CARDELLA, M. A. Immunity to Leptospirosis: Leptospira interrogans serotype Pomona bacterins in cattle. American Journal of Veterinary Research, v.36, p.59-65, 1993.). Em bovinos, a vacinação desempenha um importante papel no controle da leptospirose e deve ser associada a outras medidas de manejo, podendo com isso reduzir sensivelmente a prevalência de animais reagentes no rebanho (HODGES & DAY, 1987HODES, R.T. & DAY, A.M. Bovine leptospirosis: the effects on vaccination serological responses as determined by complement fixation on microscopic agglutination tests. New Zealend Veterinary Journal, v.35, p.61-64, 1987.; GERRITSEN et al., 1994GERRITSEN, M.J.; KOOPMANS, M.J.; DEKKER, T.C.E.M.; DE JONG, M.C.M.; MOERMAN, A.; OLYHOEK, T. Effectivetreatment with dihydroestreptomycin of naturally infected cows shedding Leptospira interrogans serovar hardjo subtype hardjobovis, American Journal of Veterinary Research, v.55, n.3, p.339-343, 1994.). No entanto, quando se tenta fazer o controle de animais positivos para leptospirose apenas com vacinação corre-se o risco de haver o aumento número de animais atingidos uma vez que a vacinação não elimina o estado de portador. Percebe-se então a importância do tratamento adequado dos animais que já se encontram positivos, antes ou durante a implantação de um esquema de vacinação em rebanhos.

A estreptomicina foi um dos primeiros antibióticos a ser utilizado para a terapia da leptospirose e é considerada, até hoje, uma das melhores opções de tratamento.

SANTOS et al. (2001)SANTOS, G.O.; CARDOSO, F.; VASCONCELLOS, S.A.; MORAIS, Z.M.; CORTEZ, A.; FÁVERO, A.C.M.; MIRAGLIA, F.; PINHEIRO, S.R.; AMOS, C.A.A. Emprego do Ceftiofur sódico ou da Estreptomicina para a terapia de leptospirose em hamsters experimentalmente infectados com o sorovar pomona. Arquivos do Instituto Biológico, São Paulo, v.68, n.1, p.1-8, 2001. empregaram estreptomicina para a terapia da leptospirose em hamsters (Mesocricetus auratus) experimentalmente infectados com L. interrogans sorovar pomona. Os resultados obtidos confirmaram a atuação da estreptomicina para o controle da leptospiremia e leptospirúria em uma única aplicação na concentração de 25 mg/kg de peso corpóreo. O ceftiofur sódico aplicado da mesma forma e concentração foi capaz de eliminar a infecção renal em 48 dos 50 animais inoculados.

Utilizando quatro esquemas de tratamento para leptospirose em 42 bovinos experimentalmente infectados, ALT et al. (2001)ALT, D.P.; ZUERNER, R. L.; BOLIN, C.A. Evaluation of antibiotics for treatment of cattle infected with Leptospira borgpetersenii serovar hardjo. Journal of the American Veterinary Medical Association, v.219, n.5, p.636-639, 2001. concluíram que a associação dihidroestreptomicina e penicilina G ainda é o melhor tratamento, embora outros antibióticos (oxitetraciclina, tilmicosin e ceftiofur) também apresentem bons resultados.

O objetivo desse trabalho foi avaliar a eficiência de duas marcas de antibióticos, que tem como princípio ativo a estreptomicina e que estão disponíveis no mercado como antibióticos polivalentes para o tratamento da leptospirose bovina. Os medicamentos em questão foram testados em sete touros naturalmente infectados, utilizando-se técnicas de diagnóstico tradicionais como a soroaglutinação microscópica, isolamento e cultivo em meio semi-sólido e a técnica de biologia molecular conhecida como PCR.

MATERIAL E MÉTODOS

O trabalho foi realizado com 14 touros adultos (Bos taurus indicus), em quarentena numa central de inseminação artificial (CIA) localizada no Estado de São Paulo. Foram escolhidos animais sorologicamente reagentes à Leptospira interrogans sorovar Hardjo na prova de soroaglutinação microscópica (SAM), o título mínimo para a seleção desses animais foi de 800, um dia antes do início do experimento. Além de reagentes para o sorovar Hardjo, os animais escolhidos apresentaram também a formação de discos de Dinger, que são indicativos de cultivo de bactérias do gênero leptospira, a partir do isolamento na urina em meio de cultura.

Os animais selecionados foram separados em quatro grupos, o primeiro com 4 animais, grupo 1: tratados com a estreptomicina da marca A e o segundo, com 3 animais, grupo 2: tratados com a estreptomicina da marca B. Nestes grupos foram aplicados dose única de 25 mg de estreptomicina por kg de peso corpóreo. Para controle do tratamento foram utilizados 2 grupos, o 1º, controle 1: com 4 animais e o 2º, controle 2: com 3 animais, que apresentaram títulos sorológicos de 800 contra o sorovar Hardjo na prova de SAM. Nos animais dos grupos controles não se utilizou a pesquisa na urina, somente o monitoramento sorológico. Na urina dos animais do grupo tratado foi realizada a reação em cadeia da polimerase (PCR) e o isolamento com inoculação de hamsters (Mesocricetos auratus). Os animais foram monitorados durante 25 dias, considerando-se o dia do tratamento como dia 0. Foram obtidas amostras de sangue e urina nos dias -1, 0, 1, 2, 3, 5, 10, 15 e 25. As amostras de sangue, grupo tratado e controle, foram dessoradas e submetidas a prova de SAM, as amostras de urina, do grupo tratado, foram submetidas às técnicas de cultivo de leptospira e de PCR.

Para a pesquisa de anticorpos foi utilizada a prova de SAM, diluindo-se os soros em solução tamponada de Sörensen, sendo a diluição inicial de 1/50, de acordo com SANTA ROSA (1970)SANTA ROSA, C.A. Diagnóstico laboratorial das leptospiroses. Revista de Microbiologia, v.1, p.97-109, 1970.

Para pesquisa de leptospira na urina, foram empregadas as técnicas de inoculação em hamsters (2,0 mL da urina de touro reagente por via intraperitoneal); cultivo de leptospira em meio de cultura; e PCR.

Foram utilizados 63 hamsters inoculados com urina supostamente contaminada e 18 hamsters como controle, dos 63 hamsters inoculados, 36 foram para o grupo A e 27 para o grupo B, os respectivos grupos controle foram constituídos de nove hamsters cada. Os hamsters foram mantidos em instalações apropriadas no infectório do Departamento de Medicina Veterinária Preventiva e Reprodução Animal da Faculdade de Ciências Agrárias e Veterinárias, Unesp, Campus de Jaboticabal. Decorridos 5 dias da inoculação da urina, todos os hamsters, (inoculados e controles) foram anestesiados em uma câmara com vapores de éter etílico; amostras de sangue foram colhidas por punção cardíaca (para pesquisa de anticorpos contra o sorovar Hardjo) e após assepsia da região abdominal, procedeu-se a laparotomia mediana para retirada de fragmentos de aproximadamente um grama de rins e fígado de cada hamsters, esses fragmentos foram macerados e suspendidos em 2 mL de solução de Sörense estéril, após homogeneização, 1,5 mL de cada suspensão foi utilizada para o cultivo em meio Fletcher.

O cultivo de leptospira foi realizado pela semeadura de 1,5 mL de material (urina dos touros, suspensão de rim e suspensão de fígado dos hamsters sacrificados após cinco dias da inoculação da urina dos touros) em meio semi-sólido de Fletcher (Difco) acrescido de 5-fluorouratil, na proporção de 400 μL/mL de meio, nas primeiras 24h de cultivo, seguido de repicagem e cultivo em meio livre de antibiótico. Após a semeadura, os tubos foram incubados à temperatura de 28° C durante 12 semanas, observando-se a ocorrência de discos de Dinger e realizando-se leituras semanais em microscopia de campo escuro, com objetiva de 40x e ocular de 15x.

A extração do material genético (DNA) das amostras foi realizado por lise enzimática com proteinase K, seguida de fenol-clorofórmio-álcool (25/24/1) isoamílico (SAMBROOK et al., 1989SAMBROOK, J.; FRITSCH, E.F.; MANIATIS, T. Molecular cloning: alaboratory manual. New York: Cold Spring Harbor Press, 1989. 957p.) em microtubos de 1.500 μL.

Os oligonucleotídeos iniciadores escolhidos foram o Lep 1 (5'GGCGGCGCGTCTTAAACATG 3') e Lep 2 (3' TTAGAACGAGTTACCCCCCTT 5') descritos por MERIEM et al. (1992). A amplificação das amostras de DNA foi realizada em microtubos de 500 μL, com volume final de 50 μL, de acordo com o protocolo de MERIEM et al. (1992). Inicialmente foi realizada a desnaturação da fita, utilizando a temperatura de 94º C por 5min, a seguir foram empregados 29 ciclos: Desnaturação do DNA: 94º C/60seg. Anelamento dos “primers”: 63º C/90Seg. Polimerização do DNA: 72º C/120seg, Extensão final: 72º C/10min.

A visualização do produto amplificado (330 pares de base) foi realizada por eletroforese em gel de agarose a 2,0% (p/v), utilizando-se tampão de corrida TBE 0,5 X (0,04 M tris-acetato e 0,001 M EDTA, pH 8,0), segundo SAMBROOK et al. (1989)SAMBROOK, J.; FRITSCH, E.F.; MANIATIS, T. Molecular cloning: alaboratory manual. New York: Cold Spring Harbor Press, 1989. 957p..

RESULTADOS

Na Tabela 1 apresentamos os resultados da reação em cadeia da polimerase (PCR), dos isolamentos de Leptospira em meio de cultivo semi-sólido da urina de cada touro sororeagente submetido ao tratamento com estreptomicina das marcas A ou B, e da cultura em meio semi-sólido de Fletcher das amostras de rins e fígados dos hamsters inoculados com a urina dos touros. Podese observar nessa tabela que a partir do terceiro dia após o tratamento não foi possível detectar material genético de leptospira pela técnica de PCR em nenhuma das amostras de urina. Porém pelo cultivo em meio semi-sólido, da urina dos touros foi possível isolar leptospira até o 3º dia do tratamento com os dois antimicrobianos utilizados. Os resultados do cultivo para leptospira a partir dos rins e fígados dos hamsters inoculados com a urina dos touros sorologicamente reagentes mostraram que apenas nos animais do grupo 1, ou seja, tratados com a estreptomicina A, foi possível o isolamento de leptospira. Nos rins e fígados dos hamsters dos grupos controles as culturas bacteriológicas foram negativas.

Tabela 1
Resultados do PCR da urina, do isolamento da leptospira na urina dos touros e do isolamento por passagem em hamsters.

Antes do tratamento os animais dos dois grupos apresentaram título sorológico de 800, após a aplicação da estreptomicina as médias geométricas dos títulos sorológicos foram decrescentes a partir do 1º dia após o tratamento, nos touros que receberam a estreptomicina A, já no grupo que foi tratado com a estreptomicina B os títulos começaram a cair apenas no 2º dia após o tratamento (Fig. 1). No entanto pelo Teste de Tukey as médias não diferiram entre si (P > 0,05) (Tabela 2).

Fig. 1
Gráfico do resultado comparativo das médias de títulos sorológicos contra o sorovar Hardjo dos animais tratados com as estreptomicinas das marcas A e B. Jaboticabal, SP. 2003. Médias Geométricas (=antilogaritmo da Slog (x)/4).
Tabela 2
Valores médios e resultados da análise de variância entre os tratamentos com estreptomicina A e estreptomicina B (dados transformados em "log x 1").

Analise de variância do delineamento inteiramente casualizado em parcelas subdivididas no tempo ("Split plot in time"), tendo como dois tratamentos principais (parcelas) os grupos tratados com estreptomicina A e estreptomicina B, e sete tratamentos secundários (subparcelas) as datas experimentais.

Quando são comparadas as médias dos títulos sorológicos dos animais tratados com as médias dos seus respectivos grupos controle, percebe-se que quando os animais são tratados, os títulos sorológicos contra o sorovar Hardjo decresceram em um padrão constante, inicial aos não tratados, atingindo os títulos mais baixos entre 10 e 15 dias após a aplicação do medicamento (Fig. 2 e Fig. 3). O que é comprovado pela análise do Teste de Tukey, que permite observar uma diferença significativa entre as médias dos títulos dos animais tratados e tratados, principalmente após 15 dias do tratamento (Tabela 3 e Tabela 4).

Fig. 2
Gráfico do resultado comparativo das médias de títulos sorológicos contra o sorovar Hardjo dos animais tratados com a estreptomicina da marca A e do seu respectivo grupo controle. Jaboticabal, SP. 2003. Médias Geométricas (=antilogaritmo da Slog (x)/4)
Fig. 3
Gráfico do resultado comparativo das médias de títulos sorológicos contra o sorovar Hardjo dos animais tratados com a estreptomicina da marca B e do seu respectivo grupo controle. Jaboticabal, SP. 2003. Médias Geométricas (=antilogaritmo da Slog (x)/4).
Tabela 3
Valores médios e resultados da análise de variância entre os tratamentos com estreptomicina A e respectivo controle (dados transformados em "log x 1").
Tabela 4
Valores médios e resultados da análise de variância entre os tratamentos com estreptomicina B e respectivo controle (dados transformados em "log x 1").
Fig. 4
Resultado da PCR para amostras de urina dos touros sorologicamente reagentes e tratados com a estreptomicina A. 1 e 21) Padrão de peso molecular em escala ascendente de 100pb; 2-7) touro 1A, colheita dos dias -1, 0, 1, 2, 3, 5; 8-13) touro 2A, colheitas dos dias -1, 0, 1, 2, 3, 5; 14-18, 22) touro 3A, colheitas dos dias -1, 0, 1, 2, 3, 5; 23-28) touro 4A, colheitas dos dias -1, 0, 1, 2, 3, 5; 29) Controle positivo; 30) Controle negativo.

Os resultados da prova de PCR para as amostras de urina dos touros sorologicamente reagentes à Leptospira interrogans sorovar Hardjo e tratados com as estreptomicinas das marcas A e B são apresentadas nas Fig. 4 e 5, respectivamente.

Fig. 5
Resultado da PCR para amostras de urina dos touros sorologicamente reagentes e tratados com a estreptomicina B. 1 e 15) Padrão de peso molecular em escala ascendente de 100pb; 2-6) touro 1B, colheitas dos dias –1, 0, 1, 2, 3; 7-11) touro 2B, colheitas dos dias -1, 0, 1, 2, 3; 12, 13, 16, 17, 18) touro 3B, colheitas dos dias -1, 0, 1, 2, 3; 14 e 19) Controle positivo; 20) Controle negativo.

DISCUSSÃO

Com relação às médias geométricas dos títulos sorológicos para o sorovar Hardjo, verificou-se que a partir da aplicação da estreptomicina da marca A houve uma queda de 50% dos títulos, resultados não evidenciados nos touros que receberam a estreptomicina da marca B. Essa queda dos títulos sorológicos após tratamento com estreptomicina pode acontecer nos casos de leptospiremia ou nos casos de infecção crônica de bovinos debilitados, comprovações parecidas foram verificadas por GERRITSEN et al. (1994)GERRITSEN, M.J.; KOOPMANS, M.J.; DEKKER, T.C.E.M.; DE JONG, M.C.M.; MOERMAN, A.; OLYHOEK, T. Effectivetreatment with dihydroestreptomycin of naturally infected cows shedding Leptospira interrogans serovar hardjo subtype hardjobovis, American Journal of Veterinary Research, v.55, n.3, p.339-343, 1994. nos primeiros 30 dias após infecção pelo sorovar Hardjobovis. No entanto, a condição de queda dos títulos sorológicos detectados pela SAM não dá a garantia de ausência de infecção renal, para que isso aconteça precisa tratar e monitorar adequadamente a fonte de infecção do rebanho bovino (HANSON, 1982HANSON, L.E. Leptospirosis in domestic animals: The puplic health perspective. Journal of the American Veterinary Medical Association, v.181, n.12, p.1505– 1509, 1982.).

O controle da leptospirúria em bovinos, por meio de um recurso terapêutico massal, aplicado simultaneamente a doentes, portadores e comunicantes, seria de grande valor no controle da leptospirose. A estreptomicina apresenta facilidade de penetração renal o suficiente para destruir as leptospiras presentes nos túbulos renais, devido a sua excreção urinária sendo a maior parte por filtração glomerular como demonstrado por GERRITSEN et al. (1994)GERRITSEN, M.J.; KOOPMANS, M.J.; DEKKER, T.C.E.M.; DE JONG, M.C.M.; MOERMAN, A.; OLYHOEK, T. Effectivetreatment with dihydroestreptomycin of naturally infected cows shedding Leptospira interrogans serovar hardjo subtype hardjobovis, American Journal of Veterinary Research, v.55, n.3, p.339-343, 1994., em bovinos infectados que receberam dose única de 25 mg/kg de peso corpóreo.

A estreptomicina da marca A conseguiu em 50% dos touros causar um bloqueio na leptospirúria a partir do 2º dia após o tratamento (touros 1 e 4). Entretanto, nos outros 50% dos touros a eliminação da leptospirúria somente foi possível de concretizar após no 3º dia do tratamento (touros 2 e 3). Já na maioria dos touros tratados com a estreptomicina B a leptospirúria ocorreu de forma intermitente até o 3º dia após a aplicação.

Nas situações observadas acima fica caracterizado que a eliminação da excreção do sorovar Hardjo pela urina foi entre 48 e 72h após a aplicação da estreptomicina por via intramuscular. Resultados semelhantes foram observados por GERRITSEN et al. (1994)GERRITSEN, M.J.; KOOPMANS, M.J.; DEKKER, T.C.E.M.; DE JONG, M.C.M.; MOERMAN, A.; OLYHOEK, T. Effectivetreatment with dihydroestreptomycin of naturally infected cows shedding Leptospira interrogans serovar hardjo subtype hardjobovis, American Journal of Veterinary Research, v.55, n.3, p.339-343, 1994. que estudando bovinos infectados naturalmente detectaram DNA de leptospiras na urina desses animais por até 48 horas após o tratamento.

A despeito dos resultados obtidos, no presente estudo, discordarem dos observados por GERRITSEN et al. (1994)GERRITSEN, M.J.; KOOPMANS, M.J.; DEKKER, T.C.E.M.; DE JONG, M.C.M.; MOERMAN, A.; OLYHOEK, T. Effectivetreatment with dihydroestreptomycin of naturally infected cows shedding Leptospira interrogans serovar hardjo subtype hardjobovis, American Journal of Veterinary Research, v.55, n.3, p.339-343, 1994. não se pode descartar a possibilidade das origens diferentes das matérias primas utilizadas pelos fabricantes na produção das estreptomicinas comerciais. Isso se torna ainda mais importante, quando se constata que a despeito de ser empregado um mesmo princípio ativo antimicrobiano foram obtidos diferentes resultados de acordo com a procedência do medicamento.

Com o intuito da verificação de ocorrência do bloqueio da indução de anticorpos na infecção optou-se pela constituição de um grupo controle com touros sororeagentes que não foram tratados com as duas marcas de estreptomicina os quais foram monitorados por meio da prova de SAM. Procedimento este defendido por KEE et al. (1994)KEE, S.; KIM, I.; CHOI, M.; CAANG, W. Detection of leptospiral DNA by PCR. Journal of Clinical Microbiology, v.32, n.4, p.1035-1039, 1994. quando mencionam que o monitoramento sorológico pode caracterizar a resposta imunológica devido à infecção, e que a pesquisa do agente por meios diretos de isolamentos pode sofrer ação de fatores bloqueadores de crescimento, o que pode induzir a um diagnóstico não conclusivo.

O procedimento adotado na aplicação de dose única de 25 mg/kg de peso corpóreo de estreptomicina para o controle da leptospirúria nos touros foi eficiente e está de acordo com as recomendações de FAINE et al. (1999)FAINE, S. Leptospira and leptospirosis. Melbourne: MedSci, 1999. 353p. e também pelos resultados obtidos por GERRITSEN et al. (1994)GERRITSEN, M.J.; KOOPMANS, M.J.; DEKKER, T.C.E.M.; DE JONG, M.C.M.; MOERMAN, A.; OLYHOEK, T. Effectivetreatment with dihydroestreptomycin of naturally infected cows shedding Leptospira interrogans serovar hardjo subtype hardjobovis, American Journal of Veterinary Research, v.55, n.3, p.339-343, 1994. e por SANTOS et al. (2001)SANTOS, G.O.; CARDOSO, F.; VASCONCELLOS, S.A.; MORAIS, Z.M.; CORTEZ, A.; FÁVERO, A.C.M.; MIRAGLIA, F.; PINHEIRO, S.R.; AMOS, C.A.A. Emprego do Ceftiofur sódico ou da Estreptomicina para a terapia de leptospirose em hamsters experimentalmente infectados com o sorovar pomona. Arquivos do Instituto Biológico, São Paulo, v.68, n.1, p.1-8, 2001.. No entanto, quanto à dose e à freqüência de aplicação da diidroestreptomicina ou da estreptomicina no controle da leptospirúria, estudos realizados por HODES & DAY (1987)HODES, R.T. & DAY, A.M. Bovine leptospirosis: the effects on vaccination serological responses as determined by complement fixation on microscopic agglutination tests. New Zealend Veterinary Journal, v.35, p.61-64, 1987. e por HUHN et al. (1993)HUHN, R. G.; HANSON, L. E.; KILLINGER, A. H.; CARDELLA, M. A. Immunity to Leptospirosis: Leptospira interrogans serotype Pomona bacterins in cattle. American Journal of Veterinary Research, v.36, p.59-65, 1993. revelaram que, para os dois antimicrobianos aludidos, uma única aplicação pela via intramuscular na dose de 25 mg/kg de peso corpóreo é suficiente para destruir as leptospiras localizadas nos túbulos renais. Ainda, como complementação no tratamento, ALT et al. (2001)ALT, D.P.; ZUERNER, R. L.; BOLIN, C.A. Evaluation of antibiotics for treatment of cattle infected with Leptospira borgpetersenii serovar hardjo. Journal of the American Veterinary Medical Association, v.219, n.5, p.636-639, 2001. recomendam a associação com a penicilina G no sucesso para eliminação do portador renal e MIRAGLIA et al. (2003)MIRAGLIA, F.; Morais, Z.M.; Cortez, A.; Melville, P.A.; Marvullo, M.F.V.; Richtzenhain, L.J.; Visintin, J.A.; Vasconcellos, S.A. Comparison of four antibiotics for inactivating leptospires in bull semen diluted in egg yolk extender and experimentally inoculated with Leptospira santarosai serovar guaicura. Brazilian Journal of Microbiology, v.34, p.147-151, 2003. para melhor proteção do sêmen bovino utilizado na inseminação artificial.

CONCLUSÃO

As médias dos títulos sorológicos dos grupos tratados com estreptomicina foram menores do que as médias dos títulos do grupo controle. A estreptomicina da marca A apresentou um melhor desempenho quando comparada com as médias dos títulos sorológicos do grupo que recebeu tratamento com a estreptomicina da marca B, tendo iniciado o declínio das médias dos títulos dois dias antes, embora pelo Teste de Tukey as médias não tenham apresentado diferença significativa. Os resultados do cultivo e isolamento de leptospira na urina dos touros tratados tanto com a estreptomicina da marca A quanto da B mostram que as duas marcas conseguiram eliminar a leptospirúria a partir do 3º dia após o tratamento.

Com esses resultados constata-se que embora a estreptomicina seja uma excelente opção para o tratamento das leptospiroses, deve-se verificar a procedência, idoneidade e pureza dos diversos produtos comerciais.

REFERÊNCIAS BIBLIOGRÁFICAS

  • ALT, D.P.; ZUERNER, R. L.; BOLIN, C.A. Evaluation of antibiotics for treatment of cattle infected with Leptospira borgpetersenii serovar hardjo Journal of the American Veterinary Medical Association, v.219, n.5, p.636-639, 2001.
  • BRASIL, Ministério da Agricultura. Inscrição dos reprodutores doadores de sêmen. Capítulo IV: Da Inscrição dos Reprodutores Doadores de Sêmen, Seção III. Exigências Sanitárias. Instrução Normativa DFIMA nº 001/79, Brasília, p.2-22, 1979
  • BRYAN, H. S.; BOLEY, L. E. STUDIES OF LEPTOSPIROSIS IN DOMESTIC ANIMALS. IV. SURVIVAL OF LEPTOSPIRA POMONA IN SEMEN EXTENDER. PROCEEDINGS OF THE AMERICAN VETERINARY MEDICAL ASSOCIATION, P.371, 1975.
  • FAINE, S. Leptospira and leptospirosis Melbourne: MedSci, 1999. 353p.
  • GERRITSEN, M.J.; KOOPMANS, M.J.; DEKKER, T.C.E.M.; DE JONG, M.C.M.; MOERMAN, A.; OLYHOEK, T. Effectivetreatment with dihydroestreptomycin of naturally infected cows shedding Leptospira interrogans serovar hardjo subtype hardjobovis, American Journal of Veterinary Research, v.55, n.3, p.339-343, 1994.
  • GINGERAS, T.R.; RICHMAN, D.D.; KWOH, D.Y.; GUATELLI, J.C. Methodologies for in vitro nucleic acid amplification and their applications. Veterinary Microbiology, v.24, p.235-251, 1990.
  • HANSON, L.E. Leptospirosis in domestic animals: The puplic health perspective. Journal of the American Veterinary Medical Association, v.181, n.12, p.1505– 1509, 1982.
  • HOAG, W.G. & BELL, W.B. In vitro studies on the acetino of streptomycin upon five serotypes of leptospiragrown in two types of medium. American Journal of Veterinary Research, v.4, p.251–254, 1955.
  • HODES, R.T. & DAY, A.M. Bovine leptospirosis: the effects on vaccination serological responses as determined by complement fixation on microscopic agglutination tests. New Zealend Veterinary Journal, v.35, p.61-64, 1987.
  • HUHN, R. G.; HANSON, L. E.; KILLINGER, A. H.; CARDELLA, M. A. Immunity to Leptospirosis: Leptospira interrogans serotype Pomona bacterins in cattle. American Journal of Veterinary Research, v.36, p.59-65, 1993.
  • KEE, S.; KIM, I.; CHOI, M.; CAANG, W. Detection of leptospiral DNA by PCR. Journal of Clinical Microbiology, v.32, n.4, p.1035-1039, 1994.
  • MAGAJEVSKI, F.S.; GIRIO, R.J.S.; MATHIAS, L.A.; RODRIGUES, L.H. Características do sêmen de touros sorologicamente reagentes a Leptospira interrognas sorovariedade hardjo Revista Brasileira de Reprodução Animal, v.28, n.1, p.34-39, 2004.
  • MIRAGLIA, F.; Morais, Z.M.; Cortez, A.; Melville, P.A.; Marvullo, M.F.V.; Richtzenhain, L.J.; Visintin, J.A.; Vasconcellos, S.A. Comparison of four antibiotics for inactivating leptospires in bull semen diluted in egg yolk extender and experimentally inoculated with Leptospira santarosai serovar guaicura Brazilian Journal of Microbiology, v.34, p.147-151, 2003.
  • NATIONAL ASSOCIATION OF ANIMAL BREEDERS. Certified semenservices minimun requirementes for disease control of semen produced for artificial insemination, Disponível em: < http://www.naab-css.org.html>. Columbia: NAAB. Acesso em: 15 jul. 2002.
    » http://www.naab-css.org.html
  • PAUL, P. S. Applications of nucleic acid probes in veterinary infectious diseases. Veterinary Microbiology, v.24, p.409-417, 1990.
  • RODRIGUES, A.L.B.; GIRIO, R.J.S.; MAGAJEVSKI, F.S.; Estudo da sobrevivência da Leptospirainterrogans sorovar pomona em sêmen bovino experimentalmente contaminado. Revista Brasileira de Reprodução Animal, v.27, n.4, p.636-643, 2003.
  • SAMBROOK, J.; FRITSCH, E.F.; MANIATIS, T. Molecular cloning: alaboratory manual New York: Cold Spring Harbor Press, 1989. 957p.
  • SANTA ROSA, C.A. Diagnóstico laboratorial das leptospiroses. Revista de Microbiologia, v.1, p.97-109, 1970.
  • SANTOS, G.O.; CARDOSO, F.; VASCONCELLOS, S.A.; MORAIS, Z.M.; CORTEZ, A.; FÁVERO, A.C.M.; MIRAGLIA, F.; PINHEIRO, S.R.; AMOS, C.A.A. Emprego do Ceftiofur sódico ou da Estreptomicina para a terapia de leptospirose em hamsters experimentalmente infectados com o sorovar pomona Arquivos do Instituto Biológico, São Paulo, v.68, n.1, p.1-8, 2001.
  • SLEIGHT, S.D. & WILLIAMS, J.A. Transmission of bovine leptospirosis by coition and artificial insemination. Journal of the American Veterinary Medical Association, v.138, p.151-152, 1961.
  • VAN EYS, G.J.J.M.; GRAVEKAMP, C.; GERRITSEN, M.J.; QUINT, W.; CORNELISSEN, M.T.E.; TERSCHEGGET, J.; TERPSTRA, W.J. Detection of leptospiroses in urine by polymerase chain reaction. Journal of Clinical Microbiology, v.27, n.10, p.2258-262, 1989.

Datas de Publicação

  • Publicação nesta coleção
    15 Abr 2022
  • Data do Fascículo
    Apr-Jun 2005

Histórico

  • Recebido
    04 Jun 2005
  • Aceito
    30 Jun 2005
Instituto Biológico Av. Conselheiro Rodrigues Alves, 1252 - Vila Mariana - São Paulo - SP, 04014-002 - São Paulo - SP - Brazil
E-mail: arquivos@biologico.sp.gov.br