Accessibility / Report Error

DETECÇÃO DE GENES DE RESISTÊNCIA ANTIMICROBIANA EM CROMOSSOMOS E PLASMÍDEOS DE STAPHYLOCOCCUS SPP.

DETECTION OF ANTIMICROBIAL RESISTANCE GENES ON THE CHROMOSOME AND PLASMIDS FROM STAPHYLOCOCCUS SPP

RESUMO

Este trabalho teve por objetivo analisar o uso da prensa francesa para se adquirir material genético de estafilococos e detectar possíveis genes de resistência cromossomais e plasmidiais aos antimicrobianos oxacilina, gentamicina, canamicina e vancomicina. O método da difusão de discos em ágar foi realizado, inicialmente, para 50 linhagens de estafilococos e a susceptibilidade antimicrobiana foi confirmada por meio de Reação em Cadeia da Polimerase (PCR). Os resultados obtidos pelo antibiograma constataram alta susceptibilidade para gentamicina e canamicina (4%) e oxacilina (8%). Todas as linhagens foram susceptíveis à vancomicina. O DNA bacteriano foi obtido por lise física a partir da prensa francesa. Os genes mecA e aph3’IIIa foram detectados no cromossomo dos estafilococos e o gene aac(6’) Ie + aph (2") foi observado tanto no cromossomo como no plasmidio destas bactérias. Pelos resultados pode-se concluir que a metodologia utilizada para a extração de DNA genômico, por meio da prensa francesa, foi barata e eficiente, pois possibilitou a detecção por PCR e a localização, por ultracentrifugação, de genes de resistência em estafilococos.

PALAVRAS-CHAVE
Rebanhos leiteiros; aminoglicosídeos; mecA; PCR; ultracentrifugação

ABSTRACT

The main of the present study was analyze the use of a french press device to obtain genetic material from staphylococci and to detect genes involved with chromosomal and plasmid resistance to the following antimicrobial drugs: oxacillin, gentamicin, kanamycin and vancomycin. The agar disc diffusion method was conducted initially for 50 strains and the bacterial susceptibility was confirmed by means of PCR reactions. The results from the antibiogram method revealed high sensibility to gentamicin and kanamycin (4%) and oxacillin (8%). All strains were susceptible to vancomycin. The DNA from the bacteria was obtained by means of physical lyses using a french press device. The genes mecA and aph’3 – IIIa were detected on the staphylococci chromosome and the gene aac(6’)Ie + aph(2’’) was observed either in the chromosome and in the plasmid content of the staphylococci analyzed. Based on the obtained results one can conclude that the methodology used to extract the genomic genetic material using the french press device was efficient and allowed a simple method to detect by PCR and to locate by ultracentrifugation, the staphylococci antibiotic resistance genes.

KEY WORDS
Dairy cattle; aminoglycosides; mecA; PCR; ultracentrifugation

INTRODUÇÃO

Os estafilococos são microrganismos encontrados na pele e nas mucosas dos seres humanos e de outros mamíferos. São bactérias patogênicas que podem causar infecções cutâneas, infecções oportunistas e até mesmo septicemias fatais (MURRAY et al., 1998MURRAY, P.R.; ROSENTHAL, K.S.; KOBAYASHI, G.S.; PFLLER, M.A. Microbiogia médica. 3.ed. São Paulo: Guanabara Koogan, 1998. v.1, 604p.). São considerados importantes causadores de mastite em rebanhos leiteiros visto que apresentam vários fatores de virulência que contribuem para sua persistência no tecido mamário (SANTOS et al., 2003SANTOS, F.G.B.; MOTA, R.A.; SILVEIRA-FILHO, V.M.; SOUZA, H.M.; OLIVEIRA, M.B.M.; JOHNER, J.M.Q.; LEAL, N.C.; ALMEIDA, A.M.P.; LEAL-BALBINO, T.C. Tipagem molecular de Staphylococcus aureus isolados do leite de vacas com mastite subclínica e equipamentos de ordenha procedentes do estado de Pernambuco. Napgama, São Paulo, v.6, n.1, p.19-23, 2003.). Nos últimos anos, algumas espécies coagulase negativas e, em especial os Staphylococcus aureus, têm merecido atenção especial devido à emergência de linhagens resistentes a múltiplos antibióticos (MANIATIS et al., 1997MANIATIS A.N.; TROUGAKOS I.P.; KATSANIS, G.; PALERMO, J.; MANIATIS, N.A., LEGAKIS, N.J. Changing patterns of bacterial nosocomial infections: a nine-year study in a general hospital. Chemotherapy, v.43, p.69-76, 1997.).

Os dois principais fatores envolvidos no desenvolvimento da resistência aos antibióticos em bactérias são a pressão seletiva e a presença de genes de resistência (WITTE, 2000WITTE, W. Ecological impact of antibiotic use in animals on different complex microflora: environment. International Journal of Antimicrobial Agents, v.14, n.4, p.321-325, 2000.). Os genes que codificam resistência aos antimicrobianos podem estar localizados no cromossomo ou nos plasmídios. O DNA cromossômico é relativamente mais estável, enquanto que o DNA plasmidial é facilmente transportado de uma linhagem para outra por conjugação bacteriana, permitindo uma transferência de genes em conjunto incluindo os de resistência a antimicrobianos (KONEMAN et al., 1997KONEMAN, E.W.; ALLEN, S.D.; JANDA, W.M.; SCHRECKENBERGER, P.C.; WINN, J.R. Color Atlas and textbook of diagnostic microbiology. 5.th.ed. Philadelphia: Lippincott/ Willians & Wilkins, 1997. 1395p.).

O principal mecanismo de resistência aos aminoglicosídeos em estafilococos é a inativação das drogas por enzimas celulares modificadoras dos aminoglicosídeos. Diversos loci distintos que codificam tais enzimas modificadoras foram caracterizados em estafilococos. Clinicamente, o mais importante destas regiões codifica atividades para as enzimas acetiltransferase (AAC), adenililtransferase (ANT) e fosfotransferase (APH). Os aminoglicosídeos,modificados em grupos aminos pela enzima AAC ou em grupos hidroxilas pela enzima ANT ou APH, perdem a habilidade de se ligar aos ribossomos e assim não inibem mais a síntese protéica das células bacterianas (PAULSEN et al., 1997PAULSEN, I.T.; FIRTH, N.; SKURRAY, R.A. Resistance to antimicrobial agents other than b-lactams. In: CROSSLEY, K.B.; ARCHER, G.L., (Eds.) The Staphylococci in Human Disease. New York: Churchill Livingstone, 1997. p.175-212.).

A resistência para a gentamicina em estafilococos é mediada pela atividade de uma enzima bifuncional que tem atividade AAC (6’) e APH (2"). Os genes aac (6’)-Ie + aph (2") que codificam para esta enzima bifuncional são transportados no transposon Tn4001. Elementos semelhantes ao Tn4001 estão amplamente distribuídos entre S. aureus e estafilococos coagulase negativos (ECN). O Tn4001 foi encontrado na família de plasmídios pSK1, plasmídios conjugativos como o pSK23 e em outros locais do cromossomo (PAULSEN et al., 1997PAULSEN, I.T.; FIRTH, N.; SKURRAY, R.A. Resistance to antimicrobial agents other than b-lactams. In: CROSSLEY, K.B.; ARCHER, G.L., (Eds.) The Staphylococci in Human Disease. New York: Churchill Livingstone, 1997. p.175-212.).

A resistência para a canamicina em estafilococos é detectada pela presença da enzima ANT (4’)-I codificada pelo gene ant (4’)-Ia. Este gene muitas vezes é carregado em plasmídios pequenos e outras vezes pode estar integrado a plasmídios conjugativos maiores como o pSK41 e, subseqüentemente, na região mec do cromossomo de alguns isolados de S. aureus (PAULSEN et al., 1997PAULSEN, I.T.; FIRTH, N.; SKURRAY, R.A. Resistance to antimicrobial agents other than b-lactams. In: CROSSLEY, K.B.; ARCHER, G.L., (Eds.) The Staphylococci in Human Disease. New York: Churchill Livingstone, 1997. p.175-212.). A resistência à neomicina e canamicina conferidas pela enzima APH(3’)-IIIa também já foi descrita em estafilococos. O gene aph3’-IIIa responsável por este fenótipo é transportado pelo transposon Tn5405 o qual pode estar localizado tanto no cromossomo como em plasmídios (DERBISE et al., 1996DERBISE, A.; DYKE, K.G.H.; EL SOLH, N. Characterization of a Staphylococcus aureus transposon Tn5405, located within Tn5404 carrying the aminoglycoside resistance genes, aphA-3 and aadE. Plasmid, v.35, n.3, p.74-88, 1996.).

A resistência à oxacilina é fenotipicamente associada com a presença de uma proteína fixadora de penicilina (PBP 2a), ausente nos estafilococos susceptíveis. Esta proteína tem baixa afinidade de ligação para antibióticosβ-lactâmicos. Trata-se de uma transpeptidase que pode assumir a síntese da parede celular bacteriana durante o tratamento com o antibiótico, quando normalmente PBPs são inativadas pela ligação com os anéis de compostos β-lactâmicos (BRAKSTAD; MAELAND, 1997BRAKSTAD, O.G.; MAELAND, J.A. Mechanisms of methicillin resistance in staphylococci. APMIS, v.105, n.4, p.264-276, 1997.). A PBP 2a é codificada pelo gene mecA que juntamente com dois genes regulatórios, o mecI e o mecRI, constituem o complexo cromossômico mec estafilocócico (SCCmec), imprescindível na determinação da resistência à meticilina nos S. aureus (BERGER-BÄCHI; ROHRER, 2002BERGER-BÄCHI, B.; ROHRER, S. Factors influencing methicillin resistance in staphylococci. Archives of Microbiology, v.178, n.3, p.165-171, 2002.). Esta resistência aparece em mais de 90% dos isolados clínicos de S. aureus meticilina resistentes (MRSA) (HIRAMATSU, 1995HIRAMATSU, K. Molecular evolution of MRSA. Microbiology and Immunology, v.39, n.8, p.531-543, 1995.).

A amplificação de DNA a partir de “primers” específicos é muito útil para se estabelecer o perfil de resistência das linhagens mediante o uso de diversos antimicrobianos. A detecção de genes de resistência em microrganismos isolados de amostras clínicas permite orientar a terapia e estabelece um prognóstico após sucessivas culturas positivas. Os testes genéticos podem ser usados como referência para avaliar novas técnicas que determinam a referida resistência (TENOVER et al., 1995TENOVER, F.C.; POPOVIC, T.; OLSVIK, O. Genetic methods for detecting antibacterial resistance genes. In: MURRAY, P.R. (Ed.). Manual of clinical microbiology. 6th.ed. Washington: American Society for Microbiology, 1995. p.1368-1378.).

Os estafilococos apresentam uma espessa parede celular composta principalmente por glicopeptídios, ácido teicoicos e proteína A (CARTER, 1989CARTER, G.R. Fundamentos de bacteriologia y micologia veterinaria. Zaragozo: Acribia, 1989. 305p.) que dificultam sua lise. Neste trabalho foi desenvolvida uma metodologia utilizando a “french pressure cell press” para a lise das paredes celulares de Staphylococcus spp. e posterior detecção por PCR de possíveis genes de resistência para oxacilina, gentamicina, canamicina e vancomicina, localizados em cromossomos e em plasmídios.

MATERIAL E MÉTODOS

Coleta das amostras. As amostras clínicas de Staphylococcus spp. foram obtidas da pele dos tetos de vacas mestiças lactantes aparentemente sadias, provenientes de algumas propriedades dos Municípios de Monte Alto, Jaboticabal e Sertãozinho, onde a ordenha realizada era manual. Foram coletadas e isoladas 50 amostras de estafilococos sendo seis delas de maior interesse neste estudo.

Identificação presuntiva do gênero estafilococos. Após a análise microscópica por coloração de Gram, foram realizadas provas bioquímicas como lecitinase (ITO et al., 1969ITO, I.Y.; COSTA, A.; BARACCHINI, O. Emprego de gema de ovo no isolamento de Staphylococcus. Anais de Microbiologia, v.16., p.189-192, 1969.), catalase (BIER, 1966BIER, O. Bacteriologia e imunologia. São Paulo: Melhoramentos, 1966. 827p.), coagulase (SPERBER; TATINI, 1975SPERBER, W.H. & TATINI, S.R. Interpretation of the tube coagulase test for identification of Staphylococcus aureus. Applied and Environmental Microbiology, v.29, n.4, p.502-505, 1975.), fermentação do manitol, oxidação e fermentação da glicose (OF), oxidação em açúcares (D-manose, D-glicose e D-trealose) e produção de acetoína a partir de glicose (MACFADDIN, 1976MACFADDIN, J.F. Biochemical tests for identification of medical bacteria. Baltimore: Williams & Wilkins, 1976. 312p.).

Realização de Antibiogramas. Os antibiogramas foram feitos para verificação da susceptibilidade aos antimicrobianos oxacilina, canamicina, gentamicina e vancomicina. Foi utilizada uma amostra de S.aureus da American Type Culture Collection (ATCC n. 29213) recomendada como controle de qualidade para testes de susceptibilidade. A metodologia foi feita de acordo com BAUER et al. (1966)BAUER, A.W.; KIRBY, W.M.M.; SHERRIS, J.C.; TURCK, M. Antibiotic susceptibility testing by a standardized single disk method. American Journal of Clinical Pathology, v.45, p.493-496, 1966. e os procedimentos destinados à padronização da técnica foram baseados nas normas propostas pelo National Committee for Clinical Laboratory Standards (NCCLS, 2003NATIONAL COMMITTEE FOR CLINICAL LABORATORY STANDARDS. NCCLS. Performance standards for antimicrobial disk susceptibility tests for bacteria that grow aerobically. 8th.ed. Wayne: NCCLS, 2003. (NCCLS document M2-A8).).

Extração do DNA genômico usando Prensa Francesa. O equipamento utilizado no desenvolvimento desta metodologia foi a “French Pressure Cell Press” (SLM AMINCO, SLM Instruments, Inc). Preparou-se um pré-cultivo bacteriano em 50 mL de meio BHI (Brain Heart Infusion Broth) com incubação a 37º C, por 12h. A seguir este foi adicionado a um volume de 1 L do mesmo meio de cultura para a realização do cultivo final, nas condições anteriores. Após centrifugação a 956 x g, o precipitado obtido foi lavado em 20 mL de uma solução tampão contendo Tris-HCl (50mM), EDTA (1mM) e sacarose a 25%. A prensa francesa permitiu a quebra física da parede bacteriana sob dupla exposição da amostra à pressão de 16.000 psi. Os procedimentos seguintes foram realizados de acordo com a metodologia de HOOKEY et al. (1999)HOOKEY, J.V.; EDWARDS, V.; PATEL, S.; RICHARDSON, J.F.; COOKSON, B.D. Use of fluorescent amplified fragment length polymorphism (fAFLP) to characterize methicillinresistant Staphylococcus aureus. Journal of Microbiology Methods, v.37, n.1, p.7-15, 1999., ressaltando-se que todos os volumes dos reagentes foram vinte vezes maiores, considerando a quantidade da solução tampão Tris-HCl inicialmente utilizada. Para a visualização do DNA, foi preparado gel de agarose 0,8% em tampão TEB 1X (89 mM de Tris; 89 mM de ácido bórico e 2,5 mM de EDTA, pH 8.2), processado a 75 V, por 1h. O material genético foi visualizado por um fotodocumentador modelo GEL DOC 2000 (Bio-Rad).

Após o término da extração do DNA genômico, foi feita a separação do DNA plasmidial do DNA cromossômico, seguindo a metodologia proposta por SAMBROOK et al. (1989)SAMBROOK, J.; FRITSCH, E.F.; MANIATIS, T. Molecular cloning: a laboratory manual. 2th.ed. New York: Cold Spring Harbor Laboratory Press, 1989. 63p.. Foi preparada uma solução de DNA na concentração de 1.600 ng/mL de tampão TE (Tris 10 mM, EDTA 1 mM, pH 8,0), adicionada de 2 g de cloreto de césio. Os plasmídios foram obtidos por ultracentrifugação a 432.800 x g em uma ultracentrífuga Beckman modelo TL100 utilizando-se um rotor TL10 3.1, por um período de 20h a 20° C.

Síntese de oligonucleotídeos iniciadores. A amplificação dos fragmentos de DNA foi feita utilizando-se os seguintes pares de oligonucleotídeos sintéticos: “primer” mecA 1282 (5’AAAATCGATGGTAAAG GGTTGGC 3’) e “primer” mecA 1793 (5"AGTTCTGCA GTACCGGATTTGC 3’), podendo produzir um fragmento de 533 pb (MERLINO et al., 2002MERLINO, J.; WATSON, J.; ROSE, B.; BEARD-PEGLER, M.; GOTTLIEB, T.; BRADBURY, R.; HARBOUR, C. Detection and expression of methicillin/oxacillin resitance in multidurgresistante Staphylococcus aureus in Central Sydney, Australia. Journal of Antimicrobial Chemotherapy, v.49, n.5, p.793, 2002.), “primer” aph(3’)-IIIa 329 (5’ CTGATCGAAAAATACCGCTGC 3’) e “primer” 597 (5’ TCATACTCTTCCGAGCAAAGG 3’), “primer”aac(6’)I e + aph(2") 2022 (5’ CCAAG AGCAATAAGGGCATACC) e “primer” 2369 (3’CACACTATCATAACCATCACCG), associados à produção de fragmentos de 268 pb e 247 pb, respectivamente (SHIMITZ et al., 1999SCHMITZ, F.J.; FLUIT, A.D.C.; GONDOLF, M.; BEYRAU, R.; LINDENLAUF, E.; VERHOEF, J.; HEINZ, H.P.; JONES, M.E. The prevalence of aminoglycoside resistance and corresponding resitance genes in clinical isolates of staphylococci from 19 European hospitals. Journal of Antimicrobial Chemotherapy, v.43, n.2, p.253-259, 1999.).

Reação em Cadeia da Polimerase. As reações de PCR foram baseadas na metodologia de YOU et al. (2000)YOU, I; KARIYAMA, R; ZERVOS, M.J.; KUMON, H.; CHOW, J.W. In- vitro activity of arbekacin alone and in combintion with vancomycin against gentamicin – and methicillinresistant Staphylococcus aureus. Diagnostic Microbiology and Infectious Disease, v.36, n.1, p.37-41, 2000.. Para as reações de amplificação foram utilizados 30 ng de DNA; tampão de PCR 1x (KCl 50 mM, TRIS-HCl 200 mM, pH 8,4); 1,5 mM de MgCl2; 0,2 mM de dNTP; 1µg de cada “primer”; 2,5 U de Taq DNA polimerase (GIBCO-BRL) e água Milli Q estéril para totalizar o volume da reação de 20 µL. A amplificação foi realizada por 2min a 94° C; 1min a 94° C; 2min a 52° C; 2min a 72° C; 39 ciclos a partir do passo 2; 5min a 72° C e manutenção das amostras sob refrigeração a 5° C. Todos os produtos amplificados foram analisados em gel de agarose 1,5%, corados com brometo de etídio e processados a 65 V, por 1h e 30min.

RESULTADOS E DISCUSSÃO

O desenvolvimento do antibiograma permitiu a detecção de uma alta susceptibilidade das cepas de estafilococos para os 4 antibióticos estudados. Foram feitos antibiogramas para as 50 linhagens de Staphylococcus spp. inicialmente analisadas e, deste total, 6 foram resistentes às drogas testadas. A resistência das bactérias aos aminoglicosídieos gentamicina e canamicina foi da ordem de 4% e, para a oxacilina, de 8%. Não foi observada resistência à vancomicina.

Tabela 1
Linhagens de estafilococos isoladas de bovinos e suas localidades.
Fig. 1
Material genético obtido pela prensa francesa com posterior ultracentrifugação. MM: marcador de tamanho molecular 1kb Plus DNA Ladder; ATCC 29213; 1: Amostra de DNA cromossômico de S. chromogenes; 2: Amostra de DNA cromossômico de S.aureus;3: Amostrade DNAcromossômico de S. aureus; 4: Amostra de DNA cromossômico de S.aureus; 5C: Amostra de DNA cromossômico de S. chromogenes; 5P: Amostra de DNA plasmidial de S. chromogenes; 6C: Amostra de DNA cromossômico de S. chromogenes; 6P: Amostra de DNA plasmidial de S.chromogenes ; padrão cromossômico de E. coli.

RABELLO et al. (2005)RABELLO, R.F.; SOUZA, C.R.; DUARTE, R.S.; LOPES, R.M.; TEIXEIRA, L.M.; CASTRO, A.C. Characterization of Staphylococcus aureus isolates recovered from bovine mastitis in Rio de Janeiro, Brazil. Journal of Dairy Science, v.88, n.9, p.3211-3219, 2005. estudaram isolados de S. aureus em vacas com mastite subclínica e encontraram alta susceptibilidade destas bactérias a diversos antibióticos testados, entre eles a oxacilina, canamicina, gentamicina e vancomicina. GÜLER et al. (2005)GÜLER, L.; OK, Ü.; GÜINDÜZ, K.; GÜLCÜ, Y; HADIMLI, H.H. Antimicrobial susceptibility and coagulase gene typing of Staphylococcus aureus isolated from bovine clinical mastitis cases in Turkey. Journal of Dairy Science, v.88, n.9, p.3149-3154, 2005. analisaram mais de duzentos isolados de S. aureus em vacas com mastite clínica e não detectaram nenhuma resistência para a oxacilina. PENGOV; CERU (2003)PENGOV, A.; CERU, S. Antimicrobial drug susceptibility of Staphylococcus aureus strains isolatet from bovine and ovine mammary glands. Journal of Dairy Science, v.86, n.10, p.3157-3163, 2003. isolaram S. aureus de vacas com infecção intramamária e detectaram susceptibilidades de 100% à oxacilina e 93,5% à canamicina. GENTILINI et al. (2002)GENTILINI, E.; DENAMIEL, G.; BETANCOR, A.; REBUELTO, M.; RODRIGUEZ, F.M.; DE TORRES, R.A. Antimicrobial susceptibility of coagulase-negative sthaphylococcal isolated from bovine mastitis in Argentina, Buenos Aires, Journal of Dairy Science, v.83, n.6, p.1913-1917, 2002. estudaram susceptibilidade à oxacilina em estafilococos coagulase negativos em isolados de vacas com mastite bovina encontrando baixa resistência a este antibiótico e total susceptibilidade à gentamicina. GUTA et al. (2002)GUTA, C.; SEBUNYA, T.K.; GASHE, B.A. Antimicrobial susceptibility of sthafilococci species from cow foremilk originating from dairy around Gaborone, Botswana. East African Medical Journal, v.79, n.1, p.45-58, 2002., analisando Staphylococcus spp. em rebanhos leiteiros, detectaram linhagens que apresentavam uma baixa resistência à gentamicina e 100% de susceptibilidade à vancomicina.

As seis linhagens presentes na Tabela 1 demonstraram resultados positivos para as provas da lecitinase e catalase. Já a prova de plasmacoagulase permitiu a identificação de três amostras coagulasepositivas (2, 3, 4) e outras três coagulase-negativas (1, 5, 6). Todas as amostras foram positivas para as provas de oxidação e fermentação da glicose e fermentação do manitol em anaerobiose. De acordo com SNEATH et al. (1986)SNEATH, P.H.A.; MAIR, N.S.; S HARPE, M.E.; HOLT, I.G. Bergey´s manual of systematic bacteriology. Batimore: Williams & Wilkins, 1986., as provas de coagulase, fermentação do manitol em anaerobiose e a prova da produção de acetoína a partir de glicose são definitivas para que as cepas sejam identificadas como S. aureus, já as provas da oxidação dos açúcares trealose, manose e maltose determinam linhagens de S. chromogenes.

Fig. 2
Produtos de amplificação do gene mecA, MM: marcador de tamanho molecular 1Kb Plus DNA Ladder. 6C: DNA cromossomal de S. chromogenes; 6P: DNA plasmidial de S. chromogenes; 4: DNA cromossomal de S. aureus; 3: DNA cromossomal de S. aureus; 1: DNA cromossomal de S. aureus; CN: controle negativo.
Fig. 3
Produtos de amplificação do gene aph (3’)-llla. MM: marcador de tamanho molecular 1Kb Plus DNA Ladder. 1: DNA cromossomal de S. chromogenes ; 2: DNA cromossomal de S. aureus; CN: controle negativo.
Fig. 4
Produtos de amplificação do geneaac(6’)-le+aph(2"), MM: marcador de tamanho molecular 1Kb Plus DNA Ladder. 6C: DNA cromossomal de S. chromogenes; 6P: DNA plasmidial de S. chromogenes; 5C: DNA cromossomal de S. chromogenes; 5P: DNA plasmidial de S. chromogenes; CN: controle negativo.

O fato dos estafilococos apresentarem uma espessa parede celular dificulta bastante sua lise. Embora existam kits de extração simples e rápidos como o InstaGene Matrix (Bio-Rad Laboratories) e metodologias que utilizam apenas a fervura em água (MEDICI, et al., 2003MEDICI, D.; CROCI, L.; DELIBATO, E.; DI PASQUALE, S.; F ILETICI, E.; TOTI, L. Evaluation of DNA Extraction Methods for Use in Combination with SYBRGreen I Real-Time PCR To Detect Salmonella enterica Serotype Enteritidis in Poultry. Applied and Environmental Microbiology, v.69, n.6, p.3456–3461, 2003.) para a lise celular, a quantidade de DNA obtida é pequena, limitando sua utilização. Outra alternativa para se extrair o material genético é a utilização da lisostafina, mas o alto custo desta enzima pode ser considerado limitante. Assim, a metodologia de extração de DNA, com o auxílio da prensa francesa, foi desenvolvida devido à necessidade de se conseguir uma alta concentração de DNA genômico necessária ao bandeamento do cromossomo e plasmídio, no processo da ultracentrifugação. A prensa francesa permitiu a obtenção de DNA plasmidial de boa qualidade e uma grande quantidade de DNA genômico apresentando alguma degradação, mas com condições suficientes para se detectar a presença de genes de resistência nas bactérias. A Figura 1 apresenta o material genético obtido pelo auxílio da prensa francesa com posterior ultracentrifugação e separação em DNA cromossômico (1, 2, 3, 4, 5) e plasmidial (5P e 6P). O uso da prensa francesa para a lise da parede celular dos estafilococos também foi utilizada por KIM et al. (1979)KIM, T.K.; HAMMOND, J.B.; CHIPLEY, J.R. Chemicalandelectron microscopic studies of factors associated with the release of penicillinase from Staphylococcus aureus. Antonie Van Leeuwenhoek Journal of Microbiology, v.45, n.4, p.581-593, 1979., em estudo envolvendo fatores associados com a liberação de penicilinase em S. aureus, porém sendo utilizada a lisostafina.

O gene mecA foi detectado nos cromossomos das linhagens 1, 3, 4 e 6, provenientes dos Municípios de Sertãozinho, Jaboticabal e Monte Alto respectivamente (Tabela 1), como pode ser observado nos produtos de amplificação referentes à Figura 2. Este resultado era esperado visto que este gene é um dos constituintes do complexo cromossômico mec estafilocócico (SCCmec) (BERGER-BÄCHI; ROHRER, 2002BERGER-BÄCHI, B.; ROHRER, S. Factors influencing methicillin resistance in staphylococci. Archives of Microbiology, v.178, n.3, p.165-171, 2002.). Alguns pesquisadores como LEE et al. (2004)LEE, J.H.; JEONG, J.M.; PARK, Y.H.;CHOI, S.S.; KIM, Y.H.; CHAE, J.S.; JIN-SAN MOON, J.S.;PARK, H.;KIM, S.; EO, S.K. Evaluation of the Methicillin-ResistantStaphylococcus aureus (MRSA)-Screen Latex Agglutination Test for Detection of MRSA of Animal Origin. Journal Clinical Microbiology, v.42, n.6, p.2780–2782, 2004., ZADOKS et al. (2000)ZADOKS, R.; VAN LEEUWEN, W.; BARKEMA, H.; SAMPIMON, O.; VERBRUGH, H.;Y.H. SCHUKKEN, Y.H.; BELKUM, V. Application of pulsed-field gel electrophoresis and binary typing as tools in veterinary clinical microbiology and molecular epidemiologic analysis of bovine and human Staphylococcus aureus isolates. Journal Clinical Microbiology, v.38, n.5, p.1931-1939, 2000. eKASZANYITZKY et al. (2004)KASZANYITZKY, E.J.; EGYED, Z.; JANOSI, S.; KESERU, J.; GAL, Z.; SZABO, I.; VERES, Z.; SOMOGYI, P. Staphylococci isolated from animals and food with phenotypically reduced susceptibility to beta-lactamase-resistant beta-lactam antibiotics. Acta Veterinaria Hungarica, v.52, n.1, p.717, 2004. relatam que Staphylococcus spp. meticilina resistentes isolados de vacas com mastite acarretam sérios problemas em medicina veterinária, sendo também, segundo LEE (2003)LEE, J.H. Methicillin (oxacillin)-resistant Staphylococcus aureus strains isolated from major food animals and their potential transmission to humans. Applied and Environmental Microbiology, v.69, n.11, p.6489-6494, 2003., potencialmente problemático para humanos.

As linhagens 1 e 6 apresentaram dois genes de resistência simultaneamente. Os genes mecA e aph(3’) IIIa foram verificados nos cromossomos da linhagem 1 e a linhagem 6 apresentou os genes mecA e aac (6’) I e + aph (2"), presentes no cromossomo e plasmídio respectivamente. Os estafilococos que apresentam resistência ameticilina (oxacilina) são, freqüentemente, resistentes a alguns agentes antimicrobianos mais comuns como os aminoglicosídeos, macrolideos, cloranfenicol, tetraciclina e fluoroquinolonas (MANDELL et al., 1995MANDELL, G.; DOUGLAS, J.; BENNETT, R. Principles and practices of infectious diseases. Edinburgh: Churchill Livingstone, 1995.), constituíndo cepas de maiores riscos para o homem e animais em casos de infecções estafilocócicas.

O gene aph(3’) IIIa foi detectado no cromossomo das linhagens 1 e 2 (Fig. 3), obtidas nas propriedades de Sertãozinho e Jaboticabal (Tabela 1). Um estudo de análise genética da susceptibilidade a diversos antimicrobianos, em linhagens de S. aureus isolados de um hospital em Lisboa, mostrou que os aminoglicosídeos gentamicina e canamicina apresentaram resistências cromossomais (CRISTINO; PEREIRA, 1989CRISTINO, J.A.; PEREIRA, A.T. Plasmid analysis of 219 methicillin-resistant Staphylococcus aureus strains with uncommon profiles isolated in Lisbon. Journal of Hospital Infection, v.13, n.2, p.133-141, 1989.). Outro estudo efetuado com MRSA, isolados de um hospital no Kuwait também demonstraram resistência cromossômica para os referidos aminoglicosideos (UDO; JACOB, 2000UDO, E.E. & JACOB, L.E. Characterisation of methicillinresistant Staphylococcus aureus from Kuwait hospitals with high-level fusidic acid resistance. Journal Medical Microbiology, v.49, n.5, p.419-426, 2000.).

A linhagem 6 apresentou amplificação correspondente ao gene aac (6’) Ie + aph (2") no cromossomo e no plasmídio, já a linhagem 5 amplificou a região correspondente ao referido gene somente no plasmídio, como pode ser observado na Figura 4. Estas linhagens foram obtidas do mesmo rebanho bovino, localizado no Município de Monte Alto (Tabela 1). SEKIGUCHI et al. (2003)SEKIGUCHI,J.I.; FUJINO,T.; SARUTA, K.; KAWANO, F; TAKAMI, J.; MIYAZAKI, H.; KURATSUJI, T.; HIROSHI YOSHIKURA, H. ; TERUO KIRIKAE, T. Spread of erythromycin-, tetracycline-, and aminoglycoside-resistant genes in methicillinresistant Staphylococcus aureus clinical isolates in a Kumamoto Hospital. Japanese Journal of Infectious Diseases, v.56, n.3, p.133-137, 2003. trabalharam com isolados clínicos de S. aureus meticilina resistentes (MRSA) e demonstraram que a maioria deles tinha gene aac (6’) Ie + aph (2") tanto no plasmídio como no cromossomo destas bactérias e, além disso, alguns isolados apresentaram este gene apenas no plasmídio e outras somente no cromossomo bacteriano.

A detecção destes genes de resistência em propriedades leiteiras de Sertãozinho, Jaboticabal e Monte Alto constitui um fator relevante, pois, de acordo com WHITE; MCDERMOTT (2001)WHITE, D.G.; MCDERMOTT, P.F. Emergence and tranfer of antibacterial resistance. Journal of Dairy Science, v.84, E. Supplement, p.151-155, 2001., as bactérias que desenvolvem resistência aos antimicrobianos podem interferir nos tratamentos mais efetivos diminuindo o controle de diversas doenças infecciosas e prejudicando humanos e animais. Segundo MCDERMOTT et al. (2002)MCDERMOTT, P.F.; ZHAO, S.; WAGNER, D.D.; SIMJEE, S.; WALKER, R.D.; WHITE, D.G. The food safety perspective of antibiotic resistance. Animal Biotechnology, v.13, n.1, p.71-84, 2002., a emergência e disseminação da resistência aos antimicrobianos resultam da interação entre os microrganismos, antibióticos e o ambiente que os rodeiam. Além disso, a resistência aos antimicrobianos pode ser adquirida espontaneamente por mutações genéticas e transferidas por seleção vertical às células filhas. Mais comumente, a resistência é adquirida por transferência horizontal de elementos móveis do DNA de uma célula doadora para outras bactérias(SEFTON, 2002SEFTON, A.M. Mechanisms of antimicrobial resistance:their clinical relevance in the new millennium. Drugs, v.62, n.4, p.557-566, 2002.).

CONCLUSÃO

Os resultados obtidos com a“french pressure cell press” permitem concluir que a metodologia foi eficaz, pois proporcionou um material genômico íntegro e em condições de ser analisado geneticamente, principalmente quanto à localização dos genes considerados neste estudo. Além disso, a detecção por PCR de linhagens contendo genes de resistência à oxacilina, gentamicina e canamicina nos tetos das vacas pode propiciar o aparecimento de problemas sérios como a mastite nos rebanhos leiteiros podendo, também, promover a contaminação do leite, tornando este produto uma importante fonte de infecção ao homem.

REFERÊNCIAS

  • BAUER, A.W.; KIRBY, W.M.M.; SHERRIS, J.C.; TURCK, M. Antibiotic susceptibility testing by a standardized single disk method. American Journal of Clinical Pathology, v.45, p.493-496, 1966.
  • BERGER-BÄCHI, B.; ROHRER, S. Factors influencing methicillin resistance in staphylococci. Archives of Microbiology, v.178, n.3, p.165-171, 2002.
  • BIER, O. Bacteriologia e imunologia São Paulo: Melhoramentos, 1966. 827p.
  • BRAKSTAD, O.G.; MAELAND, J.A. Mechanisms of methicillin resistance in staphylococci. APMIS, v.105, n.4, p.264-276, 1997.
  • CARTER, G.R. Fundamentos de bacteriologia y micologia veterinaria Zaragozo: Acribia, 1989. 305p.
  • CRISTINO, J.A.; PEREIRA, A.T. Plasmid analysis of 219 methicillin-resistant Staphylococcus aureus strains with uncommon profiles isolated in Lisbon. Journal of Hospital Infection, v.13, n.2, p.133-141, 1989.
  • DERBISE, A.; DYKE, K.G.H.; EL SOLH, N. Characterization of a Staphylococcus aureus transposon Tn5405, located within Tn5404 carrying the aminoglycoside resistance genes, aphA-3 and aadE. Plasmid, v.35, n.3, p.74-88, 1996.
  • GENTILINI, E.; DENAMIEL, G.; BETANCOR, A.; REBUELTO, M.; RODRIGUEZ, F.M.; DE TORRES, R.A. Antimicrobial susceptibility of coagulase-negative sthaphylococcal isolated from bovine mastitis in Argentina, Buenos Aires, Journal of Dairy Science, v.83, n.6, p.1913-1917, 2002.
  • GÜLER, L.; OK, Ü.; GÜINDÜZ, K.; GÜLCÜ, Y; HADIMLI, H.H. Antimicrobial susceptibility and coagulase gene typing of Staphylococcus aureus isolated from bovine clinical mastitis cases in Turkey. Journal of Dairy Science, v.88, n.9, p.3149-3154, 2005.
  • GUTA, C.; SEBUNYA, T.K.; GASHE, B.A. Antimicrobial susceptibility of sthafilococci species from cow foremilk originating from dairy around Gaborone, Botswana. East African Medical Journal, v.79, n.1, p.45-58, 2002.
  • HIRAMATSU, K. Molecular evolution of MRSA. Microbiology and Immunology, v.39, n.8, p.531-543, 1995.
  • HOOKEY, J.V.; EDWARDS, V.; PATEL, S.; RICHARDSON, J.F.; COOKSON, B.D. Use of fluorescent amplified fragment length polymorphism (fAFLP) to characterize methicillinresistant Staphylococcus aureus Journal of Microbiology Methods, v.37, n.1, p.7-15, 1999.
  • ITO, I.Y.; COSTA, A.; BARACCHINI, O. Emprego de gema de ovo no isolamento de Staphylococcus Anais de Microbiologia, v.16., p.189-192, 1969.
  • KASZANYITZKY, E.J.; EGYED, Z.; JANOSI, S.; KESERU, J.; GAL, Z.; SZABO, I.; VERES, Z.; SOMOGYI, P. Staphylococci isolated from animals and food with phenotypically reduced susceptibility to beta-lactamase-resistant beta-lactam antibiotics. Acta Veterinaria Hungarica, v.52, n.1, p.717, 2004.
  • KONEMAN, E.W.; ALLEN, S.D.; JANDA, W.M.; SCHRECKENBERGER, P.C.; WINN, J.R. Color Atlas and textbook of diagnostic microbiology 5.th.ed. Philadelphia: Lippincott/ Willians & Wilkins, 1997. 1395p.
  • KIM, T.K.; HAMMOND, J.B.; CHIPLEY, J.R. Chemicalandelectron microscopic studies of factors associated with the release of penicillinase from Staphylococcus aureus Antonie Van Leeuwenhoek Journal of Microbiology, v.45, n.4, p.581-593, 1979.
  • LEE, J.H.; JEONG, J.M.; PARK, Y.H.;CHOI, S.S.; KIM, Y.H.; CHAE, J.S.; JIN-SAN MOON, J.S.;PARK, H.;KIM, S.; EO, S.K. Evaluation of the Methicillin-ResistantStaphylococcus aureus (MRSA)-Screen Latex Agglutination Test for Detection of MRSA of Animal Origin. Journal Clinical Microbiology, v.42, n.6, p.2780–2782, 2004.
  • LEE, J.H. Methicillin (oxacillin)-resistant Staphylococcus aureus strains isolated from major food animals and their potential transmission to humans. Applied and Environmental Microbiology, v.69, n.11, p.6489-6494, 2003.
  • MACFADDIN, J.F. Biochemical tests for identification of medical bacteria Baltimore: Williams & Wilkins, 1976. 312p.
  • MANDELL, G.; DOUGLAS, J.; BENNETT, R. Principles and practices of infectious diseases Edinburgh: Churchill Livingstone, 1995.
  • MANIATIS A.N.; TROUGAKOS I.P.; KATSANIS, G.; PALERMO, J.; MANIATIS, N.A., LEGAKIS, N.J. Changing patterns of bacterial nosocomial infections: a nine-year study in a general hospital. Chemotherapy, v.43, p.69-76, 1997.
  • MCDERMOTT, P.F.; ZHAO, S.; WAGNER, D.D.; SIMJEE, S.; WALKER, R.D.; WHITE, D.G. The food safety perspective of antibiotic resistance. Animal Biotechnology, v.13, n.1, p.71-84, 2002.
  • MEDICI, D.; CROCI, L.; DELIBATO, E.; DI PASQUALE, S.; F ILETICI, E.; TOTI, L. Evaluation of DNA Extraction Methods for Use in Combination with SYBRGreen I Real-Time PCR To Detect Salmonella enterica Serotype Enteritidis in Poultry. Applied and Environmental Microbiology, v.69, n.6, p.3456–3461, 2003.
  • MERLINO, J.; WATSON, J.; ROSE, B.; BEARD-PEGLER, M.; GOTTLIEB, T.; BRADBURY, R.; HARBOUR, C. Detection and expression of methicillin/oxacillin resitance in multidurgresistante Staphylococcus aureus in Central Sydney, Australia. Journal of Antimicrobial Chemotherapy, v.49, n.5, p.793, 2002.
  • MURRAY, P.R.; ROSENTHAL, K.S.; KOBAYASHI, G.S.; PFLLER, M.A. Microbiogia médica 3.ed. São Paulo: Guanabara Koogan, 1998. v.1, 604p.
  • NATIONAL COMMITTEE FOR CLINICAL LABORATORY STANDARDS. NCCLS. Performance standards for antimicrobial disk susceptibility tests for bacteria that grow aerobically. 8th.ed. Wayne: NCCLS, 2003. (NCCLS document M2-A8).
  • PAULSEN, I.T.; FIRTH, N.; SKURRAY, R.A. Resistance to antimicrobial agents other than b-lactams. In: CROSSLEY, K.B.; ARCHER, G.L., (Eds.) The Staphylococci in Human Disease New York: Churchill Livingstone, 1997. p.175-212.
  • PENGOV, A.; CERU, S. Antimicrobial drug susceptibility of Staphylococcus aureus strains isolatet from bovine and ovine mammary glands. Journal of Dairy Science, v.86, n.10, p.3157-3163, 2003.
  • RABELLO, R.F.; SOUZA, C.R.; DUARTE, R.S.; LOPES, R.M.; TEIXEIRA, L.M.; CASTRO, A.C. Characterization of Staphylococcus aureus isolates recovered from bovine mastitis in Rio de Janeiro, Brazil. Journal of Dairy Science, v.88, n.9, p.3211-3219, 2005.
  • SAMBROOK, J.; FRITSCH, E.F.; MANIATIS, T. Molecular cloning: a laboratory manual. 2th.ed. New York: Cold Spring Harbor Laboratory Press, 1989. 63p.
  • SEFTON, A.M. Mechanisms of antimicrobial resistance:their clinical relevance in the new millennium. Drugs, v.62, n.4, p.557-566, 2002.
  • SANTOS, F.G.B.; MOTA, R.A.; SILVEIRA-FILHO, V.M.; SOUZA, H.M.; OLIVEIRA, M.B.M.; JOHNER, J.M.Q.; LEAL, N.C.; ALMEIDA, A.M.P.; LEAL-BALBINO, T.C. Tipagem molecular de Staphylococcus aureus isolados do leite de vacas com mastite subclínica e equipamentos de ordenha procedentes do estado de Pernambuco. Napgama, São Paulo, v.6, n.1, p.19-23, 2003.
  • SEKIGUCHI,J.I.; FUJINO,T.; SARUTA, K.; KAWANO, F; TAKAMI, J.; MIYAZAKI, H.; KURATSUJI, T.; HIROSHI YOSHIKURA, H. ; TERUO KIRIKAE, T. Spread of erythromycin-, tetracycline-, and aminoglycoside-resistant genes in methicillinresistant Staphylococcus aureus clinical isolates in a Kumamoto Hospital. Japanese Journal of Infectious Diseases, v.56, n.3, p.133-137, 2003.
  • SCHMITZ, F.J.; FLUIT, A.D.C.; GONDOLF, M.; BEYRAU, R.; LINDENLAUF, E.; VERHOEF, J.; HEINZ, H.P.; JONES, M.E. The prevalence of aminoglycoside resistance and corresponding resitance genes in clinical isolates of staphylococci from 19 European hospitals. Journal of Antimicrobial Chemotherapy, v.43, n.2, p.253-259, 1999.
  • SNEATH, P.H.A.; MAIR, N.S.; S HARPE, M.E.; HOLT, I.G. Bergey´s manual of systematic bacteriology Batimore: Williams & Wilkins, 1986.
  • SPERBER, W.H. & TATINI, S.R. Interpretation of the tube coagulase test for identification of Staphylococcus aureus. Applied and Environmental Microbiology, v.29, n.4, p.502-505, 1975.
  • TENOVER, F.C.; POPOVIC, T.; OLSVIK, O. Genetic methods for detecting antibacterial resistance genes. In: MURRAY, P.R. (Ed.). Manual of clinical microbiology 6th.ed. Washington: American Society for Microbiology, 1995. p.1368-1378.
  • UDO, E.E. & JACOB, L.E. Characterisation of methicillinresistant Staphylococcus aureus from Kuwait hospitals with high-level fusidic acid resistance. Journal Medical Microbiology, v.49, n.5, p.419-426, 2000.
  • ZADOKS, R.; VAN LEEUWEN, W.; BARKEMA, H.; SAMPIMON, O.; VERBRUGH, H.;Y.H. SCHUKKEN, Y.H.; BELKUM, V. Application of pulsed-field gel electrophoresis and binary typing as tools in veterinary clinical microbiology and molecular epidemiologic analysis of bovine and human Staphylococcus aureus isolates. Journal Clinical Microbiology, v.38, n.5, p.1931-1939, 2000.
  • WHITE, D.G.; MCDERMOTT, P.F. Emergence and tranfer of antibacterial resistance. Journal of Dairy Science, v.84, E. Supplement, p.151-155, 2001.
  • WITTE, W. Ecological impact of antibiotic use in animals on different complex microflora: environment. International Journal of Antimicrobial Agents, v.14, n.4, p.321-325, 2000.
  • YOU, I; KARIYAMA, R; ZERVOS, M.J.; KUMON, H.; CHOW, J.W. In- vitro activity of arbekacin alone and in combintion with vancomycin against gentamicin – and methicillinresistant Staphylococcus aureus. Diagnostic Microbiology and Infectious Disease, v.36, n.1, p.37-41, 2000.

Datas de Publicação

  • Publicação nesta coleção
    10 Jan 2022
  • Data do Fascículo
    Jul-Sep 2007

Histórico

  • Recebido
    24 Out 2006
  • Aceito
    21 Ago 2007
Instituto Biológico Av. Conselheiro Rodrigues Alves, 1252 - Vila Mariana - São Paulo - SP, 04014-002 - São Paulo - SP - Brazil
E-mail: arquivos@biologico.sp.gov.br