Oral vaccination with inhibin DNA vaccine for promoting spermatogenesis in rats

Abstract

The objective of the present study was to evaluate the effects of a novel Inhibin (INH) DNA vaccine (C500/pVAX-asd-IS) on the immune response, reproductive hormone levels, and spermatogenesis of rats. Forty healthy male rats were divided into four groups, and respectively immunized (thrice, 14 d apart) with 1×10⁸, 1×10⁹, and 1×10¹⁰ CFU of the recombinant inhibin vaccine (group C500/pVAX-asd-IS-L, C500/pVAX-asd-IS-M, and C500/pVAX-asd-IS-H) or 1×10¹⁰ CFU C500. P/N values increased after vaccination and differed (p <0.05) at 7 d, and sharply increased at 14 d following the booster vaccination (p <0.01); The weight and volume of testes in C500/pVAX-asd-IS groups were increased (p < 0.05) at decapitation, respectively; Histological evaluation showed that the number of spermatogenic cells in the lumen was increased, and the cytoplasmic remnants of sperms were allergy increased significantly compared with the control group. Oral vaccination with INH DNA reduced (P < 0.05) serum concentrations of INH B, enhanced serum concentrations of testosterone (T) and FSH. Furthermore, mRNA expressions of VIM and SMAD4 in the testes were increased in C500/pVAX-asd-IS-M and C500/pVAX-asd-IS-H groups (p < 0.05 or p < 0.01). The mRNA amount of INHβ-B in C500/pVAX-asd-IS-M group was greater than control group (p < 0.05).These results suggested that neutralization of endogenous INH through oral vaccination with INH DNA delivered by C500 strain successfully elicited a humoral immune response. INH gene immunization may have a positive effect on spermatogenesis and reproductive efficiency in male rats.

Keywords:
inhibin; vaccine; immunization; spermatogenesis; rat

Introduction

Inhibin (INH) is a glycoprotein hormone that is synthesized and secreted by sertoli cells of the testis and inhibits the secretion of follicle stimulating hormone (FSH) by the gonadotropic cells of the anterior pituitary in males (Petrozzi et al., 2019). INH contains two subunits (INH A and B), while INH B is the circulating isoform and only one detectable in adult males of most species (Li et al., 2018). The positive correlation of serum INH B concentrations, spermatogenesis, and testicular volume has been documented in many literatures (Bohring & Krause, 1999; Yalti et al., 2002). Serum INH-B concentrations were also positively correlated with total sperm counts (Jørgensen et al., 2010), and which appeared to be a reliable marker for human male fecundity (Ball et al., 2019).

DNA vaccine immunization is usually considered to be safe and effective which has been widely investigated (Dan et al., 2016a). Many studies have indicated that neutralization of endogenous INH through active immunization could improve reproductive efficiency, spermatogenesis and testicular development (Bame et al., 1999; Lovell et al., 2000). Immunization against INH enhances daily sperm production in urine of prepubertal rams (Al-Obaidi et al., 1987) and spermatid numbers in testes of bulls (Martin et al., 1991). Thus, these findings suggest that INH is a positive regulatory factor of spermatogenesis. However, there is a report suggesting that immunizing adult rams with INH vaccine increases serum FSH without altering sperm production (McKeown et al., 1997). The reason why INH immunization has no positive effect on sperm production in adult rams is unclear.

In the previous study, an attenuated Salmonella enterica serovar Choleraesuis C500 strain (asd and crp genes were deleted) was used as a delivery system for foreign antigens by using the asd^- balanced lethal chromosome–plasmid system (Zhao et al., 2009). Oral pharmacology with INH DNA vaccines expressing INH (1-32) fragment, which can enhance the number of larger follicles or litter sizes after immunization in mice and rats (Han et al., 2014; Wang et al., 2012). Dan et al., (2016a) successfully constructed a novel DNA vaccine p-TPA-SINH/TPA-SRFRP expressing INH-α (1–32), which exhibited better immunogenicity, and increased litter size of mice. However, there is little information regarding the INH DNA vaccine immunization on male animals. Consequently, we hypothesized that INH DNA vaccines exhibit promising effects on enhancing the reproductive performance of male rats. In this study, we aimed to evaluate the immune responses, reproductive hormone levels, testicular tissue structure, sperm count, sperm deformity rate, and spermatogenesis related gene expression through oral vaccination with INH DNA delivered by C500 strain in rats. Our findings will provide new insights for treating infertility caused by abnormal spermatogenesis.

Methods

All animal experimental procedures were performed in accordance with relevant guidelines set by the Ethics Committee of Hunan Agricultural University, China (Approval number: 432019032).

Recombinant plasmid

The attenuated asd^- /crp^- S. choleraesuis C500 strain (C500) was stored in our laboratory. The kanamycin sequence in the expression vector pVAX1 (Invitrogen, Carlsbad, USA) was replaced by asd DNA sequence of S. typhimurium (GenBank AE008863), named as pVAX-asd. The porcine inhibin α (1–32) (86% homology with rat) and HBsAg-S recombinant gene fragment obtained from the pCIS plasmid (Invitrogen, Carlsbad, USA) was inserted into the NdeI and HindIII sites of the expression vector pVAX-asd, named as pVAX-asd-IS, and then transfected the reconstructed vector pVAX-asd-IS into attenuated asd^- /crp^- S. choleraesuis C500 strain (C500/pVAX-asd-IS) and stroe at ̶ 80°C.

Vaccine identification and large-scale preparation

The C500 and C500/pVAX-asd-IS were recovered in ice, and cultured at 37°C overnight respectively. A single selected colony was inoculated in Luria–Bertani (LB) with antibiotics and cultured at 37°C for 1 h. The plasmids of C500/pVAX-asd-IS and C500 were extracted by Endotoxin-free plasmid extraction Kit (CWBIO, China), and sequenced by Shenzhen BGI Technology Co. LTD. Meanwhile, the plasmids were digested with EcoRI and HindIII (Ferments, China) for 1.5-2 hours, target fragment was detected using 1.5% agarose gel.

C500 and C500/pVAX-asd-IS were inoculated in LB using large bottles at 37°C for large-scale preparation of DNA vaccines, respectively. After 10h, the number of C500 and C500/pVAX-asd-IS in the bacterial solution was assessed using plate colony count method.

Animals and vaccination

Forty healthy male Sprague–Dawley (SD) rats (6-weeks old, 267.5±12 g) were purchased from Hunan Silaikejingda Laboratory Animal Co. LTD., and randomly divided into four groups (n=10 per group), and respectively immunized with 1×10⁸, 1×10⁹, and 1×10¹⁰ CFU of the recombinant inhibin vaccine (group C500/pVAX-asd-IS-L, C500/pVAX-asd-IS-M, and C500/pVAX-asd-IS-H) or 1×10¹⁰CFU C500. The rats were administered orally and immunized thrice (same to primary immunization) with an interval of 14 d.

Sample collection and measurements at decapitation

Blood samples were collected from the caudal vein on days 0, 7, 14, 21, 28, 35, and 42 after primary immunization, and centrifuged at 3000 rpm for 15 min at 4°C, then the serum was separated and stored at −80°C for further analysis.

After 42 days from primary immunization, all rats were anesthetized with phenobarbital sodium and then decapitated. Both testes were removed; epididymides were dissected and cut into pieces in 2 mL of 0.9% saline, filtered, the filtrate was used to determine sperm count and deformity rate as described previously (Nirmal et al., 2017). Analytical balances and vernier calipers were used to determine pairs of testicular weight, length and width. Testis volume was calculated using the formula: v = (4π (width/2)²(length/2))/4 and recorded as an average of both testes. Then, one testis was frozen in liquid nitrogen and stored at −80°C immediately for gene expression analysis, while the other was fixed in Bouin’s solution for histological analysis.

Detection of antibodies against INH

Specific IgG antibodies of serum were determined using an indirect ELISA with synthetic INHα (1-32) antigens (Sigma, USA) as standard antigens on days 0, 7, 14, 21, 28, 35, and 42 after primary immunization according to previously described (Dan et al., 2016b). ELISA results were analyzed in terms of P/N ratios, P/N ratios higher than 2.0 and OD values higher than 0.2 were considered positive responses.

Hormone determination

Serum concentrations of testosterone, inhibin B, LH and FSH were measured using rat-specific ELISA Kits (R&D Systems, USA) according to the manufacturer’s instructions. OD values were measured at 450 nm by a microplate reader. All samples were measured in thrice.

Histological analysis of testes

The testes fixed in Bouin’s solution were dehydrated in a graded ethanol series from water through 70% to 100% ethanol in subsequent steps and embedded in paraffin. The samples were cut into 5 µm thick sections and stained with hematoxylin and eosin (HE). The slides were observed using a light microscope (Motic, China).

Quantitative analysis of mRNA expression

Total RNA was isolated from testis using Column Animal RNAOUT kit (TIANDZ, China), according to the manufacturer’s instructions. The concentration of RNA was detected using Nanodrop-2000 spectrophotometer and the RNA integrity was evaluated by Agilent Bioanalyzer 2100. Total RNA (1μg) isolated from testis was used for cDNA synthesis through PrimeScript RT reagent Kit with gDNA Erase (TAKARA, Japan). Quantitative real-time PCR was performed using a 20 μL reaction volume containing 10 μL of SYBR Premix Ex Tap, 0.4 μL of forward and reverse primers, 0.4 μL of ROX Reference Dye (50X), 2 μL of cDNA and 7.2 mL RNase and DNase- free water. The reaction was run on a StepOne™ Real-Time PCR System (ABI, USA) set at 94°C for 30 s, 40 cycles of 94°C for 10 s, 60°C for 30 s and 72°C for 10 s. House-keeping gene β-actin was used as an internal control and the relative expression of the genes was calculated using the 2^-ΔΔCT method. A significant difference was statistically evaluated with Student’s t- test using SPSS 20.0. The primers used are listed in Table 1.

Table 1
Primer sequences of the three genes(INHβ-B, VIMENTIN and Smad4).

Gene name	Primer sequences (5'→3')	Product length /bp
β-actin	F:GGCTGTATTCCCCTCCATCG; R:CCAGTTGGTAACAATGCCATGT	154
INHβ-B	F:CGCGTCTCCGAGATCATACG; R:CACCACATTCCACCTGTCTCC	180
VIM	F:CGACGCCATCAACACCG; R:GCAACTCCCTCATCTCCTCC	206
SMAD4	F:ATCTATGCCCGTCTGTGGAG; R:AAGTTGGTGGTACTGGTGGC	362

Statistical analysis

Differences in P/N value, growth performance, and serum hormone concentrations were analyzed by performing two-way analysis of variance (ANOVA) using the general linear models (GLM) procedure in the SPSS Statistics 24.0 software (SPSS Software, Inc., Chicago, IL). T esticular weight and volume, epididymal sperm count and deformity rate, and t esticular mRNA expressions of rat were analyzed using one-way ANOVA test followed by Dunnett’s multiple comparison test and significant difference was inferred for p < 0.05 and extremely significant difference p < 0.01. All data were presented as means ± SEM.

Results

Identification of vaccines

To verify the integrity of the DNA vaccines (C500/pVAX-asd-IS and C500), the plasmids were extracted and digested with EcoRI and HindIII endonucleases, and the target fragment of C500/pVAX-asd-IS plasmids (794bp) was displayed on 1.5% agarose gel, and the plasmids of C500 were not appeared (Fig.1). Meanwhile, sequence analysis showed that the C500/pVAX-asd-IS plasmids were intact.

Figure 1
Identification of C500/pVAX-asd-IS and C500. Marker: DNA molecular weight markers (DL-2000); C500: C500 plasmids; C500/pVAX-asd-IS: the target fragment of C500/pVAX-asd-IS plasmids (794bp).

Detection of antibody in serum

The rats immunized with C500/pVAX-asd-IS evidently induced antibodies against INH at 7 d after primary immunization. However, the anti-INH antibodies were not detectable in control group. Furthermore, the P/N values increased after vaccination and differed at 7 d (p<0.05). Following the booster vaccination, the P/N values sharply increased at 14 d (p<0.05). The results indicated that immunization of INH vaccines induced the immune response and production of anti-INH antibodies in rat. (Fig. 2)

Figure 2
The P/N value of antibody against INH after primary immunization. Data are presented as the mean ± SEM (n = 10), Means for given bars, not sharing the same superscripts (a–d), are statistically significantly different, p < 0.05.

Growth performance

For the period between days 0 and 42, the body weight in C500/pVAX-asd-IS groups were greater than that of control group (p >0.05),and there was no significant difference in body weight among C500/pVAX-asd-IS groups (p > 0.05). (Fig. 3)

Figure 3
Effect of INH gene vaccine immunization on body weight of rats. Data are presented as the mean ± SEM (n = 10), Means for given bars, sharing the same superscripts (a), are not statistically significantly different, p > 0.05.

Testicular weight and volume

Compared to control group, immunization against INH promoted testis development, the weight and volume of testes in C500/pVAX-asd-IS groups were increased (p < 0.05) at decapitation, respectively. While epididymis, the weight and volume in C500/pVAX-asd-IS groups were not significantly affected by immunization (p > 0.05). (Fig. 4)

Figure 4
Effects of INH immunization on testicular organ coefficients (A), testicular volume (B), epididymal organ coefficients (C), and epididymal volume (D) of rats. Data are presented as the mean ± SEM (n = 10), * indicate significant difference p <0.05 among groups.

Morphological observation of testes

HE staining did not reveal significant difference to the seminiferous tubules in the C500/pVAX-asd-IS-L group. In C500/pVAX-asd-IS-M and C500/pVAX-asd-IS-H groups, we noticed the basement membrane of seminiferous tubules was thickened, the space between tubules was narrowed, the lumen of seminiferous tubules became larger, the number of spermatogenic cells in the lumen increased, the sperm count increased, and the cytoplasmic remnants of sperm allergy increased compared with the control group. (Fig. 5)

Figure 5
Morphological observation of testes. Cells in spermatogensis are shown as spermatogonia (short arrows), primary spermatocyte (long arrows), spermatid (ellipse), and spermatozoa (square). The figure above – magnification ×100, scale bar = 100 µm; the figure below – magnification ×400, scale bar = 20 µm. Testicular tissues were stained with H and E.

Sperm count and deformity rate in epididymis of rat

The count of sperm in epididymis was calculated using a hemocytometer, and the sperm count was greater in C500/pVAX-asd-IS groups compared with that in control group (p < 0.05), especially, the difference between C500/pVAX-asd-IS-M and the control group was extremely significant (p < 0.01). (Fig. 6A)

Figure 6
Effects of INH immunization on sperm count(A) and deformity rate(B) in epididymis of rat. Results were compared with the control group and data are presented as the mean ± SEM (n = 10), * and ** indicate significant difference p <0.05 and p <0.01 respectively among groups.

The sperm deformity rate of C500/pVAX-asd-IS was less than that of the control group, and the sperm deformity rate of C500/pVAX-asd-IS-M was extremely significantly less than that of the control group (p < 0.01), the sperm deformity rate of C500/pVAX-asd-IS-H was significantly less than that of the control group (p < 0.05).(Fig. 6B)

Serum hormone concentrations

On day 14 after the first immunization, serum INH B concentration in C500/pVAX-asd-IS-M and C500/pVAX-asd-IS-H group declined markedly compared with control group (p < 0.05); and a significantly decrease was observed for INH B amounts on day 28, 35 after the first immunization (p < 0.05) (Fig. 7A). Compared with the control group, the serum FSH concentration in C500/pVAX-asd-IS-M group presented an increasing tendency on day 14, 21, 28, 35, and 42 after the first immunization; levels of FSH also improved in C500/pVAX-asd-IS-H group compared with the control group (p < 0.01) on day 21 and 28 after primary immunization (Fig. 7B). For the LH concentration in serum, the results revealed that there was no significant difference among groups (p > 0.05) (Fig. 7C). Serum T concentrations in the C500/pVAX-asd-IS-M group were significantly greater than that of the control group (p < 0.05) on day on day 7, 21, and 28 after the first immunization (Fig. 7D).

Figure 7
Effects of INH immunization on serum INH B (A), FSH (B), LH (C), and T (D) concentrations of rats. Data are presented as the mean ± SEM (n = 10), Means for given bars, not sharing the same superscripts (a–b), are statistically significantly different, p < 0.05.

mRNA expressions

The mRNA expressions for spermatogenesis related genes in in testes of rats are shown in Fig. 8. Compared to control group, VIM and SMAD4 expressions were increased in C500/pVAX-asd-IS-M and C500/pVAX-asd-IS-H groups (p < 0.05 or p < 0.01). The mRNA amount of INHβ-B in C500/pVAX-asd-IS-M group was greater than control group (p < 0.05).

Figure 8
Relative expression of spermatogenesis related genes in testes of rats. Results were compared with the control group and data are presented as the mean ± SEM (n = 10), * and ** indicate significant difference p <0.05 and p <0.01 respectively among groups.

Discussion

Over the past decade, the use of recombinant attenuated Salmonella vaccine strains for heterologous antigen delivery has increased considerably. In the mucosal immunization routes, the oral route of antigen delivery is the most common and frequently explored, which stimulates both systemic and mucosal immune responses (Zhao et al., 2008). The oral DNA vaccine against Giardia using attenuated Salmonella and carrying CWP2-DNA possesses the satisfied immunogenicity and effectively stimulates the body to produce systemic immunity (IgG) and local mucosal immunity (SIgA) (Zhang et al., 2015). In this study, all rats immunized orally with C500 or C500/pVAX-asd-IS survived, and no signs of disease were observed in the immunized mice throughout the experimental period. In our results, oral inoculation of INH DNA vaccines induced the immune response and production of anti-INH antibodies in rat. The attenuated Salmonella vaccine was administered orally into the intestines and engulfed by phagocytes in Peyer's lymph node in animals, the plasmids were released and transported to the cytosol, where they are integrated into the nucleus, and finally express INH in host cells (Loessner & Weiss, 2004).

INH exhibits a vital role on the hypothalamus-pituitary gonadal (HPG) axis (Rehman et al., 2021). Immunization against INH has been used in mammalian species to improve reproductive efficiency and spermatogenesis (Akhtar et al., 2021). Numbers of sperm started increasing after INH immunization in merino rams (Voge & Wheaton, 2007). Active immunization against INH for bulls, the sperm density was increased, and the number of sperm was increased after the booster immunization (Schanbacher, 1991). Our results showed that INH gene vaccine immunization increased the number of sperm and decreased the sperm deformity rate in rats. The spermatogenic function of testis was positively correlated with its volume, and the spermatogenic dysfunction increased with the reduction of testicular volume (Todorić et al., 2014). In this study, the volume and weight of testis were significantly increased after oral administration of INH gene vaccine. In terms of morphology, the number of spermatogenic cells and the number of layers were relatively increased, and the exfoliated cells in the lumen of tubules were also significantly increased. The number of spermatogenic cells can be explained by the accentuated role of INH (Van Dissel-Emiliani et al., 1989). The presence of ascending numbers of apoptotic cells in C500/pVAX-asd-IS groups enhances importance for normal spermatogenesis.

Apoptosis is a normal physiological phenomenon during testis steroidogenesis (Banerjee & Chaturvedi, 2017). On hypothalamus pituitary gonadal axis, LH and FSH are under positive control of hypothalamic GnRH and gonadal steroid and INH, that exert positive and negative feedback effects on gonadotropins either directly or via hypothalamic GnRH (Themmen & Huhtaniemi, 2000). Previous studies have shown that INH immunization increases FSH concentrations and stimulates follicular development by neutralizing endogenous INH (Wang et al., 2012). Similarly, our study indicated that INH immunization has improved the FSH and T levels. INH immunization produces specific antibodies to neutralize endogenous INH, which promotes the FSH secretion and inhibits LH secretion in a feedback manner (Mitchell et al., 2011). Furthermore, Serum INHB concentrations were decreased in C500/pVAX-asd-IS groups after the booster immunization. In agreement with our finding, it was reported that serum INH B concentrations were also significantly decreased in rats after INH antagonist administration (Akhtar et al., 2019). In this process, the inhibitory effect of INHB on FSH secretion was stronger than the positive feedback effect (Johansen et al., 2014), and the decreased secretion of INHB may regulate and promote the synergistic effect between sertoli cells and germ cells through paracrine, and promoting spermatogenesis. Testicular leydig cells secrete a large amount of testosterone, which promotes and maintains spermatogenesis and testes development (Han et al., 2016).

In the previous study, VIM was identified as a biomarker which involved in seminiferous tubules structure and spermatogenesis (Pecile et al., 2021). VIM regulates various cellular functions through different pathways and plays an important role in the environment of spermatogenesis in male animals (Albert et al., 2012). SMAD4 is absolutely required for FSH synthesis in mice (Fortin et al., 2014). The SMAD4 mRNA was found to be highly expressed in sertoli cells or stromal cells of adult mice, and it is demonstrated that regulating SMAD mRNA and protein expression is a feature of mouse testis development and spermatogenesis (Itman & Loveland, 2008). Testis is underdeveloped during embryonic period in SMAD4 knockout mice, which indicates that this gene plays an important role in testicular development (Archambeault & Yao, 2014).The severely arrested spermatogenesis was accompanied by the significantly decreased mRNA expressions of INHβB in testes (Han et al., 2016), the decrease of INHβB mRNA expressions may lead to the function lesions of testis (Han et al., 2015). In this study, the increased sperm count in C500/pVAX-asd-IS groups, the decreased malformation rate in C500/pVAX-asd-IS-M and C500/pVAX-asd-IS-H groups, the down-regulation of InHβB mRNA in C500/pVAX-asd-IS-M, and the up-regulation of VIM and SMAD4 in C500/pVAX-asd-IS-M and C500/pVAX-asd-IS-H groups indicating that INH immunization may have a positive effect on spermatogenesis in male rats.

Conclusion

This study characterized that neutralization of endogenous INH through oral vaccination with INH DNA delivered by C500 strain successfully elicited a humoral immune response. Oral vaccination with INH DNA vaccine increased testicular weight, volume, spermatogenic cell count in the lumen, sperm cytoplasmic remnants. Oral vaccination with INH DNA vaccine reduced INHB concentrations, enhanced T and FSH concentrations in serum. Furthermore, Oral vaccination with INH DNA changed the INHβ-B, VIM, and SMAD4 mRNA expressions. Therefore, INH immunization may have a positive effect on spermatogenesis and reproductive efficiency in male rats.

Acknowledgements

This study was supported by National Natural Science Foundation of China (3110774 and 31672507), Natural Science Foundation of Hunan province (2020JJ4359), Hunan Agricultural University Double First- Class Construction Project (SYL201802017),Key laboratory project of Guizhou Province ([2020]2003) and the science, Technology supporting project of Science and Technology Bureau of Tongren ([2020]128).

• Financial support:
  JZM received funding for this research from National Natural Science Foundation of China (3110774 and 31672507), Natural Science Foundation of Hunan province (2020JJ4359), Hunan Agricultural University Double First- Class Construction Project (SYL201802017),Key laboratory project of Guizhou Province ([2020]2003) and the science, Technology supporting project of Science and Technology Bureau of Tongren ([2020]128).
• How to cite:
  Meng J, Feng J, Xiao L, Hu N, Lan X, Wang S. Oral vaccination with inhibin DNA vaccine for promoting spermatogenesis in rats. Anim Reprod. 2024;21(4):e20230079. https://doi.org/10.1590/1984-3143-AR2023-0079

References

• Akhtar MF, Ahmad E, Ali I, Shafiq M, Chen Z. The effect of inhibin immunization in seminiferous epithelium of yangzhou goose ganders: a histological study. Animals (Basel). 2021;11(10):2801. http://doi.org/10.3390/ani11102801 PMid:34679823.
  » http://doi.org/10.3390/ani11102801
• Akhtar MF, Wei Q, Zhu H, Chen Z, Ahmad E, Zhendan S, Shi F. The role of active immunization against inhibin alpha-subunit on testicular development, testosterone concentration and relevant genes expressions in testis, hypothalamus and pituitary glands in Yangzhou goose ganders. Theriogenology. 2019;128:122-32. http://doi.org/10.1016/j.theriogenology.2019.01.039 PMid:30743101.
  » http://doi.org/10.1016/j.theriogenology.2019.01.039
• Albert S, Wistuba J, Eildermann K, Ehmcke J, Schlatt S, Gromoll J, Kossack N. Comparative marker analysis after isolation and culture of testicular cells from the immature marmoset. Cells Tissues Organs. 2012;196(6):543-54. http://doi.org/10.1159/000339010 PMid:22739409.
  » http://doi.org/10.1159/000339010
• Al-Obaidi S, Bindon B, Hillard M, O’shea T. Reproductive characteristics of lambs actively immunized early in life with inhibin-enriched preparations from follicular fluid of cows. J Reprod Fertil. 1987;81(2):403-14. http://doi.org/10.1530/jrf.0.0810403 PMid:3123656.
  » http://doi.org/10.1530/jrf.0.0810403
• Archambeault DR, Yao HHC. Loss of smad4 in Sertoli and Leydig cells leads to testicular dysgenesis and hemorrhagic tumor formation in mice. Biol Reprod. 2014;90(3):62. http://doi.org/10.1095/biolreprod.113.111393 PMid:24501173.
  » http://doi.org/10.1095/biolreprod.113.111393
• Ball BA, Davolli GM, Esteller-Vico A, Fleming BO, Wynn MAA, Conley AJ. Inhibin-A and Inhibin-B in stallions: seasonal changes and changes after down-regulation of the hypothalamic-pituitary-gonadal axis. Theriogenology. 2019;123:108-15. http://doi.org/10.1016/j.theriogenology.2018.09.036 PMid:30296651.
  » http://doi.org/10.1016/j.theriogenology.2018.09.036
• Bame J, Dalton J, Degelos S, Good T, Ireland J, Jimenez-Krassel F, Sweeney T, Saacke R, Ireland J. Effect of long-term immunization against inhibin on sperm output in bulls. Biol Reprod. 1999;60(6):1360-6. http://doi.org/10.1095/biolreprod60.6.1360 PMid:10330093.
  » http://doi.org/10.1095/biolreprod60.6.1360
• Banerjee S, Chaturvedi CM. Apoptotic mechanism behind the testicular atrophy in photorefractory and scotosensitive quail: involvement of GnIH induced p-53 dependent Bax-Caspase-3 mediated pathway. J Photochem Photobiol B. 2017;176:124-35. http://doi.org/10.1016/j.jphotobiol.2017.09.023 PMid:28992606.
  » http://doi.org/10.1016/j.jphotobiol.2017.09.023
• Bohring C, Krause W. Serum levels of inhibin B in men with different causes of spermatogenic failure. Andrologia. 1999;31(3):137-41. http://doi.org/10.1111/j.1439-0272.1999.tb01400.x PMid:10363117.
  » http://doi.org/10.1111/j.1439-0272.1999.tb01400.x
• Dan X, Han L, Riaz H, Luo X, Liu X, Chong Z, Yang L. Construction and evaluation of the novel DNA vaccine harboring the inhibin α (1-32) and the RF-amide related peptide-3 genes for improving fertility in mice. Exp Anim. 2016a;65(1):17-25. http://doi.org/10.1538/expanim.15-0044 PMid:26437787.
  » http://doi.org/10.1538/expanim.15-0044
• Dan X, Liu X, Han Y, Liu Q, Yang L. Effect of the novel DNA vaccine fusing inhibin alpha (1-32) and the RF-amide related peptide-3 genes on immune response, hormone levels and fertility in Tan sheep. Anim Reprod Sci. 2016b;164:105-10. http://doi.org/10.1016/j.anireprosci.2015.11.018 PMid:26642750.
  » http://doi.org/10.1016/j.anireprosci.2015.11.018
• Fortin J, Boehm U, Deng CX, Treier M, Bernard DJ. Follicle-stimulating hormone synthesis and fertility depend on SMAD4 and FOXL2. FASEB J. 2014;28(8):3396-410. http://doi.org/10.1096/fj.14-249532 PMid:24739304.
  » http://doi.org/10.1096/fj.14-249532
• Han H, Sun Z, Luo G, Wang C, Wei R, Wang J. Fluoride exposure changed the structure and the expressions of reproductive related genes in the hypothalamus-pituitary-testicular axis of male mice. Chemosphere. 2015;135:297-303. http://doi.org/10.1016/j.chemosphere.2015.04.012 PMid:25966048.
  » http://doi.org/10.1016/j.chemosphere.2015.04.012
• Han L, Zhen YH, Liang AX, Zhang J, Riaz H, Xiong JJ, Guo AZ, Yang LG. Oral vaccination with inhibin DNA delivered using attenuated Salmonella choleraesuis for improving reproductive traits in mice. J Basic Microbiol. 2014;54(9):962-8. http://doi.org/10.1002/jobm.201300052 PMid:24123188.
  » http://doi.org/10.1002/jobm.201300052
• Han XF, Li JL, Zhou YQ, Ren XH, Liu GC, Cao XH, Du XG, Zeng XY. Active immunization with GnRH-tandem-dimer peptide in young male rats reduces serum reproductive hormone concentrations, testicular development and spermatogenesis. Asian J Androl. 2016;18(3):485-91. http://doi.org/10.4103/1008-682X.156856 PMid:26208395.
  » http://doi.org/10.4103/1008-682X.156856
• Itman C, Loveland KL. SMAD expression in the testis: an insight into BMP regulation of spermatogenesis. Dev Dyn. 2008;237(1):97-111. http://doi.org/10.1002/dvdy.21401 PMid:18069690.
  » http://doi.org/10.1002/dvdy.21401
• Johansen ML, Anand-Ivell R, Mouritsen A, Hagen CP, Mieritz MG, Søeborg T, Johannsen TH, Main KM, Andersson AM, Ivell R, Juul A. Serum levels of insulin-like factor 3, anti-Mullerian hormone, inhibin B, and testosterone during pubertal transition in healthy boys: a longitudinal pilot study. Reproduction. 2014;147(4):529-35. http://doi.org/10.1530/REP-13-0435 PMid:24459206.
  » http://doi.org/10.1530/REP-13-0435
• Jørgensen N, Liu F, Andersson AM, Vierula M, Irvine DS, Auger J, Brazil CK, Drobnis EZ, Jensen TK, Jouannet P, Overstreet JW, Redmon JB, Sparks A, Toppari J, Wang C, Skakkebæk NE, Swan SH. Serum inhibin-b in fertile men is strongly correlated with low but not high sperm counts: a coordinated study of 1,797 European and US men. Fertil Steril. 2010;94(6):2128-34. http://doi.org/10.1016/j.fertnstert.2009.12.051 PMid:20149358.
  » http://doi.org/10.1016/j.fertnstert.2009.12.051
• Li Y, Fortin J, Ongaro L, Zhou X, Boehm U, Schneyer A, Bernard DJ, Lin HY. Betaglycan (TGFBR3) functions as an inhibin A, but not inhibin B, coreceptor in pituitary gonadotrope cells in mice. Endocrinology. 2018;159(12):4077-91. http://doi.org/10.1210/en.2018-00770 PMid:30364975.
  » http://doi.org/10.1210/en.2018-00770
• Loessner H, Weiss S. Bacteria-mediated DNA transfer in gene therapy and vaccination. Expert Opin Biol Ther. 2004;4(2):157-68. http://doi.org/10.1517/14712598.4.2.157 PMid:14998775.
  » http://doi.org/10.1517/14712598.4.2.157
• Lovell TM, Knight PG, Groome NP, Gladwell RT. Measurement of dimeric inhibins and effects of active immunization against inhibin α-subunit on plasma hormones and testis morphology in the developing cockerel. Biol Reprod. 2000;63(1):213-21. http://doi.org/10.1095/biolreprod63.1.213 PMid:10859262.
  » http://doi.org/10.1095/biolreprod63.1.213
• Martin T, Williams G, Lunstra D, Ireland J. Immunoneutralization of inhibin modifies hormone secretion and sperm production in bulls. Biol Reprod. 1991;45(1):73-7. http://doi.org/10.1095/biolreprod45.1.73 PMid:1715195.
  » http://doi.org/10.1095/biolreprod45.1.73
• McKeown R, O’Callaghan D, Roche J, Boland M. Effect of immunization of rams against bovine inhibin α1–26 on semen characteristics, scrotal size, FSH, LH and testosterone concentrations. J Reprod Fertil. 1997;109(2):237-45. http://doi.org/10.1530/jrf.0.1090237 PMid:9155733.
  » http://doi.org/10.1530/jrf.0.1090237
• Mitchell V, Robin G, Boitrelle F, Massart P, Marchetti C, Marcelli F, Rigot JM. Correlation between testicular sperm extraction outcomes and clinical, endocrine and testicular histology parameters in 120 azoospermic men with normal serum FSH levels. Int J Androl. 2011;34(4pt1):299-305. http://doi.org/10.1111/j.1365-2605.2010.01094.x PMid:20695924.
  » http://doi.org/10.1111/j.1365-2605.2010.01094.x
• Nirmal NK, Awasthi KK, John PJ. Effects of hydroxyl-functionalized multiwalled carbon nanotubes on sperm health and testes of Wistar rats. Toxicol Ind Health. 2017;33(6):519-29. http://doi.org/10.1177/0748233716685661 PMid:28073318.
  » http://doi.org/10.1177/0748233716685661
• Pecile A, Groppetti D, Pizzi G, Banco B, Bronzo V, Giudice C, Grieco V. Immunohistochemical insights into a hidden pathology: canine cryptorchidism. Theriogenology. 2021;176:43-53. http://doi.org/10.1016/j.theriogenology.2021.09.011 PMid:34571397.
  » http://doi.org/10.1016/j.theriogenology.2021.09.011
• Petrozzi A, Pallotti F, Pelloni M, Anzuini A, Radicioni AF, Lenzi A, Paoli D, Lombardo F. Inhibin B: are modified ranges needed for orchiectomised testicular cancer patients? Asian J Androl. 2019;21(4):332-6. http://doi.org/10.4103/aja.aja_93_18 PMid:30531061.
  » http://doi.org/10.4103/aja.aja_93_18
• Rehman A, Ahmad E, Arshad U, Riaz A, Akhtar MS, Ahmad T, Khan JA, Mohsin I, Shi Z, Sattar A. Effects of immunization against inhibin α-subunit on ovarian structures, pregnancy rate, embryonic and fetal losses, and prolificacy rate in goats where estrus was induced during the non-breeding season. Anim Reprod Sci. 2021;224:106654. http://doi.org/10.1016/j.anireprosci.2020.106654 PMid:33249352.
  » http://doi.org/10.1016/j.anireprosci.2020.106654
• Schanbacher B. Pituitary and testicular responses of beef bulls to active immunization against inhibin alpha. J Anim Sci. 1991;69(1):252-7. http://doi.org/10.2527/1991.691252x PMid:1900828.
  » http://doi.org/10.2527/1991.691252x
• Themmen AP, Huhtaniemi IT. Mutations of gonadotropins and gonadotropin receptors: elucidating the physiology and pathophysiology of pituitary-gonadal function. Endocr Rev. 2000;21(5):551-83. http://doi.org/10.1210/edrv.21.5.0409 PMid:11041448.
  » http://doi.org/10.1210/edrv.21.5.0409
• Todorić D, Durdov MG, Tandara M, Čapkun V, Jurić I, Biočić M, Meštrović J, Pogorelić Z. Influence of open testicular biopsy in prepubertal rats on rats’ adulthood fertility with correlation to serum levels of inhibin B and follicle stimulating hormone. J Pediatr Urol. 2014;10(6):1063-9. http://doi.org/10.1016/j.jpurol.2014.03.012 PMid:24856973.
  » http://doi.org/10.1016/j.jpurol.2014.03.012
• Van Dissel-Emiliani FMF, Grootenhuis AJ, Jong FHD, Rooij DGD. Inhibin reduces spermatogonial numbers in testes of adult mice and Chinese hamsters. Endocrinology. 1989;125(4):1898-903. http://doi.org/10.1210/endo-125-4-1898 PMid:2647466.
  » http://doi.org/10.1210/endo-125-4-1898
• Voge J, Wheaton J. Effects of immunization against two inhibin antigens on daily sperm production and hormone concentrations in ram lambs. J Anim Sci. 2007;85(12):3249-55. http://doi.org/10.2527/jas.2007-0506 PMid:17878277.
  » http://doi.org/10.2527/jas.2007-0506
• Wang SL, Han L, Ahmad S, Cao SX, Xue LQ, Xing ZF, Feng JZ, Liang AX, Yang LG. Effect of a DNA vaccine harboring two copies of inhibin α (1-32) fragments on immune response, hormone concentrations and reproductive performance in rats. Theriogenology. 2012;78(2):393-401. http://doi.org/10.1016/j.theriogenology.2012.02.019 PMid:22592078.
  » http://doi.org/10.1016/j.theriogenology.2012.02.019
• Yalti S, Gürbüz B, Fiçicioğlu C. Serum levels of inhibin B in men and their relationship with gonadal hormones, testicular volume, testicular biopsy results and sperm parameters. J Obstet Gynaecol. 2002;22(6):649-54. http://doi.org/10.1080/0144361021000020466 PMid:12554256.
  » http://doi.org/10.1080/0144361021000020466
• Zhang HM, Zheng WY, Yao LI, Jiang XM, Feng XM. Oral immunization with CWP2-S DNA vaccine delivered by attenuated Salmonella typhimurium induces strong mucosal IgA response. Chin J Vet Med. 2015;51:28-30.
• Zhao Z, Xu Y, Wu B, Cheng X, Li Y, Tang X, Zhang C, Chen H. Characterization of attenuated Salmonella C500 strain with a delta asd mutant and use as an asd+ balanced-lethal host-vector system. Sheng wu Gong Cheng xue bao=. Chin J Biotechnol. 2009;25(1):29-36. PMid:19441223.
• Zhao Z, Xue Y, Wu B, Tang X, Hu R, Xu Y, Guo A, Chen H. Subcutaneous vaccination with attenuated Salmonella enterica serovar Choleraesuis C500 expressing recombinant filamentous hemagglutinin and pertactin antigens protects mice against fatal infections with both S. enterica serovar Choleraesuis and Bordetella bronchiseptica. Infect Immun. 2008;76(5):2157-63. http://doi.org/10.1128/IAI.01495-07 PMid:18268026.
  » http://doi.org/10.1128/IAI.01495-07

Publication Dates

• Publication in this collection
  04 Oct 2024
• Date of issue
  2024

History

• Received
  27 May 2023
• Accepted
  28 June 2024