Interploid hybrids in the ‘brizantha’ complex of Urochloa P. Beauv.: identification, genome size, cytogenetic characterization and perspectives

ABSTRACT.

Crossing between sexual artificial tetraploids of Urochloa ruziziensis and apomictic polyploids of Urochloa decumbens, and Urochloa brizantha is a breeding strategy. Crosses are carried out without prior emasculation of the plants; therefore, confirmation of hybridization and identification of pollen donors require reliable techniques such as microsatellite markers. Information on the reproductive mode, chromosome number, and genome size is also important. The aims of this study were (i) to identify the male parents and mode of reproduction of the three hybrids using molecular markers, (ii) to define the chromosome number and ribosomal DNA (rDNA) sites using fluorescent in situ hybridization (FISH), and (iii) to estimate genome size using flow cytometry. The simple sequence repeats (SSR) markers identified U. brizantha cv. Marandu, U. brizantha genotype 2 and U. brizantha cv. Xaraés as the male parents of hybrids 1F/21, 7F/153, and 10F/v5, respectively. The 1F/21 hybrid was aneuploid (2n = 36+1, 2C = 3.61 pg), whereas the 7F/153 (2n = 40, 2C = 3.79 pg) and 10F/v5 (2n = 41, 2C = 3.88 pg) hybrids resulted from interploid crosses involving U. brizantha (2n = 5x = 45). The p779/p780 apospory marker was not amplified in the hybrids, indicating sexual reproduction. The number of rDNA sites shows a dynamic behavior and inheritance of these sequences, while the position of the sites on the chromosomes is conserved within the ‘brizantha’ complex. Identifying interploid hybrids provides new perspectives for Urochloa breeding, with the possibility of exploring the genetic variability of other apomictic polyploids. These results are promising in terms of inferences and highlight the need for further studies on interploid hybridization in Urochloa.

Keywords:
aneuploidy; Brachiaria; FISH; polyploidy; SSR markers

Introduction

The increasing demand for agricultural products due to population growth has been accompanied by the adoption of more sustainable systems. Pastures composed of improved and properly managed forage are more efficient because they contribute to increased productivity without expanding the cultivated areas (Jank et al., 2021). The genus Urochloa P. Beauv. [syn. Brachiaria (Trin.) Griseb.] has important tropical forages with good yield, nutritional quality, and adaptability to low fertility soils (Jank et al., 2014; Ferreira et al., 2021), as the species of the ‘brizantha’ complex: Urochloa brizantha (A.Rich.) R.D. Webster, Urochloa decumbens (Stapf) R.D. Webster and Urochloa ruziziensis (R. Germ. & C.M. Evrard) Crins (Ferreira et al., 2021).

Urochloa breeding programs developed since 1980 at important institutions have contributed to improvements in pasture systems. Despite these promising results, breeding programs for this genus are relatively recent, and some characteristics of the species, such as polyploidy and apomixis, pose additional challenges for breeders (Ferreira et al., 2021; Simeão et al., 2021). One strategy to explore the genetic variability of apomictic genotypes is to use them as pollen donors in crosses with sexual genotypes. In the ‘brizantha’ agamic complex (x = 9), the artificial polyploidization of U. ruziziensis produced sexual tetraploid genotypes (2n = 4x = 36) (Ishigaki et al., 2009; Timbó et al., 2014a) and facilitated crossing with apomictic allotetraploids of U. brizantha and U. decumbens (Risso-Pascotto et al., 2005; Mendes-Bonato et al., 2007). This procedure has enabled the availability of several cultivars worldwide (Ferreira et al., 2021). Several hybrids are continually being produced and evaluated by research centers and partner institutions to obtain new promising genotypes for current problems.

Effective identification of hybrids is one of the limiting factors in breeding because, as there is no emasculation before crossing, some plants of the progeny may be the result of self-fertilization (Valle & Pagliarini, 2009). In addition, the hybridization system often occurs via polycrosses with open pollination (Valle & Miles, 2001; Valle & Pagliarini, 2009), making it challenging to identify male parents and certify the hybridization. Therefore, the application of efficient procedures, such as molecular marker analysis, is essential for breeding programs and has been commonly used in Paspalum L. to confirm the hybrid condition in crosses with sexual and apomictic polyploid parents (Aguilera et al., 2011; Novo et al., 2017; Brugnoli et al., 2019; Ortiz et al., 2020).

Microsatellite or simple sequence repeats (SSR) are highly polymorphic markers with good reproducibility, relative abundance, and extensive genome coverage (Powell et al., 1996; Kalia et al., 2011). Several SSR markers have been described and evaluated in Urochloa (Jungmann et al., 2009a; Jungmann et al., 2009b; Vigna et al., 2011; Ferreira et al., 2016; Triviño et al., 2017), but have not yet been used for paternity analysis in the ‘brizantha’ complex.

Moreover, information regarding the reproduction mode of hybrids is crucial for breeding. In this sense, the use of the p799/p780 marker, developed for the apospory-specific genome region (ASGR) (Akiyama et al., 2011), is efficient for diagnosing the mode of reproduction of several species and hybrids of Urochloa (Worthington et al., 2016; Worthington et al., 2019). This tool provides quick answers for different genotypes, helping breeders make decisions.

Considering the polyploidy and wide variation in the chromosome number of Urochloa genotypes (Penteado et al., 2000; Valle & Pagliarini, 2009), cytogenetics analyses are important at different breeding stages, including post-hybridization. Recently, cytogenetic analyses identified aneuploid hybrids from the crossing of U. ruziziensis (4x) with U. decumbens and U. brizantha (both 4x) (Paula et al., 2017; Moraes et al., 2019; Rocha et al., 2019).

In the present study, we tested SSR markers to confirm interspecific hybridization and paternity of Urochloa hybrids. Subsequently, we determined the mode of reproduction using the ASGR p779/p780 marker and performed cytogenetic analyses to determine the chromosome number, location of rDNA sites, and genome size of the hybrids and their respective parents.

Material and methods

Plant material

Analyses were conducted using nine genotypes (Table 1) provided by Empresa Brasileira de Pesquisa Agropecuária (Embrapa) Gado de Leite, Juiz de Fora, Minas Gerais State, Brazil. The selected hybrids exhibited interesting agronomic characteristics. They were obtained by polycrossing without prior emasculation and, therefore, with unknown male parents. Clones obtained by vegetative propagation of tillers were maintained in pots in a greenhouse under similar environmental conditions (temperature, humidity, photoperiod, irrigation, and fertilization).

Table 1
Genotypes of the evaluated Urochloa species and hybrids.

Identification	Genotype	Description
1M	U. ruziziensis 4x	female parent
7M	U. ruziziensis 4x	female parent
10M	U. ruziziensis 4x	female parent
1F/21	hybrid	1M x (?)*
7F/153	hybrid	7M x (?)*
10F/v5	hybrid	10M x (?)*
cv. Marandu	U. brizantha 4x	Pollen donor
genotype 2	U. brizantha 5x	Pollen donor
cv. Xaraés	U. brizantha 5x	Pollen donor

• *unknown male parent

DNA extraction, polymerase chain reaction (PCR), and SSR analysis

DNA was extracted from young leaves using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s recommendations. DNA integrity was assessed on a 1% agarose gel, and the samples were quantified using a NanoVue spectrophotometer.

Seventeen SSR markers (Table 2) described in the literature showing certified transfer to at least one species were tested (Jungmann et al., 2009a and b). For each reaction, 50 ng genomic DNA, 0.4 μM each primer, 1× Master mix (Cellco Biotec, São Carlos, Brazil), and water to complete the final volume of 25 μL were used. The thermocycler conditions were an initial denaturation at 95°C for 2 min.; followed by 35 amplification cycles of 95°C for 30 s, primer-specific annealing temperature (Table 2) for 50 s, and 72°C for 1 min. and 20 s; and an additional extension step at 72°C, for 7 min. and a hold step at 4°C. Amplification products were resolved by electrophoresis on a 3% agarose gel and, when necessary, on a 3% MetaPhor agarose gel, following the manufacturer’s recommendations (Lonza, Rockland, ME, USA). Product size was determined by comparison with a 1 kb ladder (Invitrogen, Carlsbad, CA, USA). Owing to Urochloa polyploidy, the SSR bands were classified as absent or present, like a dominant marker.

Identification of the mode of reproduction with the p779/p780 marker

The p779/p780 marker, which amplifies ASGR-BBML, was used to identify the mode of reproduction (Akiyama et al., 2011). PCR was also performed using the ITS-F/ITS-R primer pair designed for the internal transcribed spacer (ITS) region of rDNA (Table 2), as a positive control. The amplification conditions were as described above, and the amplified products were visualized on a 1% agarose gel.

Nuclear DNA content

Samples of young leaf tissue (20-30 mg) of each genotype and Pisum sativum L. (internal reference standard, 2C value = 9.09 pg) were macerated in a Petri dish containing 1 mL ice-cold LB01 buffer (Doležel et al., 1989). The nuclear suspension was stained with 25 µL propidium iodide (1 mg mL^-1), and at least 10,000 nuclei per sample were quantified in a Facscalibur cytometer (BD Biosciences, San Jose, CA, USA). Histograms were obtained using CellQuest software and analyzed using WinMDI 2.8 software (http://www.cyto.purdue.edu/flowcyt/software/Winmdi.htm). The average genome size was estimated in pg, considering three replications per genotypes, and compared using the Scott-Knott test (Scott & Knott, 1974) at 5% probability using Sisvar software (Ferreira, 2011).

Chromosome preparations and fluorescent in situ hybridization (FISH)

Root tips were collected and pre-treated with a solution of cycloheximide (88.9 µM) and APM (amiprophos-methyl, 4 µM) for 2 hours at room temperature (RT). Subsequently, the material was fixed in methanol: acetic acid (3:1) solution for 24h at RT and stored in 90% ethanol at -20°C. The meristems were excised and submitted to enzymatic digestion in a mix comprising 0.7% Onozuka R10 cellulase, 0.7% cellulase, 1% pectolyase, and 1% cytohelicase for approximately 1h 40 min. at 37°C. Slides were prepared using cell dissociation and air-drying techniques (Fukui & Nakayama, 1996).

FISH was performed using probes for 35S rDNA (pTa71) and 5S rDNA sequences (RICRGAC1/RICRGAC2 primers; Table 2) labeled with biotin-16-dUTP or digoxigenin-12-dUTP, respectively, via nick translation and PCR. The chromosomes were denatured in 70% formamide (2× SSC) for 1 min. 10 s at 85°C, followed by dehydration in an alcohol series (70%, 90%, and 100%). The hybridization mix (50% formamide, 10% dextran sulfate, 2× SSC, 50-100 ng of probe) was denatured for 8 min at 95°C and immediately transferred to ice. Hybridization occurred for 40-48h in a humid chamber at 37°C. Probe detection was performed with rhodamine-conjugated anti-digoxigenin and Alexa fluor 488-conjugated streptavidin at 37°C for 1h after stringency washes in 2× SSC buffer at 42°C.

Chromosomes were counterstained with DAPI (4’,6-diamidino-2-phenylindole) in a Vectashield Antifade mounting medium (1.5 µg mL^-1). At least ten metaphases were evaluated and captured for each genotype using a QImaging Retiga EXi CCD camera coupled with a BX 60 fluorescence microscope (Olympus, Tokyo, Japan). Images were processed using Adobe Photoshop version 23.5.2 software (https://www.adobe.com/br/products/photoshop.html).

Table 2
Primers used in polymerase chain reactions (PCR).

Primer	Primer (5'-3')	Annealing Temperature (°C)	Reference
BhUNICAMP003	CTGTCAGCATGGTTCACTAATAA	51	Jungmann et al., 2009a
	GCATCGAATAAAGCTCAGAAAG
BhUNICAMP004	AGTTTGCTGCCTCTTTGATTC	51	Jungmann et al., 2009a
	GTGGCGCTACCTTCTTGTG
BhUNICAMP005	CACTGCATCAACTACCCACCAC	52	Jungmann et al., 2009a
	GTCTGCTTTGCTTGCGTTACCT
BhUNICAMP015	AGGGGAGAACTGTGGTGGTGTC	55	Jungmann et al., 2009a
	TCGAGTTTTGAGGGTGGGATTG
BhUNICAMP018	TCCATATCCAACAAGGCAACAT	52	Jungmann et al., 2009a
	GCGCGAGCTGGTGAAGT
BhUNICAMP020	CCGGCCGGTTCACTCGT	52	Jungmann et al., 2009a
	GGCACTCGGACTCCCATAACTC
BbUNICAMP001	AGCGTGCTGATTCCGACCTT	52	Jungmann et al., 2009b
	GAAATGGCTATGCGAAATGTGT
BbUNICAMP002	TCGCTCGTTTCATTCCTTTCAT	53	Jungmann et al., 2009b
	CGCACGCTTATACGACAACATT
BbUNICAMP003	GCTACAGGCTACGTTGAGAAGA	52	Jungmann et al., 2009b
	ACAGGTGAGCAGTATGAGTCCA
BbUNICAMP004	ACCCCGCTGCATACCCATAAT	52	Jungmann et al., 2009b
	TTTTTGCCCCATCACTCTCTTTG
BbUNICAMP005	CGTTATGCGGCGACACT	48	Jungmann et al., 2009b
	AAGAAACTCCATGAAAAACAGA
BbUNICAMP006	GGGGCCACTGACCAAAAC	52	Jungmann et al., 2009b
	GCGTAGCTACCCGAATCC
BbUNICAMP009	AGGAGAGGGAGGAGAGGAGAAT	53	Jungmann et al., 2009b
	GCGAGTTGTTAATGAAGTGAGGA
BbUNICAMP010	TCGTTCAGTTGAGTCGTCTTCT	52	Jungmann et al., 2009b
	GCCATTCCGCCATCATAG
BbUNICAMP011	GCTCGGGAATACAGGCTTGAAA	53	Jungmann et al., 2009b
	GAAACGCGTCGGGGTGATT
BbUNICAMP012	CGCGCATTACAGACTACAGA	48	Jungmann et al., 2009b
	TAGAGAAGGCAATTGATTAGATAG
BhUNICAMP013	ATGCAGCGGAAACATCTC	52	Jungmann et al., 2009b
	ACTTCCTCCACTTCCACTCTG
p779/p780	TATGTCACGACAAGAATATG	52	Akiyama et al., 2011
	TGTAACCATAACTCTCAGCT
ITS-F/ITS-R	CGTGACCCTTAAACAAAACA	57	Torres González; Morton, 2005
	GGTCGTCTATGAGTCCTAAG
RICRGAC1/RICRGAC2	GATCCCATCAGAACTCCAAG	60	Doleželová et al., 1998 (personal communications with Fukui e Ohmido)
	CGGTGCTTTAGTGCTGGTATG

Results

Paternity and mode of reproduction analyses

Seven of the seventeen SSR markers tested (Table 2) produced polymorphisms that were considered informative (Figure 1). The BhUNICAMP004 (Figure 1a) and BhUNICAMP015 (Figure 1b) primers produced polymorphic markers in U. brizantha genotype 2 and hybrid 7F/153 but were not present in the 7M maternal parent (U. ruziziensis), indicating the respective genotype as a pollen donor for this hybrid. The BhUNICAMP015 (Figure 1b) and BbUNICAMP001 (Figure 1c) primers formed polymorphic markers in the 10F/v5 hybrid and the Xaraés cultivar (U. brizantha), identifying it as the parent involved in the formation of this hybrid. The Marandu cultivar of U. brizantha was identified as the male parent of the 1F/21 hybrid based on the pattern of marks obtained using the BbUNICAMP013 primer (Figure 1d). The BhUNICAMP005, BhUNICAMP018, and BbUNICAMP004 primers, despite not producing polymorphisms among the possible pollen donors, certified the hybrid condition of the 1F/21, 7F/153, and 10F/v5 genotypes because they produced polymorphic markers between the female and male parents that were present in the offspring (Figure 1e-g).

Figure 1
Polymorphic products amplified by polymerase chain reaction (PCR) with BhUNICAMP004 (a), BhUNICAMP015 (b), BbUNICAMP001 (c), BbUNICAMP013 (d), BhUNICAMP005 (e), BhUNICAMP018 (f), and BbUNICAMP004 (g) SSR markers in Urochloa genotypes. L, ladder; NC, negative control; M, U. brizantha cv. Marandu; P, U. brizantha genotype 2; X, U. brizantha cv. Xaraés; 1F, hybrid 1F/21; 7F, hybrid 7F/153; 10F, hybrid 10F/v5; 1M, U. ruziziensis 1M; 7M, U. ruziziensis 7M; 10M, U. ruziziensis 10M.

Eight markers (BhUNICAMP003, BbUNICAMP002, BbUNICAMP003, BbUNICAMP005, BbUNICAMP006, BbUNICAMP009, BbUNICAMP010, and BbUNICAMP012) showed good amplification but did not produce conclusive polymorphic markers. Two other markers (BhUNICAMP020 and BbUNICAMP011) did not show amplification or was nonspecific amplification.

The apomictic genotypes of U. brizantha presented a specific marker for the p779/780 apospory marker, which was not observed in the sexual parents of U. ruziziensis or the interspecific hybrids (Figure 2a). The ITS region of the rDNA was amplified in all genotypes, producing a fragment of approximately 550 bp (Figure 2b), confirming that the genomics DNAs were adequate for verifying the apospory marker.

Figure 2
Polymerase chain reaction (PCR) amplified products of the p779/p780 marker (a) and internal transcribed spacer region (b) in Urochloa genotypes. L, ladder; NC, negative control; M, U. brizantha cv. Marandu; P, U. brizantha genotype 2; X, U. brizantha cv. Xaraés; 1F, hybrid 1F/21; 7F, hybrid 7F/153; 10F, hybrid 10F/v5; 1M, U. ruziziensis 1M; 7M, U. ruziziensis 7M; 10M, U. ruziziensis 10M.

Nuclear DNA content, chromosome number, and ribosomal DNA sites

The tetraploid genotypes of U. ruziziensis (2n = 4x = 36 chromosomes) were allocated to the same statistical group for the genome size (Table 3 and Figure 3). No statistical difference was detected in the monoploid genome size (Cx) between genotype 2 (2n = 5x = 45) and cv. Marandu (2n = 4x = 36) (Table 3) in U. brizantha. The 1F/21 hybrid was identified as aneuploid (2n = 4x = 36+1) (Figure 4d) and was statistically different from the other hybrids with smaller genome sizes (Table 3 and Figure 3). Hybrids 7F/153 and 10F/v5 had statistically similar DNA content (Table 3) and 2n = 40 and 2n = 41 chromosomes, respectively (Figure 4e and f), confirming the interploid crosses.

The numbers of 35S and 5S rDNA sites varied between the hybrids and parents, but they were always in the terminal and interstitial positions in the chromosomes, respectively (Figure 4). U. ruziziensis (10M) and the three hybrids showed six, five, and three 35S rDNA sites and differed from the other genotypes. The 5S rDNA sites were the same for U. ruziziensis genotypes but varied between hybrids and between U. brizantha genotypes (Table 3 and Figure 4).

Table 3
Genome size, chromosome number, and number of ribosomal DNA sites of Urochloa genotypes.

Genotype	2C Value (pg)*	Cx Value (pg)*	Ploidy	Chromosome number (2n)	rDNA sites
					35s	5s
U. ruziziensis 1M	3.13ª	0.78a	4x	36	4	8
U. ruziziensis 7M	3.07ª	0.77a	4x	36	4	8
U. ruziziensis 10M	3.20ª	0.80a	4x	36	6	8
Hybrid 1F/21	3.61c	0.90c	4x	37	5	7
Hybrid 7F/153	3.79d	-	interploid	40	3	6
Hybrid 10F/v5	3.88d	-	interploid	41	3	6
U. brizantha cv. Marandu	3.44b	0.86b	4x	36	4	6
U. brizantha genotype 2	4.27e	0.85b	5x	45	4	5
U. brizantha cv. Xaraés	4.45f	0.89c	5x	45	4	6

• *Means followed by different letters are significantly different by Scott-Knott test, at 5% probability.

Figure 3
Flow cytometry histograms for quantification of nuclear DNA in picograms of Urochloa genotypes. Standard: Pisum sativum was used as an internal reference standard (2C = 9.09 pg)

Figure 4
Location of 35S (arrow) and 5S (arrowhead) rDNA sites in mitotic metaphase chromosomes of parental and hybrids Urochloa. U. ruziziensis: a) 1M; b) 7M; c) 10M. Hybrids: d) 1F/21; e) 7F/153; f) 10F/v5. U. brizantha: g) cv. Marandu; h) genotype 2; i) cv. Xaraés; Bar: 10 µm.

Discussion

Interploid crosses and the new possibilities for breeding Urochloa

The SSR markers used in our study efficiently confirmed hybridization and identified the male parents involved in the crosses. In Urochloa, the identification of hybrids is usually based on contrasting phenotypic differences between parents and is corroborated by the intermediate characteristics observed in the hybrids (Valle & Miles, 2001). However, considering the greater plasticity of morphological characters and the limitation in the number of these markers, monitoring paternity has been a laborious and inaccurate task, especially among species of the ‘brizantha’ complex, which are phylogenetically close (Triviño et al., 2017; Pessoa-Filho et al., 2017). Some authors have even considered U. ruziziensis and U. decumbens as synonyms of Urochloa eminii (Mez) Davidse (Plants of the World Online [POWO], 2023).

Urochloa Breeding via hybridization requires reliable methods for the effective identification of hybrids. Molecular markers are important tools because they enable direct access to the plant genotype without being influenced by environmental effects, early and rapid analysis of the material (Kordrostami & Rahimi, 2015). In grasses of Paspalum genus, random amplified polymorphism DNA (RAPD) and inter simple sequence repeat (ISSR) markers are commonly used to monitor crosses between apomictic and sexual genotypes and confirm the hybrid origin (Aguilera et al., 2011; Novo et al., 2017; Brugnoli et al., 2019; Ortiz et al., 2020). SSR markers could define unique genotypes and are excellent for hybrid identification and genotyping (Powell et al., 1996; Kalia et al., 2011). Several studies have used this marker for similar purposes in other economically important species, such as rice (Sundaram et al., 2008), citrus (Oliveira et al., 2002) and cotton (Selvakumar et al., 2010).

The chromosome number and estimated average DNA content of the parents and hybrids corroborated the results obtained with SSR markers and showed the occurrence of crosses between tetraploid and pentaploid parents in the formation of hybrids 7F/153 and 10F/v5. Our results suggested that the fusion of gametes with 18 chromosomes of U. ruziziensis (7M) + 22 chromosomes of U. brizantha genotype 2 resulted in the formation of hybrids 7F/153 (40 chromosomes) and 18 chromosomes of U. ruziziensis (10M) + 23 chromosomes of U. brizantha cv. Xaraés in 10F/v5 hybrid (41 chromosomes). This assumption is based on available information and was confirmed for the 7F/153 hybrid through genomic in situ hybridization (GISH) (Moraes et al., unpublished data). The application of GISH in other hybrids and parents can help to elucidate the genomic composition and inheritance of chromosomes involving species of the ‘brizantha’ complex.

It is uncommon to use genotypes with odd ploidies as parents in Urochloa breeding. However, our results show that interesting genotypes with other ploidy levels can be used successfully in crosses of the ‘brizantha’ complex. The formation of hybrids from interploid crosses has also been reported in previous studies on Brassica (Wen et al., 2012), wheat (Padmanaban et al., 2017), and strawberries (Luo et al., 2017). In the Urochloa genus, Hacker (1988) obtained a triploid intraspecific hybrid from a cross between the diploid and tetraploid cytotypes of U. decumbens. Nitthaisong et al. (2019) produced triploid hybrids between the diploid U. ruziziensis and U. decumbens and U. brizantha, which are both tetraploids.

Interploid hybrids obtained by crossing tetraploids and pentaploids had not yet been reported in the ‘brizantha’ complex. These results bring new possibilities to Urochloa breeders, who can advance in exploring germplasm from the ‘brizantha’ complex beyond the tetraploid level. In Brassica, interspecific interploid hybrids have been used as a bridge to transfer traits such as the yellow color of the seed to Brassica napus L. (Wen et al., 2012). Luo et al. (2017) identified strawberry hybrids with cold resistance from a cross between octaploid and dodecaploid genotypes. Padmanaban et al. (2017) reported the formation of pentaploid wheat hybrids (Triticum aestivum L. 6x x T. durum Desf. 4x), resulting in progenies with unique chromosomal constitutions and the potential to improve several important traits.

In addition to the interploid hybrids (7F/153 and 10F/v5), our analysis identified aneuploidy in the 1F/21 hybrid despite its origin involving parents with the same ploidy level. The detection of aneuploidy in this genus has been recurrent and has been reported in previous studies within the ‘brizantha’ complex (Paula et al., 2017; Moraes et al., 2019; Rocha et al., 2019) and ‘humidicola’ complex (Damasceno et al., 2023; Tomaszewska et al., 2023).

In some species, aneuploidy has been used as a strategy for genetic mapping and the formation of addition or substitution lines aimed at introgressing traits of interest (Humphreys et al., 2003; Molnár-Láng et al., 2015). The identification of aneuploids was recently reported in Urochloa. Therefore, cytogenetic and genomic studies are essential to evaluate and monitor the stability of hybrids, in addition to agronomic comparisons of performance and productivity with euploid hybrids. Evaluating parental meiosis to elucidate aspects of aneuploid gamete formation is also interesting. The parent of the 7F/153 hybrid (U. brizantha genotype 2) produces balanced and viable gametes, even with meiotic abnormalities (Moraes et al., unpublished data). In the aneuploid hybrids evaluated by Paula et al. (2017) and Moraes et al. (2019), U. ruziziensis was identified as the likely parent responsible for the observed trisomy and double trisomy.

Determining the sexual mode of reproduction of the three interspecific hybrids is important for breeding programs because they can be self-fertilized or backcrossed with parents. In turn, the apomictic progeny can be evaluated as potential cultivars (Valle & Miles, 2001). It is fundamental to evaluate the meiosis and pollen viability of hybrids to verify the fertility of these genotypes for future crossings. Agronomic traits must be evaluated, and potential improvements determined, which can be increased in the Urochloa germplasm. Finally, new progenies must be evaluated for their modes of reproduction and cytogenetics, as certain chromosomal instabilities are expected over generations in sexual genotypes with aneuploidy and interploidy. Apomictic plants tend to circumvent possible problems resulting from aneuploidy; however, because of their pseudogamy, viable pollen grains are necessary for forming viable seeds (Miles & Valle, 1996).

Like SSR markers, the p779/p780 marker is an important tool for Urochloa breeding, with its efficiency certified in a diverse panel of species and hybrids (Worthington et al., 2016; 2019). Together, these markers enable the evaluation of many genotypes in a shorter period at a reduced cost, which is considered advantageous for breeding programs.

Parental chromosome number and ribosomal DNA sites

Previous studies had already described karyotypic data on species, cultivars, and hybrids with reports on the chromosome number and/or rDNA sites (Bernini & Marin-Morales, 2001; Akiyama et al., 2010; Nielen et al., 2010; Nani et al., 2016; Paula et al., 2017). However, the interploidy findings in this study and the recurrent identification of aneuploid hybrids led to the need to investigate comparative cytogenetic characteristics at the family level (parental and respective hybrids).

The chromosome number (2n = 36 chromosomes) of female parents (1M, 7M, and 10M) corresponds to synthetic tetraploid U. ruziziensis (Ishigaki et al., 2009; Timbó et al., 2014a). Several studies have reported the occurrence of a polyploid series with diploid, tetraploid, pentaploid, and hexaploid cytotypes for U. brizantha (Penteado et al., 2000; Mendes-Bonato et al., 2002; Risso-Pascotto et al., 2003; Tomaszewska et al., 2023).

Chromosome counts (2n = 36) and genome size were reassessed in this study for cv. Marandu ratified the information previously obtained for tetraploids of U. brizantha (Bernini & Marin-Morales, 2001; Akiyama et al., 2010; Nielen et al., 2010; Timbó et al., 2014b; Nani et al., 2016; Nitthaisong et al., 2016). Genotype 2 and cv. Xaraés had a chromosome number compatible with the pentaploid level (Akiyama et al., 2010). Although tetraploidy is predominant in Urochloa, pentaploidy is the second most frequent ploidy (18.5%) identified in U. brizantha in a sample of 222 accessions (Penteado et al., 2000). The nuclear genome sizes estimated for both pentaploid genotypes corroborated a previous description of another pentaploid cytotype of U. brizantha (Moraes et al., 2021).

FISH using both rDNA probes revealed variations in the evaluated species compared to previous descriptions. The U. ruziziensis genotypes evaluated in our study showed two additional 5S rDNA sites compared to the study by Paula et al. (2017), but were compatible with the duplication of the four 5S rDNA sites of diploid plants (Akiyama et al., 2010; Nani et al., 2016). The 10M genotype presented a pair of 35S rDNA sites in addition to the other two parents and another previously evaluated tetraploid (Paula et al., 2017). The six 35S rDNA sites also extrapolated the generally expected duplication results of the two 35S rDNA sites identified in the diploids of this species (Akiyama et al., 2010; Nani et al., 2016).

For the Marandu cultivar, the number of rDNA sites aligned with previous reports (Akiyama et al., 2010; Nielen et al., 2010). Akiyama et al. (2010) reported variation in the number of rDNA sites between different tetraploid cytotypes of U. brizantha. For pentaploids, the number of rDNA sites differed from previous descriptions, which identified five sites for both rDNAs in cv. Xaraés (Akiyama et al., 2010), or five 35S rDNA sites and eight 5S rDNA sites in another pentaploid cytotype (Moraes et al., 2021).

The variation of rDNA sites has been related to transposable elements near or dispersed in the rDNA loci, increasing the possibility of chromosomal rearrangements (Raskina et al., 2008). Furthermore, the repetitive character of rDNA loci and their organization in the genome may provide frequent opportunities for ectopic recombination events, leading to variations in locus size, number, and sites distribution (Goffová & Fajkus, 2021).

The allopolyploidy proposed for the tetraploid and pentaploid cytotypes of U. brizantha (Nielen et al., 2010; Paula et al., 2017; Moraes et al., 2021) may also be related to the frequent reports of variations in rDNA sites. With the apomictic mode of reproduction, characteristic of the polyploid cytotypes of U. brizantha, apomixis can act by fixing the formed karyotypic variations. Macháčková et al. (2022) sequenced the ITS region of the sexual and apomictic taxa of Taraxacum and identified few variants in the sexual taxa, while the apomictic taxa presented a significant number of variants. Additionally, the number of 35S rDNA sites in the hybrids differed from what was expected, considering the number of sites in the parents, demonstrating the dynamic inheritance of these sequences.

The positioning pattern of the 35S and 5S rDNA sites presented by the genotypes corroborates previous reports involving species of the ‘brizantha’ complex (Akiyama et al., 2010; Nielen et al., 2010; Nani et al., 2016; Paula et al., 2017; Moraes et al., 2021). The preferential positioning of 35S rDNA at the terminal region of chromosomes is a trend in angiosperms, while 5S rDNA sites have a more variable distribution, with frequent reports in interstitial regions (Roa & Guerra, 2012, 2015; Garcia et al., 2017). The genotypes evaluated in the present study showed a higher number of 5S rDNA loci than 35S rDNA loci, which differed from the relationship identified by Garcia et al. (2017) for most plants. A similar situation was observed in Taraxacum, where most taxa had one 35S rDNA locus for two 5S rDNA loci per monoploid complement (Macháčková et al., 2022).

Some studies have also indicated a tendency for polyploids to reduce the number of sites per monoploid complement with increasing ploidy levels (Roa & Guerra, 2012; Garcia et al., 2017). Our results indicate that U. brizantha may present this pattern, as pentaploid genotypes exhibited the same number of 35S and 5S rDNA sites, the latter including a reduction compared to the tetraploid cv. Marandu. Considering the number of 35S rDNA sites per monoploid complement, U. brizantha cv. Marandu has 1 × 35S, while pentaploids have 0.8 × 35S; that is, they have less than one 35S rDNA site per monoploid complement. Future studies on cytotypes of U. brizantha with other levels of ploidy, such as diploid and hexaploid genotypes, and even other tetraploid and/or pentaploid genotypes, may clarify aspects related to variations in rDNA sites and karyotypic patterns.

Conclusion

SSR markers efficiently determined the pollen donors of the three crosses and identified U. brizantha cv. Marandu, U. brizantha genotype 2 and U. brizantha cv. Xaraés as the male parents of hybrids 1F/21, 7F/153, and 10F/v5. The three hybrids exhibited a sexual mode of reproduction. Hybrid 1F/21 showed aneuploidy, with 2n = 4x = 36+1 chromosomes, whereas hybrids 7F/153 and 10F/v5 were interploids, resulting from crosses between tetraploids and pentaploids, and had 2n = 40 and 2n = 41 chromosomes, respectively. The number of rDNA sites of the parents and hybrids indicates dynamic behavior and inheritance, while the position of the sites on the chromosomes is conserved within the ‘brizantha’ complex.

Acknowledgements

The authors thank the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), the Fundação de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG), and the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) for the funding provided for the study

References

• Aguilera, P. M., Sartor, M. E., Galdeano, F., Espinoza, F., & Quarin, C. L. (2011). Interspecific tetraploid hybrids between two forage grass species: sexual Paspalum plicatulum and apomictic P. guenoarum Crop Science, 51(4), 1544-1550. https://doi.org/10.2135/cropsci2010.10.0610
  » https://doi.org/https://doi.org/10.2135/cropsci2010.10.0610
• Akiyama, Y., Yamada-Akiyama, H., & Ebina, M. (2010). Morphological diversity of chromosomes bearing ribosomal DNA loci in Brachiaria species. Grassland Science, 56(4), 217-223. https://doi.org/10.1111/j.1744-697X.2010.00197.x
  » https://doi.org/https://doi.org/10.1111/j.1744-697X.2010.00197.x
• Akiyama, Y., Goel, S., Conner, J. A., Hanna, W. W., Yamada-Akiyama, H., & Ozias-Akins, P. (2011). Evolution of the apomixis transmitting chromosome in Pennisetum BMC Evolutionary Biology, 11(289), 1-16. https://doi.org/10.1186/1471-2148-11-289
  » https://doi.org/https://doi.org/10.1186/1471-2148-11-289
• Bernini, C., & Marin-Morales, M. A. (2001). Karyotype analysis in Brachiaria (Poaceae) species. Cytobios, 104(407), 157-171.
• Brugnoli, E. A., Martínez, E. J., Ferrari Usandizaga, S. C., Zilli, A. L., Urbani, M. H., & Acuña, C. A. (2019). Breeding tetraploid paspalum simplex: hybridization, early identification of apomicts, and impact of apomixis on hybrid performance. Crop Science, 59(4), 1617-1624. https://doi.org/10.2135/cropsci2018.12.0771
  » https://doi.org/https://doi.org/10.2135/cropsci2018.12.0771
• Damasceno, A. G., Ferreira, M. T. M., Soares, I. C., Barrios, S. C. L., Valle, C. B., & Techio, V. H. (2023). Physical mapping of ribosomal DNA sites and genome size in polyploid series of Urochloa humidicola (Rendle) Morrone & Zuloaga (Poaceae). Botany Letters, 170(4), 634-643. https://doi.org/10.1080/23818107.2023.2192274
  » https://doi.org/https://doi.org/10.1080/23818107.2023.2192274
• Doležel, J., Binarová, P., & Lucretti, S. (1989). Analysis of nuclear DNA content in plant cells by flow cytometry. Biologia Plantarum, 31(2), 113-120. https://doi.org/10.1007/BF02907241
  » https://doi.org/https://doi.org/10.1007/BF02907241
• Ferreira, D. F. (2011). Sisvar: a computer statistical analysis system. Ciência e Agrotecnologia, 35(6), 1039-1042. https://doi.org/10.1590/S1413-70542011000600001
  » https://doi.org/https://doi.org/10.1590/S1413-70542011000600001
• Ferreira, R. C. U., Cançado, L. J., Valle, C. B., Chiari, L., & Souza, A. P. (2016). Microsatellite loci for Urochloa decumbens (Stapf) RD Webster and cross-amplification in other Urochloa species. BMC Research Notes, 9(152), 1-11. https://doi.org/10.1186/s13104-016-1967-9
  » https://doi.org/https://doi.org/10.1186/s13104-016-1967-9
• Ferreira, R. C. U., Moraes, A. C. L., Chiari, L., Simeão, R. M., Vigna, B. B. Z., & Souza, A. P. (2021). An overview of the genetics and genomics of the Urochloa species most commonly used in pastures. Frontiers in Plant Science, 12(770461), 1-22. https://doi.org/10.3389/fpls.2021.770461
  » https://doi.org/https://doi.org/10.3389/fpls.2021.770461
• Fukui, K., & Nakayama, S. (1996). Plant chromosomes: laboratory methods CRC Press.
• Garcia, S., Kovařík, A., Leitch, A. R., & Garnatje, T. (2017). Cytogenetic features of rRNA genes across land plants: analysis of the Plant rDNA database. The Plant Journal, 89(5), 1020-1030. https://doi.org/10.1111/tpj.13442
  » https://doi.org/https://doi.org/10.1111/tpj.13442
• Goffová, I., & Fajkus, J. (2021). The rDNA Loci - Intersections of Replication, Transcription, and Repair Pathways. International Journal of Molecular Sciences, 22(3), 1-14. https://doi.org/10.3390/ijms22031302
  » https://doi.org/https://doi.org/10.3390/ijms22031302
• Hacker, J. B. (1988). Sexuality and hybridization in signal grass, Brachiaria decumbens Tropical Grasslands, 22, 139-144.
• Humphreys, M. W., Canter, P. J., & Thomas, H. M. (2003). Advances in introgression technologies for precision breeding within the Lolium-Festuca complex. Annals of Applied Biology, 143(1), 1-10. https://doi.org/10.1111/j.1744-7348.2003.tb00263.x
  » https://doi.org/https://doi.org/10.1111/j.1744-7348.2003.tb00263.x
• Ishigaki, G., Gondo, T., Suenaga, K., & Akashi, R. (2009). Induction of tetraploid ruzigrass (Brachiaria ruziziensis) plants by colchicine treatment of in vitro multiple‐shoot clumps and seedlings. Grassland Science, 55(3), 164-170. https://doi.org/10.1111/j.1744-697X.2009.00153.x
  » https://doi.org/https://doi.org/10.1111/j.1744-697X.2009.00153.x
• Jank, L., Barrios, S. C., Valle, C. B., Simeão, R. M., & Alves, G. F. (2014). The value of improved pastures to Brazilian beef production. Crop and Pasture Science, 65(11), 1132-1137. https://doi.org/10.1071/CP13319
  » https://doi.org/https://doi.org/10.1071/CP13319
• Jank, L., Valle, C. B., Simeão, R. M., Almeida, R. G., Santos, M. F., & Barrios, S. C. (2021). Sustainable use of grassland resources for improved livelihoods. In International Grassland Congress Proceedings (pp. 1-16). Agricultural and Livestock Research Organization.
• Jungmann, L., Vigna, B. B. Z., Paiva, J., Sousa, A. C. B., Valle, C. B., Laborda, P. R., Zucchi, M. I., & Souza, A. P. (2009a). Development of microsatellite markers for Brachiaria humidicola (Rendle) Schweick. Conservation Genetics Resources, 1, 475-479. https://doi.org/10.1007/s12686-009-9111-y
  » https://doi.org/https://doi.org/10.1007/s12686-009-9111-y
• Jungmann, L., Sousa, A. C. B., Paiva, J., Francisco, P. M., Vigna, B. B. Z., Valle, C. B., Zucchi, M. I., & Souza, A. P. (2009b). Isolation and characterization of microsatellite markers for Brachiaria brizantha (Hochst. ex A. Rich.) Stap. Conservation Genetics, 10, 1873-1876. https://doi.org/10.1007/s10592-009-9839-7
  » https://doi.org/https://doi.org/10.1007/s10592-009-9839-7
• Kalia, R. K., Rai, M. K., Kalia, S., Singh, R., & Dhawan, A. K. (2011). Microsatellite markers: an overview of the recent progress in plants. Euphytica, 177(3), 309-334. https://doi.org/10.1007/s10681-010-0286-9
  » https://doi.org/https://doi.org/10.1007/s10681-010-0286-9
• Kordrostami, M., & Rahimi, M. (2015). Molecular markers in plants: concepts and applications. Genetics in the Third Millennium, 13, 4024-4031.
• Luo, G., Xue, L., Guo, R., Xu, W., & Lei, J. (2017). Creating cold resistant strawberry via interploidy hybridization between octoploid and dodecaploid. Euphytica, 213(8), 1-10. https://doi.org/10.1007/s10681-017-1980-7
  » https://doi.org/https://doi.org/10.1007/s10681-017-1980-7
• Macháčková, P., Majeský, Ľ., Hroneš, M., Bílková, L., Hřibová, E., & Vašut, R. J. (2022). New insights into ribosomal DNA variation in apomictic and sexual Taraxacum (Asteraceae). Botanical Journal of the Linnean Society, 199(4), 790-815. https://doi.org/10.1093/botlinnean/boab094
  » https://doi.org/https://doi.org/10.1093/botlinnean/boab094
• Mendes-Bonato, A. B., Pagliarini, M. S., Forli, F., Valle, C. B., & Penteado, M. I. O. (2002). Chromosome numbers and microsporogenesis in Brachiaria brizantha (Gramineae). Euphytica, 125, 419-425. https://doi.org/10.1023/A:1016026027724
  » https://doi.org/https://doi.org/10.1023/A:1016026027724
• Mendes-Bonato, A. B., Pagliarini, M. S., & Valle, C. B. (2007). Meiotic arrest compromises pollen fertility in an interspecific hybrid between Brachiaria ruziziensis x Brachiaria decumbens (Poaceae: Paniceae). Brazilian Archives of Biology and Technology, 50(5), 831-837. https://doi.org/10.1590/S1516-89132007000500011
  » https://doi.org/https://doi.org/10.1590/S1516-89132007000500011
• Miles, J. W., & Valle, C. B. (1996). Manipulation of apomixis in Brachiaria breeding. In J. W. Miles, B. L. Maass, & C. B. Valle (Eds.), Brachiaria: biology, agronomy, and improvement (pp. 164-177). CIAT.
• Molnár-Láng, M., Ceoloni, C., & Doležel, J. (2015). Alien introgression in wheat: Cytogenetics, molecular biology, and genomics Springer International Publishing.
• Moraes, I. C., Rume, G. C., Souza Sobrinho, F., & Techio, V. H. (2019). Characterization of aneuploidy in interspecific hybrid between Urochloa ruziziensis (R. Germ. & Evrard) Crins and Urochloa decumbens (Stapf) RD Webster. Molecular Biology Reports, 46(2), 1931-1940. https://doi.org/10.1007/s11033-019-04643-8
  » https://doi.org/https://doi.org/10.1007/s11033-019-04643-8
• Moraes, I. C., Pereira, W. A., Nani, T. F., Paula, C. M. P., Rocha, M. J., Souza Sobrinho, F., & Techio, V. H. (2021). Karyotype analysis and mode of reproduction of two species of Urochloa P. Beauv. Crop Science, 61(5), 3415-3424. https://doi.org/10.1002/csc2.20542
  » https://doi.org/https://doi.org/10.1002/csc2.20542
• Nani, T. F., Pereira, D. L., Souza Sobrinho, F., & Techio, V. H. (2016). Physical map of repetitive DNA sites in Brachiaria spp.: intravarietal and interspecific polymorphisms. Crop Science Society of America, 56(4), 1769-1783. https://doi.org/10.2135/cropsci2015.12.0760
  » https://doi.org/https://doi.org/10.2135/cropsci2015.12.0760
• Nielen, S., Almeida, L. M., Carneiro, V. T., & Araujo, A. C. G. (2010). Physical mapping of rDNA genes corroborates allopolyploid origin in apomictic Brachiaria brizantha Sexual Plant Reproduction, 23(1), 45-51. https://doi.org/10.1007/s00497-009-0124-1
  » https://doi.org/https://doi.org/10.1007/s00497-009-0124-1
• Nitthaisong, P., Ishigaki, G., Tanaka, H., & Akashi, R. (2016). Chromosome number, genomic variation, and molecular markers to assess genetic diversity of Brachiaria species. Crop Science, 56(1), 312-321. https://doi.org/10.2135/cropsci2015.04.0203
  » https://doi.org/https://doi.org/10.2135/cropsci2015.04.0203
• Nitthaisong, P., Ishigaki, G., Suenaga, K., Muguerza, M., Tanaka, H., & Akashi, R. (2019). Pentaploid apomicts by interspecific hybridization between diploid Urochloa ruziziensis and tetraploid apomictic U. decumbens Crop Science, 59(4), 1648-1656. https://doi.org/10.2135/cropsci2019.01.0035
  » https://doi.org/https://doi.org/10.2135/cropsci2019.01.0035
• Novo, P. E., Acuña, C. A., Quarin, C. L., Urbani, M. H., Marcón, F., & Espinoza, F. (2017). Hybridization and heterosis in the Plicatula group of Paspalum Euphytica, 213(198), 1-12. https://doi.org/10.1007/s10681-017-1983-4
  » https://doi.org/https://doi.org/10.1007/s10681-017-1983-4
• Oliveira, A. C., Garcia, A. N., Cristofani, M., & Machado, M. A. (2002). Identification of citrus hybrids through the combination of leaf apex morphology and SSR markers. Euphytica, 128(3), 397-403. https://doi.org/10.1023/A:1021223309212
  » https://doi.org/https://doi.org/10.1023/A:1021223309212
• Ortiz, J. P. A., Pupilli, F., Acuña, C. A., Leblanc, O., & Pessino, S. C. (2020). How to become an apomixis model: the multifaceted case of Paspalum Genes, 11(9), 1-27. https://doi.org/10.3390/genes11090974
  » https://doi.org/https://doi.org/10.3390/genes11090974
• Padmanaban, S., Zhang, P., Hare, R. A., Sutherland, M. W., & Martin, A. (2017). Pentaploid wheat hybrids: applications, characterisation, and challenges. Frontiers in Plant Science, 8(358), 1-11. https://doi.org/10.3389/fpls.2017.00358
  » https://doi.org/https://doi.org/10.3389/fpls.2017.00358
• Paula, C. M. P., Souza Sobrinho, F., & Techio, V. H. (2017). Genomic constitution and relationship in Urochloa (Poaceae) species and hybrids. Crop Science, 57(5), 2605-2616. https://doi.org/10.2135/cropsci2017.05.0307
  » https://doi.org/https://doi.org/10.2135/cropsci2017.05.0307
• Penteado, M. I. O., Santos, A. C. M., Rodrigues, I. F., Valle, C. B., Seixas, M. A. C., & Esteves, A. (2000). Determination of ploidy level and evaluation of total DNA amount in different species of Brachiaria genus Embrapa Gado de Corte.
• Pessoa-Filho, M., Martins, A. M., & Ferreira, M. E. (2017). Molecular dating of phylogenetic divergence between Urochloa species based on complete chloroplast genomes. BMC Genomics, 18(516), 1-14. https://doi.org/10.1186/s12864-017-3904-2
  » https://doi.org/https://doi.org/10.1186/s12864-017-3904-2
• Powell, W., Machray, G. C., & Provan, J. (1996). Polymorphism revealed by simple sequence repeats. Trends in Plant Science, 1(7), 215-222. https://doi.org/10.1016/1360-1385(96)86898-1
  » https://doi.org/https://doi.org/10.1016/1360-1385(96)86898-1
• Plants of the World Online [POWO]. (2023). Facilitated by the royal botanic gardens Kew. Published on the internet. http://www.plantsoftheworldonline.org/
  » http://www.plantsoftheworldonline.org/
• Raskina, O., Barber, J. C., Nevo, E., & Belyayev, A. (2008). Repetitive DNA and chromosomal rearrangements: speciation-related events in plant genomes. Cytogenetic and Genome Research, 120(3-4), 351-357. https://doi.org/10.1159/000121084
  » https://doi.org/https://doi.org/10.1159/000121084
• Risso-Pascotto, C., Pagliarini, M. S., Valle, C. B., & Mendes‐Bonato, A. B. (2003). Chromosome number and microsporogenesis in a pentaploid accession of Brachiaria brizantha (Gramineae). Plant Breeding, 122(2), 136-140. https://doi.org/10.1046/j.1439-0523.2003.00825.x
  » https://doi.org/https://doi.org/10.1046/j.1439-0523.2003.00825.x
• Risso-Pascotto, C., Pagliarini, M. S., & Valle, C. B. (2005). Meiotic behavior in interspecific hybrids between Brachiaria ruziziensis and Brachiaria brizantha (Poaceae). Euphytica, 145, 155-159. https://doi.org/10.1007/s10681-005-0893-z
  » https://doi.org/https://doi.org/10.1007/s10681-005-0893-z
• Roa, F., & Guerra, M. (2012). Distribution of 45S rDNA sites in chromosomes of plants: Structural and evolutionary implications. BMC Evolutionary Biology, 12(225), 1-13. https://doi.org/10.1186/1471-214812225
  » https://doi.org/https://doi.org/10.1186/1471-214812225
• Roa, F., & Guerra, M. (2015). Non-random distribution of 5S rDNA sites and its association with 45S rDNA in plant chromosomes. Cytogenetic and Genome Research, 146(3), 243-249. https://doi.org/10.1159/000440930
  » https://doi.org/https://doi.org/10.1159/000440930
• Rocha, M. J., Chiavegatto, R. B., Damasceno, A. G., Rocha, L. C., Souza Sobrinho, F., & Techio, V. H. (2019). Comparative meiosis and cytogenomic analysis in euploid and aneuploid hybrids of Urochloa P. Beauv. Chromosome Research, 27, 333-344. https://doi.org/10.1007/s10577-019-09616-y
  » https://doi.org/https://doi.org/10.1007/s10577-019-09616-y
• Scott, A. J., & Knott, M. (1974). A cluster analysis method for grouping means in the analysis of variance. Biometrics, 30(3), 507-512. https://doi.org/10.2307/2529204
  » https://doi.org/https://doi.org/10.2307/2529204
• Selvakumar, P., Ravikesavan, R., Gopikrishnan, A., Thiyagu, K., Preetha, S., & Manikanda Boopathi, N. (2010). Genetic purity analysis of cotton (Gossypium spp.) hybrids using SSR markers. Seed Science and Technology, 38(2), 358-366. https://doi.org/10.15258/sst.2010.38.2.09
  » https://doi.org/https://doi.org/10.15258/sst.2010.38.2.09
• Simeão, R. M., Resende, M. D., Alves, R. S., Pessoa-Filho, M., Azevedo, A. L. S., Jones, C. S., Pereira, J. F., & Machado, J. C. (2021). Genomic selection in tropical forage grasses: current status and future applications. Frontiers in Plant Science, 12(665195), 1-22. https://doi.org/10.3389/fpls.2021.665195
  » https://doi.org/https://doi.org/10.3389/fpls.2021.665195
• Sundaram, R. M., Naveenkumar, B., Biradar, S. K., Balachandran, S. M., Mishra, B., IlyasAhmed, M., & Sarma, N. P. (2008). Identification of informative SSR markers capable of distinguishing hybrid rice parental lines and their utilization in seed purity assessment. Euphytica, 163, 215-224. https://doi.org/10.1007/s10681-007-9630-0
  » https://doi.org/https://doi.org/10.1007/s10681-007-9630-0
• Timbó, A. L. O., Souza, P. N. C., Pereira, R. C., Nunes, J. D., Pinto, J. E. B. P., Souza Sobrinho, F., & Davide, L. C. (2014a). Obtaining tetraploid plants of ruzigrass (Brachiaria ruziziensis). Revista Brasileira de Zootecnia, 43(3), 127-131. https://doi.org/10.1590/S1516-35982014000300004
  » https://doi.org/https://doi.org/10.1590/S1516-35982014000300004
• Timbó, A. L. O., Pereira, R. C., Souza Sobrinho, F., & Davide, L. C. (2014b). Nuclear DNA content and chromosome number in Brachiaria spp. genotypes. Revista Ciência Agronômica, 45(1), 62-67. https://doi.org/10.1590/S1806-66902014000100008
  » https://doi.org/https://doi.org/10.1590/S1806-66902014000100008
• Tomaszewska, P., Vorontsova, M. S., Renvoize, S. A., Ficinski, S. Z., Tohme, J., Schwarzacher, T., Castiblanco, V., Veja, J. J., Mitchell, R. A. C., & Heslop-Harrison, J. S. (Pat). (2023). Complex polyploid and hybrid species in an apomictic and sexual tropical forage grass group: genomic composition and evolution in Urochloa (Brachiaria) species. Annals of Botany, 131(1), 87-108. https://doi.org/10.1093/aob/mcab147
  » https://doi.org/https://doi.org/10.1093/aob/mcab147
• Torres González, A. M., & Morton, C. M. (2005). Molecular and morphological phylogenetic analysis of Brachiaria and Urochloa (Poaceae). Molecular Phylogenetics and Evolution, 37(1), 36-44. https://doi.org/10.1016/j.ympev.2005.06.003
  » https://doi.org/https://doi.org/10.1016/j.ympev.2005.06.003
• Triviño, N. J., Perez, J. G., Recio, M. E., Ebina, M., Yamanaka, N., Tsuruta, S., Ishitani, M., & Worthington, M. (2017). Genetic diversity and population structure of Brachiaria species and breeding populations. Crop Science, 57(5), 2633-2644. https://doi.org/10.2135/cropsci2017.01.0045
  » https://doi.org/https://doi.org/10.2135/cropsci2017.01.0045
• Valle, C. B., & Miles, J. W. (2001). Breeding of apomictic species. In Y. Savidan, J. G. Carman & T. Dresselhaus (Eds.), The flowering of apomixis: from mechanisms to genetic engineering (pp. 137-152). CIMMYT, IRD, European Commission.
• Valle, C. B., & Pagliarini, M. S. (2009). Biology, cytogenetics, and breeding of Brachiaria In R. J. Singh (Ed.), Genetic resources, chromosome engineering, and crop improvement series (pp. 103-151). CRC Press.
• Vigna, B. B. Z., Jungmann, L., Francisco, P. M., Zucchi, M. I., Valle, C. B., & Souza, A. P. (2011). Genetic diversity and population structure of the Brachiaria brizantha germplasm. Tropical Plant Biology, 4, 157-169. https://doi.org/10.1007/s12042-011-9078-1
  » https://doi.org/https://doi.org/10.1007/s12042-011-9078-1
• Wen, J., Zhu, L., Qi, L., Ke, H., Yi, B., Shen, J., Tu, J., Ma, C., & Fu, T. (2012). Characterization of interploid hybrids from crosses between Brassica juncea and B. oleracea and the production of yellow-seeded B. napus Theoretical and Applied Genetics, 125, 19-32. https://doi.org/10.1007/s00122-012-1813-y
  » https://doi.org/https://doi.org/10.1007/s00122-012-1813-y
• Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y. P., Perez, J. G., Vega, J., Miles, J., Dellaporta, S., & Tohme, J. (2016). A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens Genetics, 203(3), 1117-1132. https://doi.org/10.1534/genetics.116.190314
  » https://doi.org/https://doi.org/10.1534/genetics.116.190314
• Worthington, M., Ebina, M., Yamanaka, N., Heffelfinger, C., Quintero, C., Zapata, Y. P., Perez, J. G., Selvaraj, M., Ishitani, M., Duitama, J., de la Hoz, J. F., Rao, I., Dellaporta, S., Tohme, J., & Arango, J. (2019). Translocation of a parthenogenesis gene candidate to an alternate carrier chromosome in apomictic Brachiaria humidicola BMC Genomics, 20(41), 1-18. https://doi.org/10.1186/s12864-018-5392-4
  » https://doi.org/https://doi.org/10.1186/s12864-018-5392-4

Publication Dates

• Publication in this collection
  04 Aug 2025
• Date of issue
  2025

History

• Received
  25 Mar 2024
• Accepted
  09 July 2024