Genotyping of Low β-ODAP Grass Pea (Lathyrus sativus L.) Germplasm with EST-SSR Markers

Abstract

Grass pea (Lathyrus sativus L.) is an important protein source in arid regions as both human and animal food. Despite its significance, the use of grass pea is limited by the presence of β-N-oxalyl-L-a,b-diaminopropionic acid (β-ODAP) which can cause neurological disorders. Breeding studies in grass pea have therefore focused on developing high-yielding varieties with low β-ODAP content. However, the narrow range of genetic diversity and the restricted genomic tools in grass pea have slowed progress in such breeding. The present investigation was conducted to explore the genetic diversity of low β-ODAP germplasm consisting of 22 accessions with 31 EST-SSR markers. The molecular analyses revealed a total of 133 alleles ranging from 142 to 330 bp with a mean number of alleles per locus of 4.29. The mean polymorphic information content (PIC) value was calculated as 0.49, and the EST-SSRs in loci S5, S6 and S116 were of the most informative PICs. A dendrogram based on Nei’s genetic distance matrix revealed that breeding lines were grouped in two main clusters. Genetic distances were higher between GP6/GP11, GP4/GP11 and GP5/GP8 accessions which could be further used in crop improvement studies for developing wider genetic diversity.

Keywords:
genetic diversity; microsatellite; molecular selection

INTRODUCTION

The genus Lathyrus belongs to the Leguminosae family, and consists of about 160 annual and perennial species [¹]. Grass pea (Lathyrus sativus L.) is a member of the genus Lathyrus, and has high protein and carbohydrate content of up to 31% and 65% of the seeds, respectively [²,³]. This legume crop has many agricultural advantages such as tolerance to drought and water-logging, nitrogen fixation and high grain-yielding capacity. Grass pea plays a vital role as human food in rural areas because its seeds are used as a major protein source by the poor and as survival food during drought and famine [⁴].

Despite its desirable traits, the use of grass pea is limited by the presence of a neurotoxic, β-N-oxalyl-L-a,b-diaminopropionic acid (β-ODAP), which can cause the neurological disorder, lathyrism, through excessive consumption of seeds [⁵,⁶,⁷,⁸]. β-ODAP accumulates in all tissues of grass pea during all stages of development, although the highest concentrations have been reported in young seedlings [⁹,¹⁰] and seed embryos [⁵]. Therefore, the main objectives of worldwide grass pea breeding programs tend toward develop high-yielding varieties with <0.2% β-ODAP content [¹¹,¹²]. Some promising lines with low β-ODAP and high yield have been evaluated in different countries [⁴,¹³]. However, the polygenic nature of β-ODAP content [¹⁴,¹⁵], the narrow range of current genetic variation of grass pea [¹³] and environmental effects [¹⁶] make breeding studies difficult. So far, no toxin-free varieties have been developed [⁴].

Wider genetic diversity is significant for assessment of plant genetic resources, and for identifying the differences of genotypes [¹⁷]. The measurement of genetic diversity using morphological traits is direct, inexpensive and easy. However, these traits are highly affected by the environment or by cultural practices [¹⁸,¹⁹]. Molecular markers provide huge information and they are highly effective and non-sensitive to environmental fluctuations changes compared to agronomic traits [²⁰]. However, most genetic diversity studies have been conducted using morphological traits in grass pea and little information is available at the molecular level, as with many other orphan legume crops [²¹]. Molecular markers such as RAPD [²²], RFLP [²³] and AFLP [²⁴] have been used to determine genetic relationships and diversity in grass pea. Among the molecular markers, SSRs and EST-SSRs have specifically been selected by breeders because of their polymorphic character and co-dominant inheritance, as well as the large number of alleles per locus and abundant in distribution throughout the genome [²⁵,²⁶]. They are also useful for genetic diversity studies [²⁷] in spite of the fact that there are limited studies on genetic diversity specifically in grass pea using SSR and EST-SSR markers [²¹,²⁵,²⁸,²⁹,³⁰].

The demand for resilient food crops are increasing therefore improvement of grass pea is still considered a priority by international breeding studies [³¹]. Information about the genetic variation of low β-ODAP population is a great breeding value to exploit the genetic resource and identify promising lines. From this perspective, the current study evaluated the genetic diversity of a low β-ODAP population consisting of 22 grass pea lines using EST-SSR markers. The data generated in our study will be useful in the utilization of this specific grass pea population, and in selecting diverse parental lines for the future improvement of low β-ODAP and high-yield grass pea genotypes.

MATERIAL AND METHODS

Plant Material

The genetic material used in the study was comprised of 22 grass pea accessions originating from Bangladesh (Table 1). The seeds were collected from each accession for β-ODAP content calculation and it was determined by spectrophotometrically [³²]. This low β-ODAP content germplasm is maintained by the ICARDA genebank. Detailed information about quality and quantity traits for this germplasm has been reached in ICARDA international nurseries data management system (http://indms.icarda.org). The seeds of the grass pea accessions were germinated in the experimental fields of Akdeniz University, Antalya, Turkey (36°53´N, 38°30´E and altitude 33 m) during the 2018 growing season. Grass pea leaves were collected from plants and stored at -80 °C for DNA extraction.

Table 1
The list of low β-ODAP grass pea germplasm used in present study

Genotypes	Accession number	ICARDA Genbank Number	β-ODAP concentration (% weight)
GP2	Bang-190	117250	0.386
GP3	Bang-234	117378	0.408
GP4	Bang-186	117241	0.566
GP5	Bang-237	117388	0.316
GP6	Bang-187	117243	0.244
GP7	Bang-202	117283	0.415
GP8	Bang-235	117381	0.267
GP10	Bang-182	117209	0.428
GP11	Bang-255	117424	0.319
GP12	Bang-290	117524	0.368
GP13	Bang-309	117586	0.564
GP14	Bang-261	117440	0.566
GP15	Bang-313	117601	0.352
GP16	Bang-241	117400	0.497
GP17	Bang-265	117454	0.321
GP18	Bang-310	117594	0.573
GP19	Bang-185	117229	0.587
GP20	Bang-188	117248	0.583
GP21	Bang-191	117251	0.504
GP22	Bang-233	117375	0.388
GP23	Bang-242	117401	0.565
GP24	Bang-249	117408	0.448

Molecular Study

The leaves from three plants of each accession were mixed for genomic DNA extraction. The CTAB procedure [³³] was used for DNA isolation with minor modifications. Integrity and quality of DNA were evaluated by electrophoresis on 1% w/v agarose gels by comparison with a DNA standard.

The set of 31 EST-SSR primers [²⁸] used in this study from Lathyrus genus ESTs and was sourced from the NCBI database. The sequences of primers, repeat motifs and putative functions of each locus are given in Table 2.

Table 2
The information of 31 EST-SSR markers used in this study.

Locus	Primer sequences (5’-3’)	Repeat motif	GenBank acc. no	Putative function1
S5	F: TGTGGGGCTTGTTACACTGA	(GT)8	DY396423	gonadotropin beta chain
	R: AGCTACCATAACAGACAAAACC
S6	F: CTGCAACAAGAAGCCATTCA	(CT)9	GO317614	conserved hypothetical protein
	R: TATGGGTCCGTCGGAATAAC
S7	F: CAATAGGGGCCCCACTAAAT	(AAC)5	GO317636	unknown
	R: CGACGGTTAGGAAACAGAGC
S19	F: CGATGCCAAATATGGAGGTT	(TGG) 5	GO316451	dormancy-associated protein
	R: GAAGCACCACCATGTCCAC
S33	F: TGGTTTTGTTGTGGAAAGTGAG	(TTTTG)3	GO315340	conserved hypothetical protein
	R: ACTGCAAAAGCCTCAAAGGA
S43	F: GCTCTCAGCCTCACCGTAAC	(AGTTCT)3	GO317439	predicted protein
	R: CTCAATTAGCGTCCGGGTAA
S52	F: CGCCCCTCATCTTATCATTC	(CTCGCT)3	GO316642	inositol phosphate kinase
	R: GTTGTTGGGTGAAGGAATCG
S63	F: ACAGCGAAACCCTCATTCAG	(TCT)6	GO317080	Conserved hypothetical protein
	R: AGAGTGCCGTTAGGGGATTT
S70	F: GTGCAACCTTTCATCAATCA	(GGTTT)3	GO315117	bZIP transcription factor bZIP11
	R:CGGTGAAGCTAAAGAAGAAGAA
S83	F: TCTTCCAACCCAAACCCTAA	(CTC)5	GO314361	predicted protein
	R: GACGACGGTTTGAACCTGAT
S97	F: GGTTTCTTCTCACGGGTGTT	(GAA)5	GO316810	predicted protein
	R: GAAATACTTGAACCACCACTTCC
S98	F: GTCCCCACGTTAACTGAAGC	(GATCA)4	GO316847	conserved oligomeric Golgi complex
	R: GACGTAGGGTTGTTGCGATT
S102	F: GTTGGGAATCCGTCTTCAAA	(CGACGG)3	GO319283	leucine-richrepeat
	R: GTCGAGAGAGGTGAGGTTGG
S103	F: CCTCCGACATGTCCATCATT	(CAA)5	GO318479	cysteineprotease, putative
	R: TCAGCATTGTGTTGGTCGAT
S114	F: CTAGCATCCCGCCATTTATC	(CCT)5	GO318925	GTP-binding signal Rec. particle SRP54
	R: AACATTTCAGCCCTGACCAC
S116	F: TCGAGAGACTTCTCTTCTCTCCTC	(CTT)6	GO318959	unknown
	R: CGACATCTGACCATCCATTG
S117	F: CATTATCTTCCCCAGCTCCA	(CCTCCA)3	GO318966	glutathione peroxidase, putative
	R: AAGGGATGAGCCACAGAATG
S118	F: TTCCCTCCCTTTCCTTCACT	(TTGTC)3	GO319719	class II KNOX homeobox transcription factor
	R: TGTTTGGTTTGGTTTGGTGA
S119	F: CCCTCCCCTTCTTCATCTTC	(ACCAA)3	GO319719	class II KNOX homeobox transcription factor
	R: TTGTGAAAGATGCTGGTTGTG
S135	F: CACATAGCAAAAACGCTAGGC	(ACA)5	GO320656	PREDICTED: hypothetical protein
	R: CTCCGACGAGAGATGATTCG
S137	F: GAGATCATCTTTGTCGGTGGA	(ATTTCC)3	GO319063	Glycoside transferase, six-hairpin, subgroup
	R: TTCAGTAGGACCCAGCAACC
S142	F: TTGAATCCAACGGAAGATCC	(GATTCT)3	GO318214	conserved hypothetical protein
	R: CAGTTCCCGGTCAGAACAAT
S147	F: CCAGGGAGGACTATCACGAA	(CTT)8	GO319933	PREDICTED: hypothetical protein
	R: AAACAGAAACGCGATGAACC
S155	F: CGACGATCTACAACCACCAA	(CAC)6	GO317900	Serine/threonine protein kinase, active site
	R: TGGAAGGAGGGAAGAGAGGT
Locus	Primer sequences (5’-3’)	Repeat motif	GenBank acc. no	Putative function1
S156	F: GCCGAACCAGAAAACACAAT	(AAG)5	GO320751	PREDICTED: hypothetical protein
	R: TCGGTGCTCATAATTCCAGA
S159	F: CGATCTCCCACTTTAGAAAACA	(AAAC)4	GO321140	putative plasma membrane intrinsic protein
	R: GGTGGCTATAACCAATGATGG
S163	F: ACACAGAAACACCACCACCA	(CAT)5	GO318661	AT2G42690
	R: GATTTTCCGTAACGGCTTGA
S165	F:CGCTCTAGAGATAGGAGAGAGAGG	(GA)8	GO318696	Nucleic acid binding protein, putative
	R: GCTTCACAAGAACCCATTTCA
S167	F: TGACTTCTTGCTCTCCCATGT	(TCC)5	GO319158	PREDICTED: hypothetical protein
	R: GAGAGTGTAGGCGGAACCTG
S168	F: CCAAAACGACACCCCCTTAT	(ATCAAA)3	GO319159	unknown
	R: TGTGACATACAAACGGAAGC
S177	F: GGGAGTGAATCAAAACCAACA	(AAAG)4	GO320015	gamma-glutamylcysteine synthetase precursor
	R: GAAGTTCTCCGTAGCGGTGT

• ¹
  Ref. [²⁸]

Polymerase chain reactions (PCR) were performed in 10 μL reaction volumes consisting of 1µL of 10X PCR buffer, 0.3 mM of dNTPs mix, 2.5 mM of MgCl₂, 0.3 µM of each primer, 1 unit of Taq DNA polymerase (DreamTaq DNA Polymerase, Thermo Fischer Scientific Biosciences, Germany), 1 µL genomic DNA template and Milli-Q water to a final volume of 10 µL.

The PCR cycling conditions were as follows: initial denaturation at 95 °C for 5 min; 35 cycles of 95 °C for 30 s, annealing at the optimized temperature for each primer pair for 45 s and 72 °C for 45 s; the last cycle ending with a five-minute at 72 °C. PCR amplified products were electrophoretically separated on 2% agarose gel and then visualized under UV light to validate band amplification. The expected bands were also monitored in the Fragment Analyzer^TM (Advanced Analytical Technologies GmbH, Heidelberg, Germany) for accurate sizing and relative quantification of fragments. The DNF-905-K1000 reagent kit was used for qualitative analysis. The gel, inlet buffer, capillary conditioning solution and marker were prepared according to manufacturers’ instructions. The data were normalized to 1 bp (lowest) and 500 bp (highest) and calibrated to the 1-500 bp range DNA ladder. The virtual gel image was analyzed and scored using the software PROSize 2.0 (Advanced Analytical Technologies, AMES, IA, USA).

Data Analysis

The EST-SSRs generated unambiguous bands of different molecular weights that were handled for data analysis. The POPGENE package (version 3.2) [³⁴] was used to calculate the number of alleles, effective number of alleles, expected, observed heterozygosity and Wright's fixation index (F) for each locus. Shannon's information index value was also calculated according to Shannon and Weaver [³⁵]. The genetic distance among genotypes were calculated based on Nei's parameters [³⁶]. To determine the genetic relationships among the breeding lines studied, a phylogenetic dendrogram was constructed from the molecular phylogenic tree using the unweighted pair group method with arithmetic mean. MEGA software [³⁷] was used to modify the constructed phylogenetic tree. The polymorphic information content (PIC) value of each EST-SSR was identified using the Excel MS Toolkit (version 3.1) [³⁸]. A principal coordinate analysis (PCoA) was performed with the PAST (version 3.23).

RESULTS

A total of 22 grass pea accessions were fingerprinted using 31 EST-SSR markers. PCR products were obtained for all the studied loci (Figure 1) and a considerable level of variability was observed among the breeding lines. Table 3 presents the genetic parameters of size range, number of alleles (no), effective number of alleles (ne), observed (Ho) and expected (He) heterozygosity, polymorphic information content (PIC) and Shannon’s index value. All the studied EST-SSR loci were polymorphic, yielding 133 amplification fragments ranging from 142 to 330 bp. The mean number of alleles per locus was 4.29. The highest number of alleles (10) was detected in locus S6, which was followed by 8 alleles in both locus S5 and locus S116. The lowest (2) was observed in loci S117, S142, S163, S167, S168 and S177. The effective number of alleles varied from 1.09 for locus S177 to 8.00 for locus S6, with an average of 2.76.

Figure 1
Fragment Analyzer^TM shows the gel picture and peak analysis of EST-SRR profiles for selected grass pea breeding lines. Amplifications performed with the markers in loci S156, S163 and S119 with a 1-500 bp ladder.

Table 3
The genetic parameters for 31 EST-SSR loci studied in 22 grass pea accessions

EST-SSR locus	Size range	Na1	Ne	Ho	He	PIC	I	F
S5	169-205	8	5.63	0.40	0.84	0.80	1.85	0.51
S6	191-211	10	8.00	0.00	0.90	0.86	2.18	1.00
S7	213-231	7	4.84	0.90	0.81	0.77	1.74	-0.1
S19	225-243	5	2.09	0.47	0.54	0.49	1.03	0.09
S33	223-243	5	3.22	0.29	0.71	0.65	1.35	0.57
S43	155-173	4	2.07	0.47	0.54	0.48	0.99	0.09
S52	228-246	4	3.11	0.25	0.70	0.63	1.25	0.63
S63	234-240	3	1.58	0.00	0.38	0.34	0.68	1.00
S70	243-263	3	1.21	0.00	0.18	0.17	0.38	1.00
S83	299-308	4	3.25	0.89	0.71	0.64	1.26	-0.2
S97	183-198	7	3.67	0.76	0.75	0.69	1.50	-0.1
S98	162-172	3	1.70	0.14	0.42	0.37	0.72	0.65
S102	198-210	3	2.17	0.00	0.55	0.48	0.91	1.00
S103	201-222	6	3.28	1.00	0.71	0.65	1.37	-0.4
S114	270-288	7	3.88	1.00	0.76	0.70	1.54	-0.3
S116	309-330	8	5.56	1.00	0.85	0.80	1.84	-0.2
S117	288-294	2	1.15	0.14	0.14	0.12	0.25	-0.1
S118	155-170	4	2.76	1.00	0.66	0.57	1.13	-0.5
S119	233-258	5	3.83	0.28	0.76	0.70	1.44	0.62
S135	188-194	3	2.11	0.00	0.54	0.43	0.83	1.00
S137	227-245	4	2.29	0.36	0.58	0.52	1.05	0.35
S142	142-148	2	1.84	0.05	0.47	0.35	0.65	0.89
S147	147-159	4	1.69	0.17	0.42	0.38	0.80	0.59
S155	208-220	4	1.61	0.18	0.39	0.36	0.75	0.52
S156	250-256	3	2.57	0.95	0.63	0.53	1.00	-0.5
S159	251-263	4	3.25	0.36	0.71	0.64	1.27	0.47
S163	235-244	2	1.89	0.29	0.48	0.36	0.66	0.39
S165	221-235	3	1.20	0.00	0.17	0.16	0.36	1.00
S167	227-236	2	1.56	0.00	0.37	0.30	0.54	1.00
S168	256-258	2	1.47	0.00	0.33	0.27	0.50	1.00
S177	233-237	2	1.09	0.00	0.09	0.08	0.18	1.00
Mean		4.29	2.76	0.37	0.55	0.49	1.03	0.41

• ¹
  Na number of alleles, Ne effective number of alleles, He expected heterozygosity, Ho observed heterozygosity, PIC polymorphism information content, I Shannon's Information index, F Wright's fixation index.

The mean PIC value was calculated as 0.49, and the EST-SSRs in loci S5 (0.80), S6 (0.86) and S116 (0.80) were determined to be the most informative with regard to PIC values. In addition, 13 markers were observed as more informative by showing PIC values above 0.5. The EST-SSR in locus S177 had the lowest PIC value of 0.08. The highest and lowest expected heterozygosity were obtained in loci S6 and S177 with values of 0.86 and 0.09, respectively, with an average of 0.55. The highest observed heterozygosity value was obtained in loci S103, S114, S116 and S118, and the lowest was seen in loci S6, S63, S70, S102, S135, S165, S167, S168 and S177, with a mean value of 0.37. The highest Shannon's index (I) value was determined in locus S6 (2.18), while locus S177 had the lowest value (0.18), with a mean of 1.03 across the EST-SSR loci (Table 3). The fixation index (F) ranged from −0.5 for S118 and S156 to 1.00 for S6, S63, S70, S102, S135, S165, S167, S168, S177 with an average of 0.41. The genetic distances between accessions were minimal and maximal for GP4/GP18 and GP6/GP11, respectively (Table 4). Accessions with a genetic distance higher than 0.9 were GP4/GP11, GP5/GP8, GP8/GP11, GP10/GP11, GP11/GP12, GP11/GP18 and GP21/GP24.

The dendrogram based on Nei’s genetic distance matrix revealed that the 22 accessions were grouped in two main clusters (I and II) including 20 and 2 breeding lines, respectively (Figure 2). Cluster I was further divided into four sub-clusters; IA consisting of 6 breeding lines, IB of 8 and IC of 5 lines. Sub-cluster ID included one breeding line, GP13, which was not grouped. Cluster II consisted of the accessions GP11 and GP14. Principal coordinate analysis (PCoA) indicated the existence of four subgroups among 22 accessions of our study (Figure 3). The first second coordinated explained 11.0% and 9.45% of variation, respectively. The grass pea panel was also divided into three subgroups.

Figure 2
UPGMA dendrogram showing genetic relationships among 22 accessions of grass pea accessions using 31 EST-SSR markers

Figure 3
Principal coordinate analysis (PCoA) of 22 sesame accessions based on 31 EST-SSR markers.

DISCUSSION

Wider genetic diversity is highly important for sustainable plant breeding programs because it allows identification and improvement of desirable traits, especially relating to yield, human diet and resistance to biotic and abiotic stresses. Grass pea is a neglected crop, and enhanced genetic diversity would contribute to the utilization of this crop for breeding studies [³⁰]. Limited genetic and genomic resources are available in the public domain for Lathyrus, and the application of established molecular markers in the estimation of genetic variation is a promising way of demonstrating the genetic potential of this legume crop [²⁹].

The present investigation showed that EST-SSRs are useful tools for the diagnosis of genetic diversity in grass pea. The average number of alleles obtained in our germplasm (4.29) was higher than studies reported by Shiferaw and coauthors [²¹] and Gupta and coauthors [²⁵] who detected 4.0 and 3.72 alleles per locus using 11 and 18 EST-SSRs, respectively. Similarly, lower value was observed in grass pea panel which was screened with 288 microsatellites [³⁹]. An average number of alleles per locus of 8.6 has been reported in a highly diverse grass pea collection consisting of 283 genotypes and screened with 30 SSR loci [³⁰]. This larger number of alleles per locus might result from differences in the number of genotypes with diverse geographical origins [²¹,⁴⁰].

A low average PIC value of EST-SSR markers was observed in the present study (0.49), and similar low percentages have been reported in grass pea [²⁹,⁴¹] and other related grain legumes such as pea [⁴²] and faba bean [⁴³]. This might be caused by the genetic structure of EST-SSR primers which tend to be less polymorphic in crops because of greater DNA sequence conservation in transcribed regions [²⁶,⁴⁴,⁴⁵]. The average observed heterozygosity value was 0.37 in our collection, and this was higher than Italian grass pea germplasm [⁴⁶] and comparable to reported values of 0.39 and 0.40 in Ethiopian grass pea germplasms studied by Ponnaiah and coauthors [⁴⁷] and Shiferaw and coauthors [²¹], respectively.

Table 4
Genetic distance matrix for 22 accessions based on EST-SSRs

GP3	GP4	GP5	GP6	GP7	GP8	GP10	GP11	GP12	GP13	GP14	GP15	GP16	GP17	GP18	GP19	GP20	GP21	GP22	GP23	GP24
0.60	0.40	0.50	0.50	0.50	0.80	0.41	0.64	0.53	0.71	0.54	0.44	0.43	0.67	0.53	0.62	0.30	0.30	0.56	0.50	0.67	GP2
	0.70	0.60	0.50	0.50	0.70	0.56	0.68	0.53	0.82	0.51	0.33	0.59	0.55	0.69	0.48	0.72	0.89	0.39	0.47	0.48	GP3
		0.60	0.60	0.50	0.80	0.51	1.03	0.34	0.55	0.70	0.52	0.51	0.89	0.23	0.69	0.25	0.56	0.85	0.64	0.58	GP4
			0.90	0.60	1.00	0.66	0.50	0.64	0.64	0.65	0.40	0.33	0.50	0.75	0.71	0.52	0.53	0.60	0.54	0.73	GP5
				0.50	0.60	0.38	1.23	0.69	0.78	0.79	0.64	0.72	0.64	0.63	0.64	0.71	0.90	0.60	0.70	0.53	GP6
					0.40	0.40	0.66	0.41	0.70	0.55	0.47	0.50	0.68	0.50	0.45	0.59	0.63	0.57	0.37	0.56	GP7
						0.71	0.95	0.73	0.86	0.82	0.66	0.87	0.64	0.78	0.82	0.73	0.88	0.60	0.58	0.52	GP8
							0.93	0.64	0.74	0.56	0.49	0.58	0.50	0.40	0.39	0.51	0.57	0.79	0.51	0.48	GP10
								1.03	0.69	0.46	0.63	0.73	0.72	1.03	0.60	0.74	0.74	0.61	0.55	0.81	GP11
									0.86	0.70	0.53	0.69	0.65	0.52	0.72	0.46	0.77	0.54	0.66	0.6	GP12
										0.72	0.67	0.62	0.56	0.56	0.74	0.76	0.62	0.77	0.78	0.65	GP13
											0.54	0.67	0.80	0.72	0.68	0.68	0.56	0.45	0.72	0.75	GP14
												0.32	0.61	0.60	0.56	0.38	0.67	0.38	0.34	0.50	GP15
													0.68	0.66	0.68	0.39	0.60	0.52	0.61	0.60	GP16
														0.81	0.64	0.84	0.74	0.61	0.68	0.42	GP17
															0.57	0.45	0.66	0.77	0.50	0.55	GP18
																0.71	0.57	0.73	0.68	0.64	GP19
																	0.54	0.61	0.57	0.74	GP20
																		0.78	0.82	0.95	GP21
																			0.44	0.58	GP22
																				0.55	GP23

The expected heterozygosity was greater than the observed heterozygosity which is similar to other results in grass pea [²⁹], pear [⁴⁸], apple [⁴⁹] and pea [⁵⁰]. The highest number of alleles and expected heterozygosity were observed with the EST-SSR marker in locus S6, which was characterized as the most informative fragment because high values for these parameters exhibit the power of an SSR marker for differentiating accessions [⁵¹]. Shannon's information index is an important parameter for illustrating the level of polymorphism in a collection [⁵²]. As expected, because of its higher PIC value and heterozygosity, the highest value for Shannon's information index was obtained with the EST-SSR marker in locus S6. Di nucleotide repeat motifs were observed in the EST-SSR markers in loci S5 and S6, which had the highest number of alleles and PIC values as compared to higher order repeat numbers. These results confirm those from Kumar and coauthors [⁵³] and Shiferaw and coauthors [²¹] in maize and grass pea, respectively.

The genetic distance values were the lowest and the highest between accessions GP4/GP18 and GP6/GP11, respectively and this relationship was monitored in the phylogenetic tree. The dendrogram also showed that accessions GP11, GP13 and GP14 separated from the other breeding lines, indicating high genetic diversity in the studied germplasm. The results obitaned by PCoA analysis conducted with PAST [⁵⁴] was also supported that these accessions separated from other groups. Therefore, GP11, GP13 and GP14 should be used as parents in crosses creating wider genetic diversity to obtain possible superior recombinations which have low β-ODAP content. This information is extremely important because limited studies have been conducted to identify genetically distant accessions with low β-ODAP content to improve the agronomic performance of this crop [²⁵]. Crosses between grass pea accessions with low and high β-ODAP content might cause an increase of β-ODAP in F1 and further generations. The genetically distant accessions identified in this study therefore provide the advantage of maintaining low neurotoxin content in hybridizations. In addition, the polymorphic markers used in this study should be used in other grass pea germplasm projects, and might also be transferred to cross species that lack of sequence information.

CONCLUSION

The study showed that SSR based markers have powerful tools to characterize genetic detecting variation and could be used genetic analysis of legume crops [²¹,²⁷,⁵⁵,⁵⁶]. Although grass pea cultivation is very suitable for sustainable farming in Mediterranean climate conditions, a limited study has been conducted to identify superior low β-ODAP genotypes [⁵,¹⁶]. This investigation presented genetically distant genotypes and they should be used as parents in breeding studies in that climate conditions. However grass pea is an industrial crop and information on agronomic traits of all genotypes must be handled for optimal commercial usage.

REFERENCES

• ¹
  Allkin R, Macfarlance TD, White RJ, Bisby FA, Adey ME. Names and synonyms of species and subspecies in the Vicieae. Issue 2, Southampton: Vicieae Database Project Publication No. 2; 1983.
• ²
  Tamburino R, Guida, V, Pacico, S, Rocco, M, Zarelli, A, Parente, A, Maro, AD. Nutritional values and radicals scavenging capacities of grass pea (Lathyrus sativus L.) seeds in Valle Agricola district, Italy. Aust J Crop Sci. 2012;6:149-56.
• ³
  Mondal, MMA, Puteh AB. Spectrum of variability in seed size and content of protein and odap in grass pea (Lathyrus sativus L.) germplasm. Legume Res. 2014;37:479-82.
• ⁴
  Fikre A, Korbu, L, Kuo YH, Lambein F. The contents of the neuro-excitatory amino acid β-ODAP (b-N-oxalyl-L-a,b-diaminopropionic acid), and other free and protein amino acids in the seeds of different genotypes of grass pea (Lathyrus sativus L.). Food Chem. 2008;110:422-27.
• ⁵
  Siddique KHM, Loss SP, Herwig SP, Wilson JM. Growth, yield and neurotoxin (ODAP) concentration of three Lathyrus species in Mediterranean type environments of Western Australia. Aust J Exp Agr. 1996;36:209-18.
• ⁶
  Yan ZY, Spencer PS, Li, ZX, Liang YM, Wang YF, Wang CY, Li FM. Lathyrus sativus (grass pea) and its neurotoxin ODAP. Phtytochemistry. 2006;67:107-21.
• ⁷
  Grela ER, Rybinski W, Klebaniuk R, Matras J. Morphological characteristics of some accessions of grass pea (Lathyrus sativus L.) grown in Europe and nutritional traits of their seeds. Genet Resour Crop Evol. 2010;57:693-701.
• ⁸
  Hillocks RJ, Maruthi MN. Grass pea (Lathyrus sativus): Is there a case for further crop improvement? Euphytica. 2012;186:647-54.
• ⁹
  Lambein F, Khan JK, Kuo YH, Campbell CG, Briggs CJ. Toxin in the seedlings of some varieties of grass pea (Lathyrus sativus). Nat Toxins. 1993;1: 246-9.
• ¹⁰
  Jiao CJ, Xu QL, Wang CY, Li FM, Li, ZX, Wang YF. Accumulation pattern of toxin β-ODAP during lifespan and effect of nutrient elements on ß-ODAP content in Lathyrus sativus seedlings. J Agric Sci. 2006;144:369-75.
• ¹¹
  Campbell CG, Mehra RB, Agrawal SK, Chen YZ, Abd-El-Moneim AM, Khawaja HIT, Yadav, C.R, Tay, J.U, Araya, W.A. Current status and future strategy in breeding grass pea (Lathyrus sativus). Euphytica. 1994;73:167-75.
• ¹²
  Girma D, Korbu L. Genetic improvement of grass pea (Lathyrus sativus) in Ethiopia: an unfulfilled promise. Plant Breed. 2012;131:231-6.
• ¹³
  Kumar S, Bejiga G, Ahmed S, Nakkoul H, Sarker A. Genetic improvement of grass pea for low neurotoxin (ß-ODAP) content. Food Chem Toxicol. 2011;49:589-600.
• ¹⁴
  Tiwari KR, Campbell CG. Inheritance of neurotoxin (ODAP) content, flower and seed coat colour in grass pea (Lathyrus sativus L.) Euphytica. 1996;91:195-203.
• ¹⁵
  Campbell CG. Grass pea (Lathyrus sativus L.) promoting the conservation and use of underutilized and neglected crops, Vol. 18. Rome, Italy: International Plant Genetic Resources Institute; 1997.
• ¹⁶
  Hanbury CD, Siddique KHM, Galwey NW, Cocks PS. Genotype-environment interaction for seed yield and ODAP concentration of Lathyrus sativus L. and L. cicera L. in Mediterranean-type environments. Euphytica. 1999;110:445-60.
• ¹⁷
  Hurtado M, Vilanova S, Plazas M, Gramazio P, Fonseka HH, Fonseka R, Prohens J. Diversity and relationships of eggplants from three geographically distant secondary centers of diversity. PLoS One. 2012;7:41748.
• ¹⁸
  Geleta N, Labuschagne MT, Viljoen CD. Genetic diversity analysis in sorghum germplasm as estimated by AFLP, SSR and morpho-agronomical markers. Biodivers Conserv. 2006;15:3251-65.
• ¹⁹
  Zhang Z, Gao J, Kong D, Wang A, Tang S, Li Y, Pang X. Assessing genetic diversity in Ziziphus jujuba 'Jinsixiaozao' using morphological and microsatellite (SSR) markers. Biochem Syst Ecol. 2015;61:196-202.
• ²⁰
  Uzun A, Yesiloglu T, Polat I, Aka-Kacar Y, Gulsen O, Yildirim B, Tuzcu O, Tepe S, Canan I, Anil S. Evaluation of genetic diversity in lemons and some of their relatives based on SRAP and SSR markers. Plant Mol Biol Report. 2011;29:693-701.
• ²¹
  Shiferaw E, Pe ME, Porceddu E, Ponnaiah M. Exploring the genetic diversity of Ethiopian grass pea (Lathyrus sativus L.) using EST-SSR markers. Molecular Breed. 2012;30:789-97.
• ²²
  Croft AM, Pang ECK, Taylor PWJ. Molecular analysis of Lathyrus sativus L. (grass pea) and related Lathyrus species. Euphytica. 1999;107:167-76.
• ²³
  Ghorbel CN, Lauga B, Combes D, Marrakchi M. Comparative genetic diversity studies in the genus Lathyrus using RFLP and RAPD markers. Lathyrus Lathyrism Newsl. 2001;2:187-209.
• ²⁴
  Tavoletti S, Iommarini L. Molecular marker analysis of genetic variation characterizing a grass pea (Lathyrus sativus L.) collection from central Italy. Plant Breed. 2007;126:607-11.
• ²⁵
  Gupta P, Udupa, SM, Gupta, DS, Kumar, J, Kumar, S. Population structure analysis and determination of neurotoxin content in a set of grass pea (Lathyrus sativus L.) accessions of Bangladesh origin. Crop J. 2018;6:435-42.
• ²⁶
  Varshney RK, Graner A, Sorrells ME. Genic microsatellite markers in plants: features and applications. Trends Biotechnol. 2005;23:48-55.
• ²⁷
  Gupta PK, Rustgi S, Sharma S, Singh R, Kumar N, Balyan HS. Transferable EST-SSR markers for the study of polymorphism and genetic diversity in bread wheat. Mol Gen Genomics. 2003;270:315-23.
• ²⁸
  Sun XL, Yang T, Guan JP, Ma Y, Jiang JY, Cao R, Burlyaeva M, Vishnyakova M, Semenova E, Bulyntsev S, Zong X. Development of 161 novel EST-SSR markers from Lathyrus sativus (Fabaceae). Am J Bot. 2012;99:379-90.
• ²⁹
  Soren KR, Yadav A, Pandey G, Gangwar P, Parihar AK, Bohra A, Dixit GP, Datta S, Singh NP. EST-SSR analysis provides insights about genetic relatedness, population structure and gene flow in grass pea (Lathyrus sativus). Plant Breed. 2015;134:338-44.
• ³⁰
  Wang F, Yang T, Burlyaeva M, Li L, Jiang J, Fang L, Redden R, Zong X. Genetic diversity of grass pea and its relative species revealed by SSR Markers. PLoS One. 2015;10(3): e0118542.
• ³¹
  Vaz Patto MC, Rubiales D. Lathyrus diversity: available resources with relevance to crop improvement - L. sativus and L. cicera as case studies. Ann Bot. 2014;113:895-908.
• ³²
  Rao SLN, Adiga PR, Sarma PS. The isolation and characterization of ß-N-Oxalyl-L-a,ß-diaminopropionic acid: a neurotoxin from the seeds of Lathyrus sativus. Biochemistry. 1994;3:432-6.
• ³³
  Doyle JJ, Doyle JL. A rapid total DNA preparation procedure for fresh plant tissue. Focus. 1990;12:13-5.
• ³⁴
  Yeh FC, Yang RC, Boyle T. POPGENE. Microsoft windows-based freeware for population genetic analysis. University of Alberta, Edmonton; 1999.
• ³⁵
  Shannon C, Weave W. The mathematical theory of information. Urbana: University of Illinois Press;1949.
• ³⁶
  Nei M. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics. 1978;89:583-90.
• ³⁷
  Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011;28:2731-9.
• ³⁸
  Park SDE. The Excel microsatellite toolkit (version 3.1). University College Dublin, Ireland: Animal genomics laboratory; 2001.
• ³⁹
  Yang T, Jiang J, Burlyaeva M, Hu J, Coyne CJ, Kumar S, Redden R, Sun X, Wang F, Chang J, Hao X, Guan J, Zong X. Large-scale microsatellite development in grasspea (Lathyrus sativus L.), an orphan legume of the arid areas. BMC Plant Biol. 2014;14:65.
• ⁴⁰
  Yamamoto T, Kimura T, Sawamura Y, Manabe T, Kotobuki K, Hayashi T, Ban Y, Matsuta N. Simple sequence repeats for genetic analysis in pear. Euphytica. 2002;124:129-37.
• ⁴¹
  Hao X, Yang T, Liu R, Hu J, Yao Y, Burlyaeva M, Wang Y, Ren G, Zhang H, Wang D, Chang J, Zong X. An RNA sequencing transcriptome analysis of grasspea (Lathyrus sativus L.) and development of SSR and KASP markers. Front Plant Sci. 2017;8:1873.
• ⁴²
  Jain S, Kumar A, Mamidi S, McPhee K. Genetic diversity and population structure among pea (Pisum sativum L.) cultivars as revealed by simple sequence repeat and novel genic markers. Mol Biotechnol. 2014;56,:925-938.
• ⁴³
  Gong Y, Xu S, Mao W, Li Z, Hu Q, Zhang G, Ding J. Genetic diversity analysis of faba bean (Vicia faba L.) based on EST-SSR markers. Agr Sci China. 2011;10:838-44.
• ⁴⁴
  Scott KD, Eggler P, Seaton G, Rossetto M, Ablett EM, Lee LS, Henry RJ. Analysis of SSRs derived from grape ESTs. Theor Appl Genet. 2000;100:723-6.
• ⁴⁵
  Russell J, Booth A, Fuller J, Harrower B, Hedley P, Machray G, Powell W. A comparison of sequence-based polymorphism and haplotype content in transcribed and anonymous regions of the barley. Genome. 2004;47:389-98.
• ⁴⁶
  Lioi L, Sparvoli F, Sonnante G, Laghetti G, Lupo F, Zaccardelli M. Characterization of Italian grass pea (Lathyrus sativus L.) germplasm using agronomic traits, biochemical and molecular markers. Genet Resour Crop Evol. 2011;58:425-37.
• ⁴⁷
  Ponnaiah M, Shiferaw E, Pe ME, Porceddu E. Development and application of EST-SSRs for diversity analysis in Ethiopian grass pea. Plant Genet Resour - C. 2011;9:276-80.
• ⁴⁸
  Bao L, Chen K, Zhang D, Cao Y, Yamamoto T, Teng Y. Genetic diversity and similarity of pear (Pyrus L.) cultivars native to East Asia revealed by SSR (simple sequence repeat) markers. Genet Resour Crop Evol. 2007;54:959-71.
• ⁴⁹
  He Q, Li XW, Liang GL, Ji K, Guo QG, Yuan WM, Zhou GZ, Chen KS, Weg WE, Gao Z. Genetic diversity and identity of Chinese loquat cultivars/accessions (Eriobotrya japonica) using apple SSR markers. Plant Mol Biol Rep. 2011;29:197-208.
• ⁵⁰
  Rana JC, Rana M, Sharma V, Nag A, Chahota RK, Sharma TR. Genetic diversity and structure of pea (Pisum sativum L.) germplasm based on morphological and SSR markers. Plant Mol Biol Rep. 2017;35:118-29.
• ⁵¹
  Zhebentyayeva TN, Reighard GL, Gorina VM, Abbott AG. Simple sequence repeat (SSR) analysis for assessment of genetic variability in apricot germplasm. Theor Appl Genet. 2003;106:435-44.
• ⁵²
  Erfani J, Ebadi A, Abdollahi H, Fatahi R. Genetic diversity of some pear cultivars and genotypes using simple sequence repeat (SSR) markers. Plant Mol Biol Rep. 2012;30:1065-72.
• ⁵³
  Kumar B, Rakshit S, Singh RD, Gadag RN, Nath R, Paul AK, Wasialam. Genetic diversity of early maturing Indian maize (Zea mays L.) inbred lines revealed by SSR markers. J Plant Biochem Biotechnol. 2008;17:133-40.
• ⁵⁴
  Hammer Ø, Harper DAT, Ryan PD. PAST: Paleontological statistics software package for education and data analysis. Palaeontol Electron. 2001;4:1-9.
• ⁵⁵
  Kaur G, Joshi A, Jain D. SSR-Marker assisted evaluation of genetic diversity in mungbean (Vigna radiata (L.) Wilcezk) genotypes. Braz Arch Biol Techn. 2018;61:e18160613.
• ⁵⁶
  Priolli RHG, Pinheiro JB, Zucchi MI, Bajay MM, Vello NA. Genetic diversity among Brazilian soybean cultivars based on SSR loci and pedigree data. Braz Arch Biol Techn. 2010;53:3.

HIGHLIGHTS

• 1
  22 low β-ODAP grass pea accessions present a wide variation.
• 2
  The mean polymorphic information content (PIC) value is 0.49.
• 3
  Genetic distances are higher between GP6/GP11, GP4/GP11 and GP5/GP8 accessions.

Publication Dates

• Publication in this collection
  10 Aug 2020
• Date of issue
  2020

History

• Received
  12 Mar 2019
• Accepted
  17 Mar 2020