Inhibitory Effect of Five Naturally Occurring Compounds on the Expression of Genes Associated with the QS System and some Virulence Factors in P. aeruginosa

Abstract

Pseudomonas aeruginosa is an opportunistic nosocomial pathogen with a pathogenicity that is an important factor in public health and is the result of the functioning of the Quorum Sensing (QS) system. Currently, compounds of natural origin have shown promising biological effects on certain pathogens in recent years. The aim of the present study was to determine the possible inhibitory effect of five naturally occurring molecules on some genes associated with two pathways of the QS system, as well as on elastase protease and pyocyanin production in two resistant strains of P. aeruginosa. For this purpose, RT-qPCR assays were performed to know the expression of some QS-associated genes (lasR, rhlR, lasI, aprA and lasB) and spectrophotometric assays to evaluate the production of elastase, protease and pyocyanin in the presence or absence of the molecules. It was found that sesamin and ferulic acid were the molecules with the highest inhibitory effect, higher than 40 %, on most of the genes evaluated (lasR, rhlR, aprA and lasB) in the two P. aeruginosa strains BAA-47 and 27853. Likewise, ferulic acid was the most active compound on two of the three virulence factors evaluated even though in general the effect of the molecules was not greater than 50 %. Therefore, these compounds are considered to have a possible multitarget effect by inhibiting the expression of genes associated with the two main systems of P. aeruginosa.

Keywords:
Quorum sensing; Pseudomonas aeruginosa; virulence; natural compounds

GRAPHICAL ABSTRACT

HIGHLIGHTS

Sesamin and ferulic acid had the highest inhibitory effect on the genes evaluated in P. aeruginosa

These compounds have a possible multitarget effect on the two main systems of QS in P. aeruginosa.

Ferulic acid was the most active compound on two of the three virulence factors evaluated

INTRODUCTION

Pseudomonas aeruginosa was included by the World Health Organization (WHO) in the critical priority group by its high capacity to obtain resistance genes and being a multidrug-resistant pathogen, representing a public health problem, being necessary to develop new antibiotics to treat infections [¹-³]. This Gram-negative bacterium is considered an opportunistic nosocomial pathogen causing pulmonary, gastrointestinal, urinary and skin infections, usually affecting hospitalized and immunocompromised patients [⁴,⁵].

Its clinical importance relaces to production of multiple virulence factors and the formation of biofilm, result of the functioning of the Quorum Sensing system (QS), which confers specific characteristics for tissue colonization [⁶,⁷]. This system is a bacterial communication mechanism based on the synthesis and chemical signaling of autoinducer molecules that regulate gene expression [⁸,⁹]. P. aeruginosa has three known interconnected QS communication systems: Las, Rhl and PQS, the first two comprises an autoinducer synthase that produces the autoinducer N-3-oxo-dodecanoyl-homoserine lactone (3-oxo-C12-HSL) and N-butanoyl-homoserine lactone (C4-HSL), respectively [¹⁰]. However, for the PQS system, there are other types of activators known as 4-hydroxy-2-alkylquinolines (HAQ), within this group are 4-hydroxy-2-heptylquinoline (HHQ) and 2-heptyl-3,4-dihydroxyquinoline (PQS). The synthesis of HHQ requires the presence of the pqsABCDE and phnAB operons, whereas the synthesis of PQS occurs by the hydroxylation of HHQ by PqsH [¹⁰,¹¹]. The inducer 3-oxo-C12-HSL binds to LasR and activates lasI and several downstream genes. This complex (LasR-autoinducer) also activates expression of rhlR and rhlI genes, as well as pqsR, pqsABCDE and pqsH genes [⁹,¹²].

Activation of this system allows genes associated with virulence factors to be expressed, being relevant because of their clinical importance; for example, aprA (alkaline protease), lasB (elastase) and pyocyanin (pyo), among others [¹³,¹⁴]. The presence of these multiple virulence factors enhances the pathogenicity of P. aeruginosa, favoring the pathogen during the processes of colonization, tissue damage and invasion, and evasion of the host's defense mechanisms [¹⁰,¹⁵]. A relevant virulence factor is elastase (LasB), the most abundant protein of the secretome of P. aeruginosa, which hydrolyzes a high amount of host proteins, causing tissue damage, altering the immune response, and provoking inflammation [¹⁶]. For its part, pyocyanin acts on multiple cellular pathways within the host causing ciliary strokes, epithelial dysfunction, neutrophil apoptosis, and consequently, alterations in the lung immune system [¹⁷]

Therefore, it is necessary to find alternative therapeutic methods such as the search for QS inhibitors, as a strategy to regulate biofilm formation and decrease the virulence of P. aeruginosa, being necessary to know the mechanism of operation of the QS system to determine the route of inhibition of new molecules [¹⁸,¹⁹]. In the last years, compounds of natural origin have shown promising biological effects on certain pathogens; for example, compounds such as 5-hydroxymethylfurfural, chlorogenic acid and ellagic acid are some molecules that have shown multitarget effects on the genes associated with the QS system lasI, lasR, rhlI, rhlR and pqsR and on some virulence genes such as lasB and rhlA, with inhibition percentages between 30 and 70 % for some strains of P. aeruginosa [²⁰-²²]. It has been widely reported the potential effect of some natural compounds (phenylpropanoids, lignans, terpenes and others) as inhibitors of QS, virulence factors and biofilm on important bacteria in public health [²³,²⁴], however, it is necessary to corroborate this effect on the transcripts or proteins of the QS system in order to report the possible potential for different types of structures previously reported to have other biological effects [¹⁰,²⁵ ]. Therefore, the aim of the present study was to determine the possible inhibitory effect of five molecules of natural origin on some genes associated with two pathways of the QS system, as well as on of elastase, protease and pyocyanin production in two resistant strains of P. aeruginosa.

MATERIAL AND METHODS

Compound specifications

The compounds evaluated (5,5'-(1S,3aR,4S,6aR)-tetrahydro-1H,3H-furo[3,4-c]furan-1,4-diylbis(1,3-benzodioxol) (sesamin) 1, trans -3- (4´-hydroxy-3´-methoxyphenyl)prop-2-enoic acid (ferulic acid) 2, trans-3-(4',5'-methylendioxyphenyl)prop-2-enal 3, 1,2-dimethoxy-4-propylbenzene 4, and 5-(2´-propenyl)-1,3-benzodioxole) (safrole) 5. Of the five compounds evaluated, three (sesamin, ferulic acid and safrole) are commercial with purity greater than 94%; and the remaining compounds are synthesis products of methyleugenol (1,2-dimethoxy-4-propylbenzene) and safrole (trans-3-(4',5'-methylendioxyphenyl) prop-2-enal), Figure 1. The selection of compounds was derived from a previous literature review of molecules with possible effect on the Quorum Sensing system and previous results of the effect of the compounds on biofilm formation [26]. This allowed to stablish the concentrations of the compounds, Table 1.

Figure 1
Compounds evaluated on the gene expression and virulence factors on P. aeruginosa. Sesamin 1, ferulic acid 2, trans-3-(4',5'-methylendioxyphenyl) prop-2-enal 3, 1,2-dimethoxy-4-propylbenzene 4, and safrole 5.

Table 1
Concentration of the five molecules to be evaluated on the two strains of P. aeruginosa

Compound number	IUPAC name (Common name)	Concentration (µg/mL)
		ATCC BAA-47	ATCC 27853
1	5,5'-(1S,3aR,4S,6aR )-tetrahydro-1H,3H-furo[3,4-c]furan-1,4-diylbis(1,3-benzodioxole) (sesamin)	25	25
2	trans -3- (4´-hydroxy-3´-methoxyphenyl) prop-2-enoic acid (ferulic acid)	1,5	50
3	trans-3-(4',5'-methylendioxyphenyl) prop-2-enal	13	50
4	1,2-dimethoxy-4-propylbenzene	25	25
5	5-(2´-propenil)-1,3-benzodioxole) (safrole)	3	100

Bacterial strains and culture

The reference strains used were P. aeruginosa ATCC BAA-47 and ATCC 27853. The culture was performed in Luria Bertani (LB) broth and incubated on an orbital shaker (Jeio Tech IST-3075) at 37 °C, 180 rpm for 24 h. The method used to preserve the morphological, physiological, and genetic characteristics of the strains was freezing at -70 °C in 20% glycerol and LB.

Determination of the effect of molecules with QS inhibitory potential on the expression of some genes of the Las and Rhl systems in two strains of P. aeruginosa.

Primer selection and verification

The transcriptional receptor genes of the two main QS systems (lasR and rhlR) and three cascade genes related to virulence factors (lasI, aprA and lasB), as well as the housekeeping gene (rpoD) were selected. The primers corresponding to these genes were selected from the literature Table 2, verifying their amplification for subsequent use in expression studies. For conventional PCR, 1X GoTaq® Green Master Mix (Promega USA), 0.5 µM primers (Table 2), 2 µL of template and DNase-free water were used for a final volume of 25 µL. The amplification conditions used in the thermal cycler were: 94 °C for five minutes (denaturation), then 35 cycles of 94 °C for 45 seconds, 55 °C for 45 seconds and 72 °C for one minute with a final extension at 72°C for one minute. The amplification products were run on a 2% agarose gel (P/V). Additionally, real-time PCR amplification efficiency evaluation was performed for each gene to avoid overestimation of gene expression in the assays [²⁷-²⁹].

Table 2
Genes evaluated with the sequence corresponding to the primers used and the respective expected products in bp

Gene	Sequence	Expected product size (pb)	Reference
rpoD	F- GGGCGAAGAAGGAAATGGTC R-CAGGTGGCGTAGGTGGAGAA	178	[30]
lasR	F-ACGCTCAAGTGGAAAATTGG R- GTAGATGGACGGTTCCCAGA	247	[31]
rhlR	F- AGGAATGACGGAGGCTTTTT R- CCCGTAGTTCTGCATCTGGT	231	[31]
lasI	F- CTACAGCCTGCAGAACGACA R- ATCTGGGTCTTGGCATTGAG	168	[31]
lasB	F- GGAATGAACGAAGCGTTCTC R- GGTCCAGTAGTAGCGGTTGG	300	[32]
aprA	F- CCCTGTCCTATTCGTTCCTG R- GCGTCGACGAAGTGGATATT	175	[33]

RNA extraction and RT-qPCR

To determine the effect of the five compounds on gene expression, an overnight culture of P. aeruginosa was diluted 1:100 in LB medium and incubated with the molecules or DMSO at 1% (control) until the growth phase equivalent to an optical density at 600 nm between 0.6 and 0.8, that is approximately 1×10⁹ CFU/mL [³⁴]. Each assay was performed in triplicate. For the extraction of total RNA, the RNeasy® Mini kit Qiagen (USA) was used together with RNA protect (Qiagen USA) for the stabilization and protection of the extracted RNA, additionally to eliminate the contaminating DNA in the RNA samples, RNase-free DNase I "RQ1 RNase-Free DNase (Promega USA)" was used. Purity was verified by conventional PCR on RNA and the concentration of each sample was measured using the NanoDrop (Thermo Fisher USA). For reverse transcription, between 0.8 to 1.0 µg of RNA was used using the same amount in the control (RNA extracted from bacteria without molecule but with DMSO) and treatments and cDNA was synthesized, using the M-MLV enzyme (Promega) and random primers (0.5µg) (Promega USA) in a final volume of 25µL. Finally, real-time qPCR was performed using the CFX96™ Real-Time PCR kit (Bio-Rad USA) and the Luna® Universal qPCR (USA) Master Mix kit using 2 μL of cDNA with a primer concentration of 0.25 µM. The final amplification conditions were as follows: a single cycle at 95 °C for 1 minute (polymerase activation) and 38 amplification cycles of 95 °C for 30 seconds (denaturation) and 62 °C for 30 seconds (hybridization and extension) and a final cycle corresponding to the 60-95°C melting curve. The amplification profiles and melting curves were analyzed and the threshold cycle (Ct) values for the lasR, rhlR and affected genes (lasI, lasB and aprA) (Table 2) were normalized to the Ct of the rpoD housekeeping gene [³³,³⁵,³⁶]. Differential gene expression was plotted using the mathematical model that calculates gene expression changes as a relative change in gene expression (as seen by SYBR® Green fluorescence) between treatments and the housekeeping gene (rpoD) Ct (2-∆∆Ct) [³⁷].

Evaluation of molecules on the production of QS-associated virulence factors in two strains of P. aeruginosa

Additionally, the selected molecules were evaluated for their effect on elastase, protease and pyocyanin production at the same concentrations used in the gene expression studies. From an overnight culture, independently, each of the treatments was centrifuged at 10,000 rpm for 15 minutes to separate the supernatant. Each of these assays was performed in triplicate and the results were expressed as percent formation according to the following equation [³⁸]. The positive control was bacterium with 1% DMSO and each treatment or 1 % DMSO without bacterium were considered as a blank.

$\%deformationorproduction=(ODtreatment/ODbacteriumcontrol$

Protease quantification assay

75 µL of the overnight culture supernatant was taken and mixed with 0.3 % azocasein in buffer solution (100 mM Tris pH 8.0), this mixture was incubated at 37 °C for 30 minutes. The reaction was stopped using 10 % trichloroacetic acid, then centrifuged at 10,000 rpm for 10 minutes. Finally, the supernatant was taken and the protease activity was read spectrophotometrically at 400 nm [³⁹].

Elastase quantification Assay

50µL of overnight culture supernatant was mixed with 450 µL of buffer (100 mM Tris pH 7.5) containing elastin congo red (ECR) (20 mg/mL) and incubated at 37 °C for 3 hours with shaking. After incubation, the reaction was stopped with 500 µL of phosphate buffer saline (PBS 0.7 M pH 6.0), centrifuged at 10,000 rpm for 10 minutes to remove insoluble ECR. Finally, elastase activity was measured at 495 nm [³⁹].

Pyocyanin quantification assay

750 µL of overnight culture supernatant and 350 µL of chloroform were placed, the tubes were shaken strongly with the help of a vortex until the release of a blue color was observed, then they were left to stand for 4-5 minutes where the two phases were separated. The organic phase containing this blue pigment was taken and acidified with 300 µL of 0.2 M HCl, again shaken vigorously until a slight color change to pink was observed. Spectrophotometric measurements were taken at 520 nm [⁴⁰].

Statistical analysis

All values obtained (percent formation) were presented as mean ± standard deviation (SD). A one-way ANOVA analysis was performed considering the assumptions of independence, homogeneity and randomness on the absorbance measurements obtained in the assays (positive control, treatments, and negative control). Subsequently, for these same, a Shapiro-Wilk normality test and a Duncan's multiple comparison test between means were performed. A p-value < 0.05 was considered to indicate significant differences [³⁸].

RESULTS

The compounds sesamin and ferulic acid showed an inhibitory effect on lasR and rhlR genes in the two strains tested and aprA and lasB cascade genes in strain BAA-47. The compounds 1,2-dimethoxy-4-propylbenzene, trans-3-(4',5'-methylendioxyphenyl) prop-2-enal inhibited the lasR and lasB gene in the two P. aeruginosa strains and rhlR and lasI only in strain 27853. Additionally, it was possible to determine that safrole was the compound with the least inhibitory capacity on gene expression in the two P. aeruginosa strains evaluated (Figure 2,3).

Figure 2
Effect of the five compounds evaluated on the expression of lasR, rlhR, lasI, aprA and lasB genes on P. aeruginosa BAA-47 by RT-qPCR, the rpoD gene was used as a calibrator and the expression was normalized by the 2^-ΔΔCT method. *Treatments that are significantly different from the control (one-way ANOVA followed by the Duncan test; P<0.05). Sesamin 1, ferulic acid 2, trans-3-(4',5'-methylendioxyphenyl) prop-2-enal 3, 1,2-dimethoxy-4-propylbenzene 4, and safrole 5.

Figure 3
Effect of the five compounds evaluated on the expression of lasR, rlhR, lasI, aprA and lasB genes on P. aeruginosa 27853 by RT-qPCR, the rpoD gene was used as a calibrator and the expression was normalized by the 2^-ΔΔCT method. *Treatments that are significantly different from the control (one-way ANOVA followed by the Duncan test; P<0.05). Sesamin 1, ferulic acid 2, trans-3-(4',5'-methylendioxyphenyl) prop-2-enal 3, 1,2-dimethoxy-4-propylbenzene 4, and safrole 5.

Figure 4 and 5 shows the results obtained for the five compounds evaluated on protease, elastase and pyocyanin production for the two strains of P. aeruginosa. It was found that none of the compounds significantly inhibited protease in strain ATCC BAA-47, while sesamin was the only compound that showed significant effect in strain ATCC 27853. On the other hand, the compounds safrole, ferulic acid, trans-3-(4',5'-methylendioxyphenyl)prop-2-enal and 1,2-dimethoxy-4-propylbenzene showed significant effects on elastase production in strain ATCC BAA-47, while 1,2-dimethoxy-4-propylbenzene was the only molecule able to significantly affect elastase production in strain ATCC 27853. Additionally, it was determined that sesamin favored the production of elastases in the two strains evaluated. With respect to the production of pyocyanin, the molecules evaluated did not show to be very active against this virulence factor; however, it was determined that sesamin and ferulic acid were the compounds that presented the greatest effect on the production of pyocyanin (approximately 20.5%).

Figure 4
Effect of the five compounds evaluated on the production of P. aeruginosa (ATCC BAA-47) virulence factors Analysis of variance (ANOVA) significant effect* (p <0,05). C(+) (bacterium with 1% DMSO), sesamin 1, ferulic acid 2, trans-3-(4',5'-methylendioxyphenyl) prop-2-enal 3, 1,2-dimethoxy-4-propylbenzene 4, and safrole 5.

Figure 5
Effect of the five compounds evaluated on the production of P. aeruginosa (ATCC 27853) virulence factors. Analysis of variance (ANOVA) significant effect* (p <0,05). C(+) (bacterium with 1% DMSO), sesamin 1, ferulic acid 2, trans-3-(4',5'-methylendioxyphenyl)prop-2-enal 3, 1,2-dimethoxy-4-propylbenzene 4, and safrole 5.

DISCUSSION

P. aeruginosa is currently one of the most studied pathogens because it occurs with the highest incidence in chronic infections. Its virulence behavior is regulated by QS, hence, the continuous search for new molecules and their effect on the QS system [²⁰]. This study highlights the importance of knowing and verifying the effect of compounds of natural origin on the QS system of P. aeruginosa, responsible for the activation of multiple virulence factors in this pathogen.

The sesamin and ferulic acid compounds showed an inhibitory effect on the expression of the genes of the Las and Rhl systems of the two strains evaluated. From the five evaluated compounds there is only one report about sesamin in molecular experiments [³³], and for the four remaining there had not been reports of its effect on genes studied. For sesamin, inhibition greater than 80% in the lasR, rhlR and lasI genes in strain PAO1 has been reported [³³], being similar to that found in strain ATCC 27853 in the present study. Molecular docking studies have reported that their inhibition on genes may be associated with the coupling with the LasR and LasI protein through hydrophobic interactions, and in turn with the expression of the cascade virulence factor associated with the LasR and LasI system [³³].

Ferulic acid was the most active compound in the evaluation of gene expression, mainly, it had the capacity to inhibit the expression of the lasR gene between 71-77 % and the rhlR gene between 49-57 % in both strains. The gene inhibition of the two systems are relate to previous reports that show that lasR gene favors the autoinduction of this same system and in turn activates the second pathway with the rhlR gene at both the transcriptional level and the posttranslational level [¹⁴,⁴¹]. This simultaneous inhibitory effect on the two systems was also observed for the compounds trans-3-(4',5'-methylendioxyphenyl) prop-2-enal, 1,2-dimethoxy-4-propylbenzene, and sesamin against the ATCC 27853 strain. This effect is consistent with reports previous for quercetin [⁴²] , derivatives of benzimidazole and baicalin among others [⁴³]. Ferulic acid has no previous reports on genes evaluated but its potential on QS system has been proposed, for example, there is a report of inhibition between 35-40% on the LasR protein in a bioluminescence assay with mutant strains [⁴⁴] and inhibition of the tetK, msrA and norA genes on Staphylococcus aureus strains (RN4220, IS-58 and SA1199B) [⁴⁵,⁴⁶]. Also, there is a recent report with in silicostudies, where it is suggested that ferulic acid is a potential inhibitor of the transcriptional regulator RhlR in P. aeruginosa [⁴⁷].

Trans-3-(4',5'-methylendioxyphenyl)prop-2-enal showed an opposite effect in the ATCC strain BAA-47 where there was inhibition of the lasR gene but not on the expression of the rhlR gene. These results can be explained by the relation with the third system, PQS [¹⁴] , and presence of alternative regulatory systems that modulate the expression of some genes, for example, the transcriptional regulators Vfr and GacA that activate the lasR and rhlR genes, directly intervening in the cascade expression of the QS system [⁴⁸,⁴⁹] .

Additionally, the results of ferulic acid and trans-3-(4',5'-methylendioxyphenyl) prop-2-enal, especially in strain 27853, showed a decrease in the expression of lasI close to 60% and 80%, respectively. It is likely that the action of this compound is on the LasR protein and in turn on the lasR gene, which is not being transcribed at the same level as the control; this would explain why the formation of the transcriptional receptor to which the autoinducer signal should bind is not favored. A study showed this effect using 2-Hydroxyanisole, which had a high probability of union to LasR in silico, and in transcriptomics analysis were observed that the compound down regulated lasR and cascade genes like lasI and lasB, between others [⁵⁰].

Considering the systematic regulation of QS in P. aeruginosa, it was possible to corroborate the effect that molecules on the systems (Las and Rhl) have on the expression of genes associated with virulence factors. For example, it was corroborated that the compounds sesamin, in BAA-47 strain, ferulic acid and trans-3-(4',5'-methylendioxyphenyl) prop-2-enal, in both strains, inhibited the lasR gene and the aprA cascade gene with inhibition percentages between 20-45 %. A report showed a similar effect where Terpinen-4-ol decrease the expression of QS genes (lasI, lasR, rhlI, rhlR) and virulence factors genes (lasB, aprA, toxA, and plcH), and in turn it was confirmed by its effect directly on virulence factors [⁵¹]. However, sesamin inhibited the lasR gene in strain 27853, but not the aprA gene. This effect was previously reported by other authors where sesamin inhibited 78.5 % lasR gene expression, however, aprA gene expression was not affected, probably because of the alternative regulatory systems present in P. aeruginosa that not only activate but can also switch off the expression of other genes associated with the system [³³].

Another cascade gene, associated with the system, is lasB whose expression is controlled by the Las and Rhl system, this cascade effect was found with the compounds sesamin, trans-3-(4',5'-methylendioxyphenyl) prop-2-enal and 1,2-dimethoxy-4-propylbenzene for the two bacteria evaluated, ferulic acid with strain BAA-47 and safrole in strain 27853 (Figure 2 and 3). This effect has also been reported by Li and coworkers, who reported a significant inhibition of 80% by the diallyl disulfide compound on the rhlR gene and a total inhibition (98%) on the lasB [⁵²]. However, the compound trans-3-(4',5'-methylendioxyphenyl) prop-2-enal, in BAA-47 strain, showed no inhibitory effect on the rhlR gene but did show an inhibitory effect on the expression of lasB gene, which may be related unique to its effect on the Las system. Similarly, it has been possible to corroborate inhibitory effects by other compounds that show a similar trend to that reported in the present study but that use other methodologies such as gene silencing, RNAseq or measurement of Miller units by measuring β-galactosidase activity, such as that reported for molecules derived from 3-nitrophenol where reporters and modified strains of Escherichia coli are used [⁵³,⁵⁴].

The molecules evaluated presented greater inhibition in elastase production, especially for safrole, ferulic acid, trans-3-(4',5'-methylendioxyphenyl) prop-2-enal and 1,2-dimethoxy-4-propylbenzene showed significant effects in strain ATCC BAA-47, while sesamin and ferulic acid presented the greatest effect on the production of pyocyanin (approximately 20.5%). It is important to highlight that the values for strain ATCC 27853 were not included, since it presented low values of absorbance to be quantified.

The compounds ferulic acid, trans-3-(4',5'-methylendioxyphenyl)prop-2-enal, 1,2-dimethoxy-4-propylbenzene and safrole do not present previous reports of their inhibitory activity on the three virulence factors (protease, elastase and pyocyanin) on P. aeruginosa, being this their first report. However, in a previous study it was found that ferulic acid produces an inhibition of 32.4% (250 g/mL) on lasA protease in the staphylolytic assay and 50.29% in pyocyanin production [⁵⁵].

In the present study Sesamin showed inhibition of virulence factors only in elastase, while a report show inhibition in various virulence factors as elastase, protease and pyocyanin in the PAO1 strain at 75 (g/mL [³³], these differences are explained for concentration (25 (g/mL). In the same study it was determine that sesamin showed inhibition in the expression of genes associated with the Las and Rhl systems and in the expression of some virulence factors such as protease, similar to a previous report [³³].

In this research was possible to corroborate the relationship between the expression of some genes with some virulence factors, for example, ferulic acid and sesamin in strain ATCC BAA-47 showed inhibitory effects of the Rhl system in the case of the quantification of lasB gene and elastase (Figure 2 and Figure 4), evidencing and corroborating the activation of cascade genes and virulence factors; similar to previous reports [⁴¹].

Finally, it is possible to highlight that some phenolic compounds have previous reports of inhibition for some virulence factors and genes associated with QS in P. aeruginosa. For example, it has been reported that trans-cinnamaldehyde inhibits swarming by about 50% and was shown in silico to have a binding affinity for the LasI protein and coumarin significantly inhibits protease production, pyocyanin, biofilm formation and the expression of genes such as lasI and rhlI [⁵⁶,⁵⁷]. Additionally, the effect of this type of compounds has also been reported on virulence factors and their associated genes in other microorganisms. These compounds include quercetin, which has reported inhibitory activity on biofilm formation, some virulence factors (motility) and expression of QS genes (avrA, hilA, rpoS and luxS) in Salmonella enterica [⁵⁸]; as well as 2,3-dimethylHQ and 2,5-ditertbutylHQ showed significant inhibition of the expression of Vibrio parahaemolyticus QS-associated genes such as luxS and luxI, and some virulence factors such as toxins, pili, phosphatases, outer membrane channels, among others (toxR, aphA, mshA, tolC) [⁵⁹] .

Considering the above results, the structures of the compounds with the best inhibitory effect, ferulic acid, sesamin and 1,2-dimethoxy-4-propylbenzene, associated with the QS genes, could be considered for future studies on the synthesis of alternative molecules that enhance the effect found, as future drug alternatives to treat Pseudomonas mediated infections possibly in conjunction with antibiotics.

CONCLUSION

The results of this study allow to conclude, sesamin and ferulic acid were the compounds that showed the greatest inhibitory effect on lasR and rhlR genes, as well as their effect on lasI, aprA and lasB cascade genes in the two strains evaluated. Similarly, ferulic acid and 1,2-dimethoxy-4-propylbenzene showed an inhibitory effect on elastase and protease production in the two P. aeruginosa strains. The inhibition of the Las and Rhl system genes by these compounds determines a multitarget effect and allows postulating sesamin and ferulic acid as alternative molecules for the development of new drugs against infections caused by Pseudomonas.

Acknowledgments

The authors extend their gratitude to the research groups (QUIPRONAB belonging to the Universidad Nacional de Colombia, BIOMIGEN belonging to the Universidad de La Salle and LIAC laboratory of Universidad de La Salle for their collaboration in the development of the research.

REFERENCES

• ¹
  Thakur M, Kumar Y, Yadav V, Pramanik A. Understanding resistance acquisition by Pseudomonas aeruginosa and possible pharmacological approaches in palliating its pathogenesis. Biochem Pharmacol. 2023;215(July):115689 https://doi.org/10.1016/j.bcp.2023.115689
  » https://doi.org/10.1016/j.bcp.2023.115689
• ²
  Poole K. Pseudomonas aeruginosa: Resistance to the max. Front Microbiol. 2011;2(APR):1-13 https://doi.org/10.3389/fmicb.2011.00065
  » https://doi.org/10.3389/fmicb.2011.00065
• ³
  Díaz Santos E, Mora Jiménez C, del Río-Carbajo L, Vidal-Cortés P. Treatment of severe multi-drug resistant Pseudomonas aeruginosa infections. Medicina Intensiva (English Edition). 2022;46(9):508-20 https://doi.org/10.1016/j.medine.2022.06.014
  » https://doi.org/10.1016/j.medine.2022.06.014
• ⁴
  Sathe N, Beech P, Croft L, Suphioglu C, Kapat A, Athan E. Pseudomonas aeruginosa: Infections and novel approaches to treatment "Knowing the enemy" the threat of Pseudomonas aeruginosa and exploring novel approaches to treatment. Infect Med. 2023;2(3):178-194 https://doi.org/10.1016/j.imj.2023.05.003
  » https://doi.org/10.1016/j.imj.2023.05.003
• ⁵
  Jangra V, Sharma N, Chhillar A. Therapeutic approaches for combating Pseudomonas aeruginosa infections. Microbes Infect. 2022;24(4):104950 https://doi.org/10.1016/j.micinf.2022.104950
  » https://doi.org/10.1016/j.micinf.2022.104950
• ⁶
  Granato ET, Ziegenhain C, Marvig RL, Kümmerli R. Low spatial structure and selection against secreted virulence factors attenuates pathogenicity in Pseudomonas aeruginosa. ISME J. 2018;12(12):2907-18 https://doi.org/10.1038/s41396-018-0231-9
  » https://doi.org/10.1038/s41396-018-0231-9
• ⁷
  Burrows LL. The Therapeutic Pipeline for Pseudomonas aeruginosa Infections. ACS Infect Dis. 2018;4(7):1041-7 https://doi.org/10.1021/acsinfecdis.8b00112
  » https://doi.org/10.1021/acsinfecdis.8b00112
• ⁸
  Higgins EL, Kellner-Rogers JS, Estanislau AM, Esposito AC, Vail NR, Payne SR, et al. Design, synthesis, and evaluation of transition-state analogs as inhibitors of the bacterial quorum sensing autoinducer synthase CepI. Bioorg Med Chem Lett. 2021;39(May):127873 https://doi.org/10.1016/j.bmcl.2021.127873
  » https://doi.org/10.1016/j.bmcl.2021.127873
• ⁹
  García-Diéguez L, Diaz-Tang G, Marin Meneses E, Cruise V, Barraza I, Craddock T, et al. Periodically disturbing biofilms reduces expression of quorum sensing-regulated virulence factors in Pseudomonas aeruginosa. iScience. 2023;26(6):106843 https://doi.org/10.1016/j.isci.2023.106843
  » https://doi.org/10.1016/j.isci.2023.106843
• ¹⁰
  Lima E, Winans S, Pinto U. Quorum sensing interference by phenolic compounds - A matter of bacterial misunderstanding. Heliyon. 2023;9(7):e17657 https://doi.org/10.1016/j.heliyon.2023.e17657
  » https://doi.org/10.1016/j.heliyon.2023.e17657
• ¹¹
  Kim K, Kim YU, Koh BH, Hwang SS, Kim SH, Lépine F, et al. HHQ and PQS, two Pseudomonas aeruginosa quorum-sensing molecules, down-regulate the innate immune responses through the nuclear factor-?B pathway. Immunology. 2010 Apr;129(4):578-88 https://doi.org/10.1111/j.1365-2567.2009.03160.x
  » https://doi.org/10.1111/j.1365-2567.2009.03160.x
• ¹²
  Yi L, Dong X, Grenier D, Wang K, Wang Y. Research progress of bacterial quorum sensing receptors: Classification, structure, function and characteristics. Sci. Total Environ. 2021;763(14):30-1 http://doi.org/10.1016/j.scitotenv.2020.143031
  » http://doi.org/10.1016/j.scitotenv.2020.143031
• ¹³
  Shao X, Yao C, Ding Y, Hu H, Qian G, He M, et al. The transcriptional regulators of virulence for Pseudomonas aeruginosa: Therapeutic opportunity and preventive potential of its clinical infections. Genes Dis. 2022;10(5):2049-63 https://doi.org/10.1016/j.gendis.2022.09.009
  » https://doi.org/10.1016/j.gendis.2022.09.009
• ¹⁴
  Brindhadevi K, LewisOscar F, Mylonakis E, Shanmugam S, Verma T, Pugazhendhi A. Biofilm and Quorum sensing mediated pathogenicity in Pseudomonas aeruginosa. Process Biochem. 2020;96(June):49-57. https://doi.org/10.1016/j.procbio.2020.06.001
  » https://doi.org/10.1016/j.procbio.2020.06.001
• ¹⁵
  Ghazalibina M, Morshedi K, Farahani R, Babadi M, Khaledi A. Study of virulence genes and related with biofilm formation in Pseudomonas aeruginosa isolated from clinical samples of Iranian patients; A systematic review. Gene Rep. 2019;17(June):100471 https://doi.org/10.1016/j.genrep.2019.100471
  » https://doi.org/10.1016/j.genrep.2019.100471
• ¹⁶
  Everett Martin, Davies David. Pseudomonas aeruginosa elastase (LasB) as a therapeutic target. Drug Discov Today. 2021;26(9):2108-23 https://doi.org/10.1016/j.drudis.2021.02.026
  » https://doi.org/10.1016/j.drudis.2021.02.026
• ¹⁷
  Paz-Zarza VM, Mangwani-Mordani S, Martínez-Maldonado A, Álvarez-Hernández D, Solano-Gálvez S, Vázquez-López R. [Pseudomonas aeruginosa: Pathogenicity and antimicrobial resistance in urinary tract infection]. Rev. Chilena Infectol. 2019;36(2):180-9 http://dx.doi.org/10.4067/S0716-10182019000200180
  » http://dx.doi.org/10.4067/S0716-10182019000200180
• ¹⁸
  Hemmati F, Salehi R, Ghotaslou R, Kafil H, Hasani A, Gholizadeh P, et al. Quorum quenching: A potential target for antipseudomonal therapy. Infect Drug Resist. 2020;13:2989-3005 https://doi.org/10.2147/IDR.S263196
  » https://doi.org/10.2147/IDR.S263196
• ¹⁹
  Kameswaran S, Ramesh B. Quenching and Quorum Sensing in Bacterial Bio-films. Res Microbiol. 2023;104085 https://doi.org/10.1016/j.resmic.2023.104085
  » https://doi.org/10.1016/j.resmic.2023.104085
• ²⁰
  Rajkumari J, Borkotoky S, Reddy D, Mohanty SK, Kumavath R, Murali A, et al. Anti-quorum sensing and anti-biofilm activity of 5-hydroxymethylfurfural against Pseudomonas aeruginosa PAO1: Insights from in vitro, in vivo and in silico studies. Microbiol Res. 2019;226(Sept):19-26 https://doi.org/10.1016/j.micres.2019.05.001
  » https://doi.org/10.1016/j.micres.2019.05.001
• ²¹
  Sarabhai S, Sharma P, Capalash N. Ellagic Acid Derivatives from Terminalia chebula Retz. Downregulate the Expression of Quorum Sensing Genes to Attenuate Pseudomonas aeruginosa PAO1 Virulence. PLoS One. 2013;8(1):1-11 https://doi.org/10.1371/journal.pone.0053441
  » https://doi.org/10.1371/journal.pone.0053441
• ²²
  Wang H, Chu W, Ye C, Gaeta B, Tao H, Wang M, et al. Chlorogenic acid attenuates virulence factors and pathogenicity of Pseudomonas aeruginosa by regulating quorum sensing. Appl Microbiol Biotechnol. 2019;103(2):903-15 https://doi.org/10.1007/s00253-018-9482-7
  » https://doi.org/10.1007/s00253-018-9482-7
• ²³
  Ta CAK, Arnason JT. Mini review of phytochemicals and plant taxa with activity as microbial biofilm and quorum sensing inhibitors. Molecules. 2016;21(1) https://doi.org/10.3390/molecules21010029
  » https://doi.org/10.3390/molecules21010029
• ²⁴
  Silva LN, Zimmer KR, Macedo AJ, Trentin DS. Plant Natural Products Targeting Bacterial Virulence Factors. Chem Rev. 2016;116(16):9162-236 https://doi.org/10.1021/acs.chemrev.6b00184
  » https://doi.org/10.1021/acs.chemrev.6b00184
• ²⁵
  Rather MA, Saha D, Bhuyan S, Jha AN, Mandal M. Quorum Quenching: A Drug Discovery Approach Against Pseudomonas aeruginosa. Microbiol Res. 2022;264(April):127173 https://doi.org/10.1016/j.micres.2022.127173
  » https://doi.org/10.1016/j.micres.2022.127173
• ²⁶
  Velasco W. [Potential inhibitory effect of natural compounds on Quorum Sensing in Pseudomonas aeruginosa]. Universidad el Bosque. 2022.
• ²⁷
  Bassy Álvarez O, Larigauderie G, Ortega García M, Granja Albarellos C, Cabria Ramos J. [Optimization and validation of a real-time PCR for rapid identification of Bacillus thuringiensis, surrogate of Bacillus anthracis]. Sanid Mil. 2018;74(2):84-89.
• ²⁸
  Svec D, Tichopad A, Novosadova V, Pfaffl MW, Kubista M. How good is a PCR efficiency estimate: Recommendations for precise and robust qPCR efficiency assessments. Biomol Detect Quantif. 2015 Mar 1;3:9-16 http://dx.doi.org/10.1016/j.bdq.2015.01.005
  » http://dx.doi.org/10.1016/j.bdq.2015.01.005
• ²⁹
  Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative CT method. Nat Protoc. 2008 May;3(6):1101-8 https://doi.org/10.1038/nprot.2008.73
  » https://doi.org/10.1038/nprot.2008.73
• ³⁰
  Morello E, Pérez-Berezo T, Boisseau C, Baranek T, Guillon A, Bréa D, et al. Pseudomonas aeruginosa Lipoxygenase LoxA Contributes to Lung Infection by Altering the Host Immune Lipid Signaling. Front Microbiol. 2019;10(August):1-16 https://doi.org/10.3389/fmicb.2019.01826
  » https://doi.org/10.3389/fmicb.2019.01826
• ³¹
  Teerapo K, Roytrakul S, Sistayanarain A, Kunthalert D. A scorpion venom peptide derivative BmKn-22 with potent antibiofilm activity against Pseudomonas aeruginosa. PLoS One. 2019;14(6):1-17 https://doi.org/10.1371/journal.pone.0218479
  » https://doi.org/10.1371/journal.pone.0218479
• ³²
  Lanotte P, Watt S, Mereghetti L, Dartiguelongue N, Rastegar-Lari A, Goudeau A, et al. Genetic features of Pseudomonas aeruginosa isolates from cystic fibrosis patients compared with those of isolates from other origins. J Med Microbiol. 2004;53(1):73-81 https://doi.org/10.1099/jmm.0.05324-0
  » https://doi.org/10.1099/jmm.0.05324-0
• ³³
  Anju VT, Busi S, Ranganathan S, Ampasala DR, Kumar S, Suchiang K, et al. Sesamin and sesamolin rescues Caenorhabditis elegans from Pseudomonas aeruginosa infection through the attenuation of quorum sensing regulated virulence factors. Microbial Pathogenesis 2021;155:104912 https://doi.org/10.1016/j.micpath.2021.104912
  » https://doi.org/10.1016/j.micpath.2021.104912
• ³⁴
  Yin L, Zhang Y, Azi F, Zhou J, Liu X, Dai Y, et al. Inhibition of biofilm formation and quorum sensing by soy isoflavones in Pseudomonas aeruginosa. Food Control. 2022;133:108629 https://doi.org/10.1016/j.foodcont.2021.108629
  » https://doi.org/10.1016/j.foodcont.2021.108629
• ³⁵
  Banerjee M, Moulick S, Bhattacharya K, Parai D, Chattopadhyay S, Mukherjee S. Attenuation of Pseudomonas aeruginosa quorum sensing, virulence and biofilm formation by extracts of Andrographis paniculata. Microb Pathog. 2017;113(August):85-93 https://doi.org/10.1016/j.micpath.2017.10.023
  » https://doi.org/10.1016/j.micpath.2017.10.023
• ³⁶
  DehghanZadeh Z, Koupaei M, Saderi H, Amin Marashi SM, Ghorbani Z, Owlia P. Inhibitory effect of Saccharomyces cerevisiae supernatant and lysate on expression of lasB and apl genes of Pseudomonas aeruginosa. Gene Rep. 2021;24(June):101247 https://doi.org/10.1016/j.genrep.2021.101247
  » https://doi.org/10.1016/j.genrep.2021.101247
• ³⁷
  Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-??CT method. Methods. 2001;25(4):402-8 https://doi.org/10.1006/meth.2001.1262
  » https://doi.org/10.1006/meth.2001.1262
• ³⁸
  Rather M, Gupta K, Mandal M. Inhibition of biofilm and quorum sensing-regulated virulence factors in Pseudomonas aeruginosa by Cuphea carthagenensis ( Jacq .) J . F . Macbr . Leaf extract : An in vitro study. J Ethnopharmacol. 2021;269(6):269:113 https://doi.org/10.1016/j.jep.2020.113699
  » https://doi.org/10.1016/j.jep.2020.113699
• ³⁹
  Singh VK, Mishra A, Jha B. 3-Benzyl-Hexahydro-Pyrrolo[1,2-a] Pyrazine-1,4-Dione Extracted From Exiguobacterium Indicum Showed Anti-Biofilm Activity Against Pseudomonas aeruginosa By Attenuating Quorum Sensing. Front Microbiol. 2019;10(7): https://doi.org/10.3389/fmicb.2019.01269
  » https://doi.org/10.3389/fmicb.2019.01269
• ⁴⁰
  Chadha J, Ravi, Singh J, Chhibber S, Harjai K. Gentamicin Augments the Quorum Quenching Potential of Cinnamaldehyde In Vitro and Protects Caenorhabditis elegans From Pseudomonas aeruginosa Infection. Front Cell Infect Microbiol. 2022;12(June):1-18 https://doi.org/10.3389/fcimb.2022.899566
  » https://doi.org/10.3389/fcimb.2022.899566
• ⁴¹
  Papenfort K, Bassler BL. Quorum sensing signal-response systems in Gram-negative bacteria. Nat Rev Microbiol. 2016;14(9):576-88 https://doi.org/10.1038/nrmicro.2016.89
  » https://doi.org/10.1038/nrmicro.2016.89
• ⁴²
  Ouyang J, Feng W, Lai X, Chen Y, Zhang X, Rong L, et al. Quercetin inhibits Pseudomonas aeruginosa biofilm formation via the vfr - mediated lasIR system. Microb. Pathog. 2020;149(December 2019):104291 https://doi.org/10.1016/j.micpath.2020.104291
  » https://doi.org/10.1016/j.micpath.2020.104291
• ⁴³
  Luo J, Dong B, Wang K, Cai S, Liu T, Cheng X, et al. Baicalin inhibits biofilm formation, attenuates the quorum sensing-controlled virulence and enhances Pseudomonas aeruginosa clearance in a mouse peritoneal implant infection model. Vol. 12, PLoS ONE. 2017. 1-32 https://doi.org/10.1371/journal.pone.0176883
  » https://doi.org/10.1371/journal.pone.0176883
• ⁴⁴
  Aleksic I, Ristivojevic P, Pavic A, Radojevic I, Comic LR, Vasiljevic B, et al. Anti-quorum sensing activity, toxicity in zebrafish (Danio rerio) embryos and phytochemical characterization of Trapa natans leaf extracts. J Ethnopharmacol. 2018;222(March):148-58 https://doi.org/10.1016/j.jep.2018.05.005
  » https://doi.org/10.1016/j.jep.2018.05.005
• ⁴⁵
  Pinheiro P, Santiago M, da Silva F, de Araújo A, de Oliveira C, Freitas P, et al. Ferulic acid derivatives inhibiting Staphylococcus aureus tetK and MsrA efflux pumps. Biotechnol Rep. 2022;34(20):7-17 https://doi.org/10.1016/j.btre.2022.e00717
  » https://doi.org/10.1016/j.btre.2022.e00717
• ⁴⁶
  Sundaramoorthy NS, Mitra K, Ganesh JS, Makala H, Lotha R, Bhanuvalli SR, et al. Ferulic acid derivative inhibits NorA efflux and in combination with ciprofloxacin curtails growth of MRSA in vitro and in vivo. Microb Pathog. 2018;124(May):54-62 https://doi.org/10.1016/j.micpath.2018.08.022
  » https://doi.org/10.1016/j.micpath.2018.08.022
• ⁴⁷
  Escobar-Muciño E. The role of eugenol and ferulic acid as the competitive inhibitors of transcriptional regulator RhlR in P. aeruginosa. MethodsX. 2022;9(10):17-71 https://doi.org/10.1016/j.mex.2022.101771
  » https://doi.org/10.1016/j.mex.2022.101771
• ⁴⁸
  Venturi V. Regulation of quorum sensing in Pseudomonas. FEMS Microbiol Rev. 2006;30(2):274-91 https://doi.org/10.1111/j.1574-6976.2005.00012.x
  » https://doi.org/10.1111/j.1574-6976.2005.00012.x
• ⁴⁹
  Zhang Y, Chew BLA, Wang J, Yuan M, Yam JKH, Luo D, et al. Structural basis for the inhibitory mechanism of auranofin and gold(I) analogues against Pseudomonas aeruginosa global virulence factor regulator Vfr. Comput Struct Biotechnol J. 2023 Jan 1;21:2137-46 https://doi.org/10.1016/j.csbj.2023.03.013
  » https://doi.org/10.1016/j.csbj.2023.03.013
• ⁵⁰
  Vadakkan K, Hemapriya J, Anbarasu A, Ramaiah S, Vijayanand S. Quorum quenching by 2-Hydroxyanisole extracted from Solanum torvum on Pseudomonas aeruginosa and its inhibitory action upon LasR protein. Gene Rep. 2020;21(July):100802 https://doi.org/10.1016/j.genrep.2020.100802
  » https://doi.org/10.1016/j.genrep.2020.100802
• ⁵¹
  Guzzo F, Scognamiglio M, Fiorentino A, Buommino E, D'Abrosca B. Plant Derived Natural Products against Pseudomonas aeruginosa and Staphylococcus aureus: Antibiofilm Activity and Molecular Mechanisms. Molecules. 2020;25(21) https://doi.org/10.3390/molecules25215024
  » https://doi.org/10.3390/molecules25215024
• ⁵²
  Li W, Ma Y, Xie X, Shi Q, Wen X, Sun T, et al. Diallyl disulfide from garlic oil inhibits Pseudomonas aeruginosa quorum sensing systems and corresponding virulence factors. Front Microbiol. 2019;10(7):7555-64 https://doi.org/10.3389/fmicb.2018.03222
  » https://doi.org/10.3389/fmicb.2018.03222
• ⁵³
  Vandeputte OM, Kiendrebeogo M, Rasamiravaka T, Stévigny C, Duez P, Rajaonson S, et al. The flavanone naringenin reduces the production of quorum sensing-controlled virulence factors in Pseudomonas aeruginosa PAO1. Microbiology (N Y). 2011;157(7):2120-32 https://doi.org/10.1099/mic.0.049338-0
  » https://doi.org/10.1099/mic.0.049338-0
• ⁵⁴
  Wang B, Yang Y, Wang W, Yu J, Zhang F, Wu S, et al. Identification of 3-nitrophenol ester derivatives as novel quorum-sensing inhibitors of Pseudomonas aeruginosa. J Mol Struct. 2023;1273:22-3. https://doi.org/10.1016/j.molstruc.2022.134284
  » https://doi.org/10.1016/j.molstruc.2022.134284
• ⁵⁵
  Pattnaik S, Barik S, Muralitharan G, Busi S. Ferulic acid encapsulated chitosan-tripolyphosphate nanoparticles attenuate quorum sensing regulated virulence and biofilm formation in Pseudomonas aeruginosa PAO1. IET Nanobiotechnol. 2018;12(8):1056-61 https://doi.org/10.1049/iet-nbt.2018.5114
  » https://doi.org/10.1049/iet-nbt.2018.5114
• ⁵⁶
  Chang C, Krishnan T, Wang H, Chen Y, Yin WF, Chong Y, et al. Non-antibiotic quorum sensing inhibitors acting against N-acyl homoserine lactone synthase as druggable target. Sci Rep. 2014;4:1-8 https://doi.org/10.1038/srep07245
  » https://doi.org/10.1038/srep07245
• ⁵⁷
  Zhang Y, Sass A, Van Acker H, Wille J, Verhasselt B, Van Nieuwerburgh F, et al. Coumarin reduces virulence and biofilm formation in Pseudomonas aeruginosa by affecting quorum sensing, type III secretion and C-di-GMP levels. Front Microbiol. 2018;9(AUG):1-10 https://doi.org/10.3389/fmicb.2018.01952
  » https://doi.org/10.3389/fmicb.2018.01952
• ⁵⁸
  Kim YK, Roy PK, Ashrafudoulla M, Nahar S, Toushik S, Hossain M, et al. Antibiofilm effects of quercetin against Salmonella enterica biofilm formation and virulence, stress response, and quorum-sensing gene expression. Food Control. 2022;137(10):1964 https://doi.org/10.1016/j.foodcont.2022.108964
  » https://doi.org/10.1016/j.foodcont.2022.108964
• ⁵⁹
  Sathiyamoorthi E, Faleye O, Lee J, Lee J. Hydroquinone derivatives attenuate biofilm formation and virulence factor production in Vibrio spp. Int J Food Microbiol. 2023;384(2022):109954 https://doi.org/10.1016/j.ijfoodmicro.2022.109954
  » https://doi.org/10.1016/j.ijfoodmicro.2022.109954

• Funding:

  This research was funded by Universidad Nacional de Colombia, Universidad de La Salle and Ministerio de Ciencia Tecnología e Innovación (MINCIENCIAS) through contract 835-2017 with code 1101-777-58105, announcement “777-2017 Convocatoria para proyectos de ciencia, tecnología e innovación en salud 2017” of the Project "Identification of leading molecules of natural origin with multitarget action as quorum sensing inhibitors in multiresistant Pseudomonas aeruginosa".

Edited by

Editor-in-Chief:

Paulo Vitor Farago

Associate Editor:

Jane Manfron Budel

Publication Dates

• Publication in this collection
  10 June 2024
• Date of issue
  2024

History

• Received
  31 May 2023
• Accepted
  07 Oct 2023