Analysis of Germin-like protein genes family in Vitis vinifera (VvGLPs) using various in silico approaches

Ilyas, M.; Rahman, A.; Khan, N. H.; Haroon, M.; Hussain, H.; Rehman, L.; Alam, M.; Rauf, A.; Waggas, D. S.; Bawazeer, S.

doi:10.1590/1519-6984.256732

M. Ilyas ^**e-mail: mohammadilyas1000@gmail.com; Dr.ilyas@uoswabi.edu.pk

University of Swabi, Department of Botany, Swabi, Khyber Pakhtunkhwa, Pakistan

http://orcid.org/0000-0001-7399-7743

A. Rahman

University of Swabi, Department of Botany, Swabi, Khyber Pakhtunkhwa, Pakistan

N. H. Khan

University of Swabi, Department of Environmental Sciences, Swabi Khyber Pakhtunkhwa, Pakistan

M. Haroon

University of Swabi, Department of Agriculture, Swabi, Khyber Pakhtunkhwa, Pakistan

H. Hussain

University of Swabi, Department of Biotechnology, Swabi, Khyber Pakhtunkhwa, Pakistan

http://orcid.org/0000-0002-5449-7660

L. Rehman

University of Swabi, Department of Biotechnology, Swabi, Khyber Pakhtunkhwa, Pakistan

M. Alam

University of Swabi, Department of Agriculture, Swabi, Khyber Pakhtunkhwa, Pakistan

A. Rauf

University of Swabi, Department of Chemistry, Swabi, Khyber Pakhtunkhwa, Pakistan

http://orcid.org/0000-0003-2429-5491

D. S. Waggas

Fakeeh College of Medical Sciences, Department of Pharmacology, Jeddah, Saudi Arabia

S. Bawazeer

Umm Al-Qura University, Faculty of Pharmacy, Department of Pharmacology, Mecca, Kingdom of Saudi Arabia

*e-mail: mohammadilyas1000@gmail.com; Dr.ilyas@uoswabi.edu.pk

Figures (4)
Tables (3)

Thumbnail

Figure 1
Multiple sequence alignment of the Vitis vinifera Germin-like proteins (VvGLPs) genes family. The analysis was conducted with the Clustal Omega program (Sievers and Higgins, 2018SIEVERS, F. and HIGGINS, D.G., 2018. Clustal Omega for making accurate alignments of many protein sequences. Protein Science, vol. 27, no. 1, pp. 135-145. http://dx.doi.org/10.1002/pro.3290. PMid:28884485.
http://dx.doi.org/10.1002/pro.3290... ). Each Germin motif is represented with a black box. The peptide signal region and KGD/KGE motif are represented with blue and yellow boxes respectively.

Thumbnail

Figure 2
Domain analysis of the Vitis vinifera Germin-Like proteins (VvGLPs) genes family. Multiple Em for Motif Elicitation (MEME) suit (Version 5.4.1) (Bailey et al., 2015BAILEY, T.L., JOHNSON, J., GRANT, C.E. and NOBLE, W.S., 2015. The MEME suite. Nucleic Acids Research, vol. 43, no. W1, pp. W39-W49. http://dx.doi.org/10.1093/nar/gkv416. PMid:25953851.
http://dx.doi.org/10.1093/nar/gkv416... ) was used for the analysis to predict 05 possible motives in the VvGLPs as represented with colored blocks. The conserved motives were confirmed for their functional role via “Motif scan” as well as “Motif Search” softwares. Motives width and sequence is given in the figure. M: Motif, S4: Small RNA-binding protein domain, N/A: Not available.

Thumbnail

Figure 3
Phylogenetic analysis of the Vitis vinifera Germin-like proteins (VvGLPs) genes family. Groups with distinct colors were highlighted with parenthesis. Genes located on chromosomes 14 and 11 were labeled as triangles and rectangles respectively. The evolutionary history was inferred using the Neighbor-Joining method. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the p-distance method and are in the units of the number of amino acid differences per site. This analysis involved 7 amino acid sequences. All ambiguous positions were removed for each sequence pair (pairwise deletion option). There were a total of 225 positions in the final dataset. Evolutionary analysis was conducted with Molecular and evolutionary genetic analysis tool Ver.10 (MEGAX).

Thumbnail

Figure 4
Regulatory element analysis of the Vitis vinifera Germin-like proteins (VvGLPs) genes promoters. Detail of the elements in each promoter is given in each graph labelled with respective promoter name. The analysis was conducted with the PlantPAN (Ver.3) server (Chow et al., 2019CHOW, C.N., LEE, T.Y., HUNG, Y.C., LI, G.Z., TSENG, K.C., LIU, Y.H., KUO, P.L., ZHENG, H.Q. and CHANG, W.C., 2019. PlantPAN3.0: a new and updated resource for reconstructing transcriptional regulatory networks from ChIP-seq experiments in plants. Nucleic Acids Research, vol. 47, no. D1, pp. D1155-D1163. http://dx.doi.org/10.1093/nar/gky1081. PMid:30395277.
http://dx.doi.org/10.1093/nar/gky1081... ). The number of each element is given on each bar. Graphs were made using Excel 2016.

Thumbnail

Table 1
Computational analysis based on various structural and functional properties of the Vitis vinifera Germin-like proteins (VvGLPs) genes family.

Thumbnail

Table 2
In silico functional analysis of the Vitis vinifera Germin-like proteins (VvGLPs) genes. The analysis was conducted using Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) (Szklarczyk et al., 2019SZKLARCZYK, D., GABLE, A.L., LYON, D., JUNGE, A., WYDER, S., HUERTA-CEPAS, J., SIMONOVIC, M., DONCHEVA, N.T., MORRIS, J.H., BORK, P., JENSEN, L.J. and MERING, C.V., 2019. STRING v11: protein–protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Research, vol. 47, no. D1, pp. D607-D613. http://dx.doi.org/10.1093/nar/gky1131. PMid:30476243.
http://dx.doi.org/10.1093/nar/gky1131... ) and Blast2go Servers (Conesa and Götz, 2008CONESA, A. and GÖTZ, S., 2008. Blast2GO: a comprehensive suite for functional analysis in plant genomics. International Journal of Plant Genomics, vol. 2008, pp. 619832. http://dx.doi.org/10.1155/2008/619832. PMid:18483572.
http://dx.doi.org/10.1155/2008/619832... ).

Thumbnail

Table 3
Transcriptional factor binding sites (TFBSs) analysis of the Vitis vinifera Germin-like protein genes (VvGLPs) promoter. The cis-regulatory elements were found using PlantPAN (Version 3) software (Chow et al., 2019CHOW, C.N., LEE, T.Y., HUNG, Y.C., LI, G.Z., TSENG, K.C., LIU, Y.H., KUO, P.L., ZHENG, H.Q. and CHANG, W.C., 2019. PlantPAN3.0: a new and updated resource for reconstructing transcriptional regulatory networks from ChIP-seq experiments in plants. Nucleic Acids Research, vol. 47, no. D1, pp. D1155-D1163. http://dx.doi.org/10.1093/nar/gky1081. PMid:30395277.
http://dx.doi.org/10.1093/nar/gky1081... ). The elements may exist on both strands (sense or antisense) of the promoters.

Gene Name	M.wt	pl	-R	+R	EC	II	Al	GRAVY	Pfam domain	SL (CELLO)	SL (PSORT)	N-sites	p-sites
VvGLP1	23456.99	6.40	15	14	3105	23.15	100.09	0.273	Cupin	Extracellular	Periplasmic	2	6
VvGLP2	22732.27	8.53	16	18	1490	21.00	95.67	0.241	Cupin	Mitochondria	Extracellular	2	7
VvGLP3	24326.95	4.90	21	14	18450	25.39	103.47	0.261	Cupin	Extracellular	Plasma membrane	1	7
VvGLP4	23607.06	6.82	19	19	6085	17.51	96.05	0.138	Cupin	Extracellular	Periplasmic	3	10
VvGLP5	22294.39	5.20	17	11	7450	18.89	97.49	0.123	Cupin	Extracellular	Periplasmic	2	6
VvGLP6	21525.13	6.38	12	11	4470	29.21	105.05	0.576	Cupin	Plasma membrane	Extracellular	1	3
VvGLP7	24078.37	5.45	18	13	7450	20.92	93.00	0.160	Cupin	Periplasmic	Chloroplast	2	9

Gene Name	STRING Analysis	Blast2Go
VvGLP1	Terpene synthase/Terpene cyclase-like 1/Mn⁺/Lipoxygenase/Cytochrome P450/Monoterpenoid biosynthesis/IPT Domain/C & N Terminal domain/Isoprenoid synthase	Mn⁺ ion binding activity, Noncytoplasmic
VvGLP2	Phosphate permease, and Zinc/iron permease fungal/plant/ OPT oligopeptide transporter protein, and Natural resistance-associated macrophage protein/Achaete-scute transcription factor-related, and Haemerythrine-like/ Calcineurin-like phosphoesterase/ Mn⁺/ Major facilitator superfamily (MFS)/	Mn⁺ ion binding activity, Noncytoplasmic
VvGLP3	Terpene synthase/Terpene cyclase-like 1/Mn⁺/Lipoxygenase/Monoterpenoid biosynthesis/Isoprenoid synthase/IPT Domain/Cytochrome P450/N & C Terminal domain	Mn⁺ ion binding activity, Noncytoplasmic
VvGLP4	NIF	Mn⁺ ion binding activity, Noncytoplasmic
VvGLP5	NIF	Mn⁺ ion binding activity, Noncytoplasmic
VvGLP6	Tetratricopeptide repeat (TPR) domain/ S-locus, Receptor kinase, and Alpha/beta hydrolase fold-1/ C-terminal	Mn⁺ ion binding activity, Noncytoplasmic
VvGLP7	NIF	Mn⁺ ion binding activity, Noncytoplasmic

Element name	Sequence	Function & Description
3-AF1 binding site	AAAGAGAGGAA	Light-responsive element
AAGAA-motif	AAGAAAG	Not available
ARE	AAACCA	A cis-acting regulatory element essential for the anaerobic induction
AT~TATA-box	TATATA	Transcription regulation
AuxRR-core	GGTCCAT	Cis-acting regulatory element involved in auxin responsiveness
CAAT-box	CAAAT	Common cis-acting element in promoter and enhancer regions
CGTCA-motif	ACTGC	Cis-acting regulatory element involved in the MeJA-responsiveness
G-box	AGCAC	Cis-acting regulatory element involved in light responsiveness
GATA-motif	AAGGATAA	Part of a light-responsive element
MSA-like	ATTGGCAATCGTAAAACTAC	Cis-acting element involved in cell cycle regulation
MYC	CATTTG	Jasmonic acid signaling, abiotic & biotic stress responsiveness
O2-site	GTTGTCGTGA	Cis-acting regulatory element involved in Zn metabolism regulation
STRE	GAGGGG	Heat shock, oxidative, and osmotic response element
TATA-box	TATAGA	Core promoter element around -30 of the transcription start site
TATC-box	TATCCCA	Cis-acting element involved in Gibberellin-responsiveness
TC-rich repeats	CAATCACTTA	Cis-acting element involved in defense and stress responsiveness
TCA-element	GTAGAAGACT	Cis-acting element involved in Salicylic acid responsiveness
TCT-motif	CATTCT	Part of a light-responsive element
Unnamed__1	GGTGC	Not available
Unnamed__2	GGCCCC	Not available
Unnamed__4	GTGG	Promoter development and gene regulation
WRE3	TCCACC	Not available
WUN-motif	TAATTAC	Wound response element
as-1	TGACG	Not available
Box 4	ATTACA	Part of a conserved DNA module involved in light responsiveness
chs-CMA1a	TTACTTAA	Part of a light-responsive element
MRE	AATCCAA	MYB binding site involved in light responsiveness
ERE	ATTTCATA	Drought, submergence, fruit ripening & secondary metabolite production
MYC	GTTTAC	Biotic and abiotic stresses
I-BOX	CCATCTT	Part of a light-responsive element
GT1-motif	AATTGG	Light responsive element, light responsive element
LTR	CCGAAA	Cis-acting element involved in low-temperature responsiveness
MYB	TAACCA	Propanoid biosynthesis, drought and salt stress, etc.
CARE	CACTCAAC	Not available
CCGTCC motif	CCGTCC	Not available
GA-motif	ATAGATAA	Part of a light-responsive element
GARE-motif	GTTGTCT	Gibberellin-responsive element
Gap-box	CAAATGAAAAACTA	Part of a light responsive element
RY-element	GTACGTAC	Cis-acting regulatory element involved in seed-specific regulation
circadian	CATAGATATC	Cis-acting regulatory element involved in circadian control
AP-1	TGAGTTAG	Not available
CCAAT-box	CAACG	MYBHv1 binding site
TGA-element	AACGAC	Auxin-responsive element

[1] *e-mail: mohammadilyas1000@gmail.com; Dr.ilyas@uoswabi.edu.pk

Brasil

Brasil

Analysis of Germin-like protein genes family in Vitis vinifera (VvGLPs) using various in silico approaches

Análise da família de genes de proteínas semelhantes a germin em Vitis vinifera (VvGLPs) usando várias abordagens in silico

Abstract