Susceptibility variation of Malassezia pachydermatis to antifungal agents according to isolate source

Abstract

Malassezia pachydermatisis associated with dermatomycoses and otomycosis in dogs and cats. This study compared the susceptibility of M. pachydermatis isolates from sick (G1) and healthy (G2) animals to azole and polyene antifungals using the M27-A3 protocol. Isolates from G1 animals were less sensitive to amphotericin B, nystatin, fluconazole, clotrimazole and miconazole.

Malassezia pachydermatis; susceptibility; antifungal agents


Susceptibility variation of Malassezia pachydermatis to antifungal agents according to isolate source

Caroline Borges WeilerI, * * Corresponding Author. Mailing address:C.B. Weiler. Programa de Pós-graduação em Ciências Farmacêuticas, Universidade Federal de Santa Maria, Santa Maria, RS, Brasil. E-mail: carolweiler@hotmail.com. ; Francielli Pantella Kunz de JesusII; Graziela Habib NardiIII;Érico Silva LoretoII; Janio Morais SanturioII; Selene Dall'Acqua CoutinhoIII; Sydney Hartz AlvesI, II

IPrograma de Pós-graduação em Ciências Farmacêuticas, Universidade Federal de Santa Maria, Santa Maria, RS, Brasil

IIDepartamento de Microbiologia e Parasitologia, Universidade Federal de Santa Maria, Santa Maria, RS, Brasil

IIILaboratório de Biologia Molecular e Celular, Universidade Paulista, São Paulo, SP, Brasil

ABSTRACT

Malassezia pachydermatisis associated with dermatomycoses and otomycosis in dogs and cats. This study compared the susceptibility of M. pachydermatis isolates from sick (G1) and healthy (G2) animals to azole and polyene antifungals using the M27-A3 protocol. Isolates from G1 animals were less sensitive to amphotericin B, nystatin, fluconazole, clotrimazole and miconazole.

Key words: Malassezia pachydermatis, susceptibility, antifungal agents.

Currently, the genus Malasseziaincludes fourteen species, thirteen of which are lipid-dependent and are most frequently recovered from humans, ruminants and horses (Malassezia furfur, M. globosa, M. obtusa, M. restricta, M.slooffiae, M. sympodialis, M. dermatis, M. nana, M. japonica, M. yamatoensis, M. equina, M. caprae and M. cuniculi); the non-lipid-dependent species, M. pachydermatis, is commonly recovered from dogs and cats (Cabañes et al., 2011). The distribution of different species, the colonization prevalence and the population density of Malasseziaspp. varies by carrier and affected sites of the body, which are influenced by the skin lipid composition and the presence of competitive microbiota (Sugita et al., 2010).

M. pachydermatisis the species most adapted to animals and is often recovered as part of the microbiota of the ear canal and skin of dogs, cats and other species of domestic and wild animals. In dogs and cats, M. pachydermatis has been linked to both localized (otitis externa and dermatitis) and systemic disease (Guillot and Bond, 1999). Anti-fungal triazoles are commonly used for treatment, and treatment should be continued until the clinical signs resolve and yeast are no longer observed during direct examination (Daigle, 2007).

The aim of this study was to compare the susceptibility of M. pachydermatis isolates recovered from healthy animals and animals with otitis to ketoconazole, fluconazole, itraconazole, voriconazole, clotrimazole, miconazole, nys-tatin and amphotericin B.

We studied two groups of M. pachydermatisisolates taken from dogs and cats at the Cellular and Molecular Biology Laboratory of the Paulista University (UNIP, São Paulo, Brazil). Group 1 (G1) was comprised of 40 isolates recovered from the ear canals of animals with otitis externa; group 2 (G2) was comprised of 40 isolates recovered from the ear canals of healthy animals. Isolate identification was confirmed by randomly amplified polymorphic DNA using the Mpa-F (CTGCCATACGGATGCGCAAG) and 58S-R (TTCGCTGCGTTCTTCATCGA) primers (Sugita et al., 2003).

Stock solutions of antifungal agents were obtained from the dilution of each antifungal drug in dimethyl sulfo-xide or sterile distilled water for fluconazole. The drugs were serially diluted in RPMI 1640 broth (GIBCOTM) to obtain the following final concentrations: ketoconazole (16 μg/mL-0.007 μg/mL) (Janssen Beerse), itraconazole (16 μg/mL-0.007 μg/mL) (Janssen Beerse), clotrimazole (64 μg/mL-0.125 μg/mL) (Bayer), voriconazole (16 μg/mL-0.007 μg/mL) (Pfizer), miconazole (64 μg/mL-0.125 μg/mL) (Labware), nystatin (64 μg/mL- 0.125 μg/mL) (Bristol-Myers), amphotericin B (16 μg/mL-0.007 μg/mL) (Bristol-Myers) and fluconazole (64 μg/mL-0.125 μg/mL) (Pfizer). Inocula were obtained from 48-h pure Dixon agar cultures and consisted of microorganism suspensions in sterile saline (0.85%) plus Triton X-100 (0.05%) (Merck), whose turbidity was adjusted to 0.5 on the McFarland scale. Inocula were diluted 1:50 in sterile distilled water and then at 1:20 in RPMI 1640 broth. For each isolate, microdilution plates containing 10 μLof antifungals in RPMI 1640 diluted in different concentrations were inoculated with 10 μLof the standardized ino-cula. As positive control, the standardized inocula were cultured alone; the negative control was the antifungal alone diluted in RPMI 1640 broth. Culture plates were incubated at 37 °C for 48 h. Minimum inhibitory concentrations (MICs) were recorded following the M27-A3 protocol (CLSI, 2007). All tests were performed in duplicate. The Mann-Whitney test was used to compare the two groups of isolates to determine whether they had similar susceptibility patterns to the antifungal agents tested.

Because no standardized susceptibility testing procedures exist for M. pachydermatis, the present study was based on the M27-A3 protocol (CLSI, 2007); in the absence of specific breakpoints for Malasseziaspp., we utilized breakpoints described for Candidaspp.

In this work, the lowest MICs were observed with ketoconazole, itraconazole and voriconazole (Table 1). Voriconazole showed the smallest variations of MICs with the MICs for G1 isolates ranging from 0.01-0.25 μg/mL, while the MICs for G2 isolates ranged from 0.01 to 0.125 μg/mL. These data are consistent with findings from Gupta et al.(2000) that reported MICs ranging from 0.03 to 0.25 μg/mL. Hammer et al.(2000) reported the lowest MICs with ketoconazole, with MIC50and MIC90values similar to values we recorded for G2 isolates (Table 2). Although the susceptibility testing for itraconazole, fluconazole and amphotericin B showed that 100% of the isolates were susceptible to these antifungals, the MIC range was higher in G1 isolates compared to G2 isolates (Table 2). Nakamura et al.(2000) tested seven Malassezia species and all were susceptible to itraconazole; however, M. pachydermatis exhibited the highest MIC range among the species evaluated.

Statistical analysis revealed significant differences in susceptibility between G1 and G2 isolates. In the susceptibility tests with amphotericin B, nystatin, fluconazole, miconazole and clotrimazole, G1 isolates had significantly higher MICs compared to G2 isolates (p < 0.05). The existence of a different susceptibility profile between the two groups revealed higher antifungal resistance in the isolates obtained from infected animals (G1). The study by Lyskova et al.(2007) using M. pachydermatisisolates from animals with and without otitis media found that all isolates exhibited high susceptibility to all of the antifungal agents tested in this study, except for fluconazole, to which 4.4% of the isolates were resistant. However, in this same study, significant differences in susceptibility between the two isolate groups were not observed. Fluconazole resistance has been described previously as Eichenberg et al.(2003) observed fluconazole resistance in 2.4% of the 82 isolates tested. Further, Jesus et al.(2011) induced resistance to fluconazole in vitro, demonstrating that M. pachydermatis isolates can become resistant during treatment with this antifungal. Bernardo et al.(1998) found a M. pachydermatis isolate that was resistant to several anti-fungals, including amphotericin B, nystatin and micona-zole.

Malassezia species have a structure resembling a capsule around the cell wall that provides protection and is similar in form to the capsule of Cryptococcusspp. (Ashbee and Bond, 2010). In saprophytic strains, this capsule contains high levels of lipids, blocking the exposure of fungal antigenic proteins. Factors such as humidity, high temperature and high fat environment favor rapid M. pachydermatis multiplication, which is accompanied by decreased lipid content and exposure of antigenic particles. The reduced susceptibility observed in G1 isolates against azole antifungal agents might be linked to variations in lipid composition. The main mechanism of action of azoles is to inhibit ergosterol synthesis. However, these drugs also act on the cell membrane through direct interaction with its lipid components (Hitchcock et al., 1986). Thus, during infection, the body's immune cells release substances that promote a lipid imbalance in the constitution of the fungal membrane, affecting membrane permeability (De Kruyff et al., 1973) and interfering with the action of azole antifungal agents. In the case of polyene antifungal agents, the reduced susceptibility of the G1 isolates may be related to the high activity of fungal intracellular enzymes such as cata-lase and/or superoxide dismutase. In microorganisms, catalase plays an important role in the detoxification of reactive oxygen species that are released by phagocytic cells during the host immune response (Hampton et al., 1998). Because polyenes act directly on fungal ergosterol causing direct oxidative damage to the cell membrane, the high concentration of catalase in fungal cells could protect the fungal cells from the oxidative action of polyene antifungal agents, possibly explaining the higher MICs in isolates obtained from animals with malasseziosis.

This study demonstrated that M. pachydermatisisolated from animals with otitis are less sensitive to some antifungal agents than yeasts isolated from animals without otitis. This finding may explain because some malasseziosis treatment failure and emphasizes the importance to evaluate the susceptibility of this pathogenic fungi.

Submitted: August 18, 2011

Approved: July 02, 2012.

  • Ashbee HR, Bond R (2010) MalasseziaSpecies and Immunity: Host-Pathogen Interactions. In: Boekhout T, Guého-Kellermann E, Mayser P, Velegraki A (eds) Malassezia and the Skin - Science and Clincial Practice. Springer, New York, pp 144-146.
  • Bernardo FM, Martins HM, Martins ML (1998) A survey of mycotic otitis externa of dogs in Lisbon. Rev Iberoam Micol 15:163-165.
  • Cabañes FJ, Veja S, Castellá G (2011) Malassezia cuniculi sp. nov., a novel yeast species isolated from rabbit skin. Med Mycol 49:40-48.
  • Clinical and Laboratory Standards Institute (2007) Reference Method for Broth Diluition Antifungal Susceptibility Tes-ting of Yeast: Approved Guideline M27-A3, v. 28.CLSI, Wayne, PA,USA, 1-25.
  • Daigle JC (2007) Clinical clues, diagnosis and treatment of Malassezia dermatitis.The North American Veterinary Conference Congress, Orlando, Flórida, 21, pp 317-318.
  • De Kruyff B, De Greef WJ, Eyk RVW, Demel RA, Van Deenen LLM (1973) The effect of different fatty acid and sterol composition on the erythritol flux through the cell membrane of Acholeplasma laidlawii Biochimica et Biophysica Acta (BBA) - Biomembranes 298:479-499.
  • Eichenberg ML, Appelt CE, Berg V, Muschner AC, Nobre MO, Matta D, Alves SH, Ferreiro L (2003) Susceptibility of Malasseziapachydermatisto azole antifungal agents evaluated by a new broth microdilution method. Acta Sci Vet 31:75-80.
  • Guillot J, Bond R (1999) Malasseziapachydermatis: A review. Med Mycol 37:295-306.
  • Gupta AK, Kohli Y, Li A, Summerbell RC (2000) In vitrosusceptibility of the seven Malasseziaspecies to ketoconazole, voriconazole, itraconazole e terbinafina. Brit J Dermatol 142:758-765.
  • Hammer KA, Carson CF, Riley TV (2000) In vitroactivities of ketoconazole, econazole, miconazole and Melaleucaalternifolia(tea tree) oil against Malasseziaspecies. Antimicrob Agents Ch 44:467-469.
  • Hampton MB, Kettle AJ, Winterbourn CC (1998) Inside the neutrophil phagosome: Oxidants, myeloperoxidase and bacterial killing. Blood 92:3007-3017.
  • Hitchcock C, Barrett-Bee K, Russel N (1986) The lipid composition of azoles-sensitive and azole-resistant strains of Candida albicans J Gen Microbiol 132:2421-2431.
  • Jesus FPK, Lautert C, Zanette RA, Mahl DL, Azevedo MI, Ma-chado MLS, Alves SH, Botton SA, Dutra V, Santurio JM (2011) Invitrosusceptibiliy of fluconazole-susceptible and -resistent isolates of Malasseziapachydermatisagainst azoles. Vet Microbiol 152:161-164.
  • Lyskova P, Vydrzalova M, Mazurova J (2007) Identification and antimicrobial susceptibility of bacteria and yeasts isolated from healthy dogs and dogs with otitis externa. J Vet Med A 54:559-563.
  • Nakamura Y, Kano R, Murai T, Watanabe S, Hasegawa A (2000) Susceptibility testing of Malasseziaspecies using the urea broth microdilution method. Antimicrob Agents Ch 44:2185-2186.
  • Sugita T, Boekhout T, Velegraki A, Guillot J, Hadina S, Cabañes J (2010) Epidemiology of Malassezia - Related skin diseases. In: Boekhout T, Guého E, Mayser P, Velegraki A (eds) Malassezia and the Skin: Science and Clinical Practice. Springer, New York, pp 65-120.
  • Sugita T, Taqkashima M, Kodama M, Tsubol R, Nishikawa A (2003) Description of a new yeast species, Malasseziajaponica, abd its detection in patients with atopic dermatitis and healthy subjects. J Clin Microbiol 41:4695-4699.

  • *
    Corresponding Author. Mailing address:C.B. Weiler. Programa de Pós-graduação em Ciências Farmacêuticas, Universidade Federal de Santa Maria, Santa Maria, RS, Brasil. E-mail:

Publication Dates

  • Publication in this collection
    26 Mar 2013
  • Date of issue
    2013

History

  • Received
    18 Aug 2011
  • Accepted
    02 July 2012
Sociedade Brasileira de Microbiologia USP - ICB III - Dep. de Microbiologia, Sociedade Brasileira de Microbiologia, Av. Prof. Lineu Prestes, 2415, Cidade Universitária, 05508-900 São Paulo, SP - Brasil, Ramal USP 7979, Tel. / Fax: (55 11) 3813-9647 ou 3037-7095 - São Paulo - SP - Brazil
E-mail: bjm@sbmicrobiologia.org.br