Characterization of quinolone resistance in <i>Salmonella</i> spp. isolates from food products and human samples in Brazil

Pribul, Bruno Rocha; Festivo, Marcia Lima; Souza, Miliane Moreira Soares de; Rodrigues, Dalia dos Prazeres

doi:10.1016/j.bjm.2015.04.001

Acessibilidade / Reportar erro

Brasil

Brazilian Journal of Microbiology

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Food Microbiology • Braz. J. Microbiol. 47 (1) • Jan-Mar 2016 • https://doi.org/10.1016/j.bjm.2015.04.001 copy

Characterization of quinolone resistance in Salmonella spp. isolates from food products and human samples in Brazil

Authorship SCIMAGO INSTITUTIONS RANKINGS

Abstract

Non-typhoidal salmonellosis is an important zoonotic disease caused by Salmonella enterica. The aim of this study was to investigate the prevalence of plasmid-mediated quinolone resistance in Salmonella spp. and its association with fluoroquinolone susceptibility in Brazil. A total of 129 NTS isolates (samples from human origin, food from animal origin, environmental, and animal) grouped as from animal (n = 62) and human (n = 67) food were evaluated between 2009 and 2013. These isolates were investigated through serotyping, antimicrobial susceptibility testing, and the presence of plasmid-mediated quinolone resistance (PMQR) genes (qnr, aac(6')-Ib) and associated integron genes (integrase, and conserved integron region). Resistance to quinolones and/or fluoroquinolones, from first to third generations, was observed. Fifteen isolates were positive for the presence of qnr genes (8 qnrS, 6 qnrB, and 1 qnrD) and twenty three of aac(6')-Ib. The conserved integron region was detected in 67 isolates as variable regions, from ±600 to >1000 pb. The spread of NTS involving PMQR carriers is of serious concern and should be carefully monitored.

Keywords
Foodborne diseases; Salmonella spp.; Quinolone resistance

Primers	Primer sequences (5'-3')	Target gene	Amplicon size (bp)	Reference
QnrA-F	ATTTCTCACGCCAGGATTTG	qnrA	516	Jacoby et al. ⁹9 Jacoby GA, Gacharna N, Black TA, Miller GH, Hooper DC. Temporal appearance of plasmid-mediated quinolone resistance genes. Antimicrob Agents Chemother. 2009;53:1665-1666.
QnrA-R	GATCGGCAAAGGTTAGGTCA
QnrB-F	GATCGTGAAAGCCAGAAAGG	qnrB	469	Jacoby et al. ⁹9 Jacoby GA, Gacharna N, Black TA, Miller GH, Hooper DC. Temporal appearance of plasmid-mediated quinolone resistance genes. Antimicrob Agents Chemother. 2009;53:1665-1666.
QnrB-R	ACGATGCCTGGTAGTTGTCC
QnrC-F	GGGTTGTACATTTATTGAATCG	qnrC	307	Kim et al. ⁸8 Kim HB, Park CH, Kim CJ, Kim EC, Jacoby GA, Hooper DC. Prevalence of plasmid-mediated quinolone resistance determinants over a 9-year period. Antimicrob Agents Chemother. 2009;53:639-645.
QnrC-R	CACCTACCCATTTATTTTCA
QnrD-F	CGAGATCAATTTACGGGGAATA	qnrD	582	Cavaco et al. ¹⁰10 Cavaco LM, Hasman H, Xia S, Aarestrup FM. qnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica serovar Kentucky and Bovismorbificans strains of human origin. Antimicrob Agents Chemother. 2009;53:603-608.
QnrD-R	AACAAGCTGAAGCGCCTG
QnrS-F	ACGACATTCGTCAACTGCAA	qnrS	417	Jacoby et al. ⁹9 Jacoby GA, Gacharna N, Black TA, Miller GH, Hooper DC. Temporal appearance of plasmid-mediated quinolone resistance genes. Antimicrob Agents Chemother. 2009;53:1665-1666.
QnrS-R	TAAATTGGCACCCTGTAGGC
AAC(6')-Ib-F	TATGAGTGGCTAAATCGAT	aac(6')-Ib	482	Park et al. ¹¹11 Park CH, Robicsek A, Jacoby GA, Sahm D, Hooper DC. Prevalence in the United States of aac(6')-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob Agents Chemother. 2006;50:3953-3955.
AAC(6')-Ib-R	CCCGCTTTCTCGTAGCA
Integrase-F	CCTCCCGCACGATGATC	Integrase	250	Peirano et al. ¹²12 Peirano G, Agers ø Y Aarestrup FM, et al. Occurrence of integrons and antimicrobial resistance genes among Salmonella enterica from Brasil. J Antimicrob Chemother. 2006;58:305-309.
Integrase-R	TCCACGCATCGTCAGGC
Integron-3	AAGCAGACTTGACCTGA	Integron	Variable	Peirano et al. ¹³13 Lestari SI, Han F, Wang F, Ge B. Prevalence and antimicrobial resistance of Salmonella serovars in conventional and organic chickens from Louisiana retail stores. J Food Prot. 2009;72:1165-1172.
Integron-5	GGCATCCAAGCAGCAAG

Salmonella Serotype	Year	Number of NTS ^a a Non-typhoid Salmonella . isolated from
Human	Food	Environment	Animal	Total
S. Tiphymurium	2013	2	–	–	–	2
2012	24	14	1	1	40
2011	7	2	2	–	11
2010	–	4	–	1	5
2009	2	2	1	1	6

S. Enteritidis	2013	3	–	–	–	3
2012	20	1	–	–	21
2009	1	–	–	–	1

S. Muenchen	2012	2	1	–	–	3
2011	–	1	–	–	1

S. Saintpaul	2012	1	–	–	2	3

S. Infantis	2012	1	–	1	–	2
2010	–	1	–	–	1

S. Heidelberg	2012	–	2	–	–	2
2011	–	–	–	1	1

Others	2013	1	–	–	–	1
2012	3	8	6	–	17
2011	–	1	1	1	3
2010	–	1	1	2	4
2009	–	1	–	2	3

Total		67	39	14	32	152

Isolate	Source	PMQR	Integron ^a a Variable region.	MIC ( µg/mL)
Cip	Nal	Eno	Lvx	Ofl
S. Typhimurium	H	qnrB aac(6')-Ib	–	≥2	≥128	≥4	≥2	≥4
S. Typhimurium	H	qnrB aac(6')-Ib	±900 bp	≥2	≥128	≥4	≤0.06	≤0.25
S. Typhimurium	H	qnrB	–	≥2	≥128	≥4	≥2	≥4
S. Typhimurium	H	qnrB	>1000 bp	≤0.5	≥128	≤1	≤0.06	≤0.06
S. Typhimurium	F	qnrS	–	≤0.5	≤64	≤2	≤0.06	≤0.06
S. Typhimurium	F	qnrD	–	≤0.03	≤32	≤0.06	≤0.06	≤0.06
S. Saintpaul	A	qnrS aac(6')-Ib	±900 bp	≤0.5	≥128	≤0.5	≤0.06	≤0.06
S. Saintpaul	H	qnrS	–	≤0.5	≥128	≥4	≤0.06	≤0.12
S. Muenchen2 ^b b Isolate quantity.	H	qnrS	–	≤0.5	≤32	≤2	≤0.06	≤0.06
S. Livingstone	F	qnrS	–	≤0.5	≥128	≥4	≤0.06	≤0.06
S. Orion	E	qnrS	–	≤0.5	≥128	≤2	≤0.06	≤0.06
S. Panama	H	qnrS	–	≤1	≤64	≤2	≤0.06	≤0.06
S. Enteritidis	H	qnrB	±800 bp	≤0.25	≥128	≤1	≤0.06	≤0.06
S. ent . subsp ent .	H	qnrB	>1000 bp	≤1	≥128	≤2	≤0.06	≤0.25
S. Typhimurium2	H	aac(6')-Ib	–	≥2	≥128	≥4	≤2	≤2
S. Typhimurium3	F	aac(6')-Ib	–	≥2	≥128	≥4	≤2	≤2
S. Typhimurium	E	aac(6')-Ib	±900 bp	≥2	≥128	≥4	≤2	≤2
S. Typhimurium	A	aac(6')-Ib	±900 bp	≥2	≥128	≥4	≤2	≤2
S. Typhimurium	H	aac(6')-Ib	±900 bp	≥2	≥128	≥4	≥4	≥4
S. Typhimurium	F	aac(6')-Ib	–	≥2	≥128	≥4	≥4	≥4
S. Typhimurium	F	aac(6')-Ib	±900 bp	≥2	≥128	≥4	≤1	≤1
S. Typhimurium	H	aac(6')-Ib	±800 bp	≤1	≥128	≥4	≥4	≤2
S. Typhimurium	H	aac(6')-Ib	>1000 bp	≤0.25	≥128	≤0.25	≤0.12	≤0.12
S. Enteritidis	H	aac(6')-Ib	–	≤0.5	≥128	≤2	≤0.12	≤0.12
S. Enteritidis	H	aac(6')-Ib	±800 bp	≥2	≥128	≥4	≤1	≤1
S. Give	H	aac(6')-Ib	–	≥2	≤64	≥4	≤1	≤2
S. Hadar	F	aac(6')-Ib	–	≤0.5	≥128	≤2	≤0.06	≤0.06
S. Infantis	E	aac(6')-Ib	–	≤0.25	≤8	≤0.06	≤0.06	≤0.06
S. Muenchen	F	aac(6')-Ib	±600 bp	≤0.5	≤32	≤2	≤0.06	≤0.06
S. Montevideo	E	aac(6')-Ib	–	≤0.5	≤32	≤1	≤0.06	≤0.06
S. Saintpaul	A	aac(6')-Ib	±800 bp	≤0.5	≥128	≤1	≤0.06	≤0.06

Sociedade Brasileira de Microbiologia USP - ICB III - Dep. de Microbiologia, Sociedade Brasileira de Microbiologia, Av. Prof. Lineu Prestes, 2415, Cidade Universitária, 05508-900 São Paulo, SP - Brasil, Ramal USP 7979, Tel. / Fax: (55 11) 3813-9647 ou 3037-7095 - São Paulo - SP - Brazil
E-mail: bjm@sbmicrobiologia.org.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] *Corresponding author. E-mail: bruno.pribul@ioc.fiocruz.br (B.R. Pribul).