Occurrence and antimicrobial resistance patterns of <i>Listeria monocytogenes</i> isolated from vegetables

Byrne, Vanessa de Vasconcelos; Hofer, Ernesto; Vallim, Deyse Christina; Almeida, Rogeria Comastri de Castro

doi:10.1016/j.bjm.2015.11.033

Acessibilidade / Reportar erro

Brasil

Brazilian Journal of Microbiology

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Food Microbiology • Braz. J. Microbiol. 47 (2) • Apr-Jun 2016 • https://doi.org/10.1016/j.bjm.2015.11.033 copy

Occurrence and antimicrobial resistance patterns of Listeria monocytogenes isolated from vegetables

Authorship SCIMAGO INSTITUTIONS RANKINGS

Abstract

Although the consumption of fresh and minimally processed vegetables is considered healthy, outbreaks related to the contamination of these products are frequently reported. Among the food-borne pathogens that contaminate vegetables is Listeria monocytogenes, a ubiquitous organism that exhibits the ability to survive and multiply at refrigerated temperatures. This study aimed to evaluate the occurrence of L. monocytogenes in vegetables as well as the antimicrobial resistance of isolates. The results showed that 3.03% of samples were contaminated with L. monocytogenes, comprising 2.22% of raw vegetables and 5.56% of ready-to-eat vegetables. Multiplex PCR confirmed the virulence potential of the isolates. Antimicrobial resistance profiling showed that 50% of the isolates were susceptible to the antibiotics used. The resistance of one isolate to penicillin G, a commonly employed therapeutic agent, and the presence of serotype 4b, a serotype commonly associated with food-borne outbreaks, could be potential health hazards for consumers.

Keywords
Vegetables; Food safety; Listeria monocytogenes; Antimicrobial resistance

Gene target	Sequence (5'–3')	Determinant	Amplicon	Amplification conditions	Reference
23S rRNA	F = GGGGAACCCACTATCTTTAGTC R = GGGCCTTTCCAGACCGCTTCA	Genus Listeria	239 bp	95 °C (1 min), 62 °C (1 min), 72 °C (1 min)	Hudson et al. ²⁶26 Hudson JA, Lake RJ, Savill MG, Scholes P, McCormick RE. Rapid detection of Listeria monocytogenes in ham samples using immunomagnetic separation followed by polymerase chain reaction. J Appl Microbiol. 2001;90:614-621.

D1	F = CGATATTTTATCTACTTTGTCA R = TTGCTCCAAAGCAGGGCAT	Division I or III	214 bp	95 °C (30 s), 56 °C (30 s), 72 °C (1 min)	Borucki and Call ²⁷27 Borucki MK, Call DR. Listeria monocytogenes serotype identification by PCR. J Clin Microbiol. 2003;41:5537-5540.

D2	F = GCGGAGAAAGCTATCGCA R = TTGTTCAAACATAGGGCTA	Division II	140 bp	95 °C (30 s), 56 °C (30 s), 72 °C (1 min)	Borucki and Call ²⁷27 Borucki MK, Call DR. Listeria monocytogenes serotype identification by PCR. J Clin Microbiol. 2003;41:5537-5540.

ORF2110	F = AGTGGACAATTGATTGGTGAA R = CATCCATCCCTTACTTTGGAC	Serotype 4b	597 bp	95 °C (1 min), 60 °C (1 min), 72 °C (1 min)	Doumith et al. ²⁸28 Doumith M, Buchrieser C, Glaser P, Jacquet C, Martin P. Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. J Clin Microbiol. 2004;42:3819-3822.

lmo0737	F = AGGGCTTCAAGGACTTACCC R = ACGATTTCTGCTTGCCATTC	L. monocytogenes serovars 1/2a, 1/2c, 3a and 3c	691 bp	95 °C (1 min), 60 °C (1 min), 72 °C(1 min)	Doumith et al. ²⁸28 Doumith M, Buchrieser C, Glaser P, Jacquet C, Martin P. Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. J Clin Microbiol. 2004;42:3819-3822.

lmo1118	F = AGGGGTCTTAAATCCTGGAA R = CGGCTTGTTCGGCATACTTA	L. monocytogenes serovars 1/2c and 3c	906 bp	95 °C (1 min), 60 °C (1 min), 72 °C(1 min)	Doumith et al. ²⁸28 Doumith M, Buchrieser C, Glaser P, Jacquet C, Martin P. Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. J Clin Microbiol. 2004;42:3819-3822.

ORF2819	F = AGCAAAATGCCAAAACTCGT R = CATCACTAAAGCCTCCCATTG	L. monocytogenes serovars 1/2b, 3b, 4b, 4d, and 4e	471 bp	95 °C (1 min), 60 °C (1 min), 72 °C(1 min)	Doumith et al. ²⁸28 Doumith M, Buchrieser C, Glaser P, Jacquet C, Martin P. Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. J Clin Microbiol. 2004;42:3819-3822.

Hly	F = GCCTGCAAGTCCTAAGACGCCAATC R = CTTGCAACTGCTCTTTAGTAACAGC	Listeriolysin O	706 bp	95 °C(1 min), 62 °C (1 min), 72 °C(1 min)	Hudson et al. ²⁶26 Hudson JA, Lake RJ, Savill MG, Scholes P, McCormick RE. Rapid detection of Listeria monocytogenes in ham samples using immunomagnetic separation followed by polymerase chain reaction. J Appl Microbiol. 2001;90:614-621.

Vegetable group	Samples	Positive samples		Origin
	n	n	%
Raw	45	1	2.22	Lettuce (1 sample)
Frozen	33	ND	0.00
Ready-to-eat (salads)	54	3	5.56	Lettuce, beets and purple cabbage (1 sample) Lettuce, beets, purple cabbage and white cabbage (2 samples)

Total	132	4	3.03%

Antimicrobial	Breakpoints (mm)			Isolates (number)
Antimicrobial	Resistant	Intermediate	Susceptible	Resistant	Intermediate	Susceptible
Cefoxitin	≤19	–	≥20	ND	–	4
Ciprofloxacin	≤15	16–20	≥21	ND	ND	4
Erythromycin	≤13	14–22	≥22	ND	ND	4
Streptomycin	≤19	–	≥23	ND	–	4
Oxacillin	≤17	–	≥18	ND	–	4
Penicillin G	≤28	–	≥29	1	–	3
Tetracycline	≤14	15–18	≥19	1	ND	3
Vancomycin	–	–	≥15	ND	–	4

Sociedade Brasileira de Microbiologia USP - ICB III - Dep. de Microbiologia, Sociedade Brasileira de Microbiologia, Av. Prof. Lineu Prestes, 2415, Cidade Universitária, 05508-900 São Paulo, SP - Brasil, Ramal USP 7979, Tel. / Fax: (55 11) 3813-9647 ou 3037-7095 - São Paulo - SP - Brazil
E-mail: bjm@sbmicrobiologia.org.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] *Corresponding author. rogeriac@ufba.br