Safety, beneficial and technological properties of   <i>Enterococcus faecium</i> isolated from Brazilian cheeses

Santos, Karina Maria Olbrich dos; Vieira, Antônio Diogo Silva; Salles, Hévila Oliveira; Oliveira, Jacqueline da Silva; Rocha, Cíntia Renata Costa; Borges, Maria de Fátima; Bruno, Laura Maria; Franco, Bernadette Dora Gombossy de Melo; Todorov, Svetoslav Dimitrov

doi:10.1590/S1517-838246120131245

Karina Maria Olbrich dos Santos

Empresa Brazileira de Pesquisa Agropecuária, Agroindústria de Alimentos, Rio de Janeiro, RJ, Brazil.

Empresa Brazileira de Pesquisa Agropecuária, Caprinos e Ovinos, Sobral, CE, Brazil.

Antônio Diogo Silva Vieira

Empresa Brazileira de Pesquisa Agropecuária, Caprinos e Ovinos, Sobral, CE, Brazil.

Laboratório de Microbiologia de Alimentos, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, São Paulo, SP, Brazil.

Hévila Oliveira Salles

Empresa Brazileira de Pesquisa Agropecuária, Caprinos e Ovinos, Sobral, CE, Brazil.

Jacqueline da Silva Oliveira

Empresa Brazileira de Pesquisa Agropecuária, Caprinos e Ovinos, Sobral, CE, Brazil.

Cíntia Renata Costa Rocha

Departamento de Bioquímica, Laboratorio de Imunopatologia Keizo Asami, Universidade Federal de Pernambuco, Recife, PE, Brazil.

Maria de Fátima Borges

Empresa Brazileira de Pesquisa Agropecuária, Agroindústria Tropical, Fortaleza, CE, Brazil.

Laura Maria Bruno

Empresa Brazileira de Pesquisa Agropecuária, Agroindústria Tropical, Fortaleza, CE, Brazil.

Bernadette Dora Gombossy de Melo Franco

Laboratório de Microbiologia de Alimentos, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, São Paulo, SP, Brazil.

Svetoslav Dimitrov Todorov Send correspondence to S.D. Todorov. Laboratório de Microbiologia de Alimentos, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, São Paulo, SP, Brazil. E-mail: slavi310570@abv.bg.

Laboratório de Microbiologia de Alimentos, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, São Paulo, SP, Brazil.

Send correspondence to S.D. Todorov. Laboratório de Microbiologia de Alimentos, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, São Paulo, SP, Brazil. E-mail: slavi310570@abv.bg.

Associate Editor: Eduardo Cesar Tondo

	Enterococcus faecium EM485	Enterococcus faecium EM925	Primers (5′ - 3′)	Reference
Virulence genes^* * gelE (gelatinase), hyl(hyaluronidase), asa1 (aggregation substance), esp (enterococcal surface protein), cylA (cytolysin), efaA (endocarditis antigen), ace (adhesion of collagen), vanA and vanB (vancomycin resistance), hdc1 and hdc2 (histidine decarboxylase), tdc (tyrosine decarboxylase), and odc (ornithine decarboxylase).
gelE	−	−	TATGACAATGCTTTTTGGGAT AGATGCACCCGAAATAATATA	*Vankerckhoven et al., 2004*Vankerckhoven V, Van Autgaerden T, Vael C, Lammens C et al. (2004) Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium. J Clinic Microbiol 42:4473–4479.
Hyl	−	−	ACAGAAGAGCTGCAGGAAATG GACTGACGTCCAAGTTTCCAA	*Vankerckhoven et al., 2004*Vankerckhoven V, Van Autgaerden T, Vael C, Lammens C et al. (2004) Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium. J Clinic Microbiol 42:4473–4479.
asa1	−	−	GCACGCTATTACGAACTATGA TAAGAAAGAACATCACCACGA	*Vankerckhoven et al., 2004*Vankerckhoven V, Van Autgaerden T, Vael C, Lammens C et al. (2004) Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium. J Clinic Microbiol 42:4473–4479.
Esp	−	−	AGATTTCATCTTTGATTCTTG AATTGATTCTTTAGCATCTGG	*Vankerckhoven et al., 2004*Vankerckhoven V, Van Autgaerden T, Vael C, Lammens C et al. (2004) Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium. J Clinic Microbiol 42:4473–4479.
cylA	−	−	ACTCGGGGATTGATAGGC GCTGCTAAAGCTGCGCTT	*Vankerckhoven et al., 2004*Vankerckhoven V, Van Autgaerden T, Vael C, Lammens C et al. (2004) Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium. J Clinic Microbiol 42:4473–4479.
efaA	−	−	GCCAATTGGGACAGACCCTC CGCCTTCTGTTCCTTCTTTGGC	*Martin-Platero et al., 2009*Martin-Platero AM, Valdivia E, Maqueda M et al.(2009) Characterization and safety evaluation of enterococci isolated from Spanish goats’ milk cheeses. Int J Food Microbiol 132:24–32.
Ace	−	−	GAATTGAGCAAAAGTTCAATCG GTCTGTCTTTTCACTTGTTTC	*Martin-Platero et al., 2009*Martin-Platero AM, Valdivia E, Maqueda M et al.(2009) Characterization and safety evaluation of enterococci isolated from Spanish goats’ milk cheeses. Int J Food Microbiol 132:24–32.
Antibiotic resistance
VanA	−	−	TCTGCAATAGAGATAGCCGC GGAGTAGCTATCCCAGCATT	*Martin-Platero et al., 2009*Martin-Platero AM, Valdivia E, Maqueda M et al.(2009) Characterization and safety evaluation of enterococci isolated from Spanish goats’ milk cheeses. Int J Food Microbiol 132:24–32.
VanB	+	+	GCTCCGCAGCCTGCATGGACA ACGATGCCGCCATCCTCCTGC	*Martin-Platero et al., 2009*Martin-Platero AM, Valdivia E, Maqueda M et al.(2009) Characterization and safety evaluation of enterococci isolated from Spanish goats’ milk cheeses. Int J Food Microbiol 132:24–32.
Biogenic amine
hdc1	−	−	AGATGGTATTGTTTCTTATG AGACCATACACCATAACCTT	*Rivas et al., 2005*Rivas P, Alonso J, Moya J et al. (2005) The impact of hospital-acquired infections on the microbial etiology and prognosis of late-onset prosthetic valve endocarditis Chest 128:764–771.
hdc2	−	−	AAYTCNTTYGAYTTYGARAARGARG ATNGGNGANCCDATCATYTTRTGNCC	*Rivas et al., 2005*Rivas P, Alonso J, Moya J et al. (2005) The impact of hospital-acquired infections on the microbial etiology and prognosis of late-onset prosthetic valve endocarditis Chest 128:764–771.
Tdc	+	+	GAYATNATNGGNATNGGNYTNGAYCARG CCRTARTCNGGNATAGCRAARTCNGTRTG	*Rivas et al., 2005*Rivas P, Alonso J, Moya J et al. (2005) The impact of hospital-acquired infections on the microbial etiology and prognosis of late-onset prosthetic valve endocarditis Chest 128:764–771.
odc	−	−	GTNTTYAAYGCNGAYAARCANTAYTTYGT ATNGARTTNAGTTCRCAYTTYTCNGG	*Rivas et al., 2005*Rivas P, Alonso J, Moya J et al. (2005) The impact of hospital-acquired infections on the microbial etiology and prognosis of late-onset prosthetic valve endocarditis Chest 128:764–771.

Antibiotic	MIC breakpoint recommendation of EUCAST (2011) and EFSA (2008)EFSA (2008) Update of the criteria used in the assessment of bacterial resistance to antibiotics of human or veterinary importance. Prepared by the Panel on Additives and Products or Substances used in Animal Feed. EFSA J 732:1–15. for Enterococcus spp.		Enterococcus faecium EM485	Enterococcus faecium EM925	Sensitivity or resistance

	EUCAST	EFSA
Amoxicillin	S ≤ 4 μg/mL, R ≥ 8 μg/mL	NS	0.12 μg/mL	0.06 μg/mL	S
Amoxicillin/clavulonic acid	S ≤ 4 μg/mL, R ≥ 8 μg/mL	NS	0.12 μg/mL	0.25 μg/mL	S
Ampicillin	S ≤ 4 μg/mL, R ≥ 8 μg/mL	4	0.5 μg/mL	0.12 μg/mL	S
Cefotaxime	NS	NS	0.25 μg/mL	0.25 μg/mL	S
Ceftriaxone	NS	NS	0.12 μg/mL	0.06 μg/mL	S
Ciprofloxacin	NS	NS	-	-	R
Erythromycin		4	0.25 μg/mL	0.5 μg/mL	S
Gentamicin	> 128 μg/mL	R > 32 μg/mL^* * with potential interference form the medium; NS = not specified by cited documents; R = resistant; S = sensitive.	16.0 μg/mL	32.0 μg/mL	S
Imipenem	S ≤ 4 μg/mL, R ≥ 8 μg/mL	NS	0.015 μg/mL	0.015 μg/mL	S
Levofloxacin	NS	NS	8.0 μg/mL	8.0 μg/mL	S
Linezolid	NS	NS	1.0 μg/mL	1.0 μg/mL	S
Meropenem	NS	NS	0.015 μg/mL	0.015 μg/mL	S
Metronidazole	NS	NS	-	-	R
Oxacillin	NS	NS	4.0 μg/mL	4.0 μg/mL	S
Penicillin	NS	NS	1.0 μg/mL	1.0 μg/mL	S
Tetracycline	NS	R > 2 μg/mL	4.0 μg/mL	4.0 μg/mL	R
Vancomycin	S ≤ 4 μg/mL, R > 4 μg/mL	R > 4 μg/mL	-	-	R

Microorganism	Milk’s pH after			Viability^a a Difference between counts at time 0 and after 30 days of cold storage (5 °C) in milk acidified at different pH values. (Δ log cfu/mL) in acidified milk at

	6 h	24 h	48 h	pH 4.0	pH 5.0
E. faeciumEM485	5.8	5.2	4.8	0.6^a a Difference between counts at time 0 and after 30 days of cold storage (5 °C) in milk acidified at different pH values.	0.95^b b Increase of viable cell counts.
E. faeciumEM925	5.3	4.8	4.8	0	0.47^b b Increase of viable cell counts.

[1] Send correspondence to S.D. Todorov. Laboratório de Microbiologia de Alimentos, Faculdade de Ciências Farmacêuticas, Universidade de São Paulo, São Paulo, SP, Brazil. E-mail: slavi310570@abv.bg.

Brasil

Brasil

Safety, beneficial and technological properties of Enterococcus faecium isolated from Brazilian cheeses