Abstract
The main objective of the present study was to isolate and characterize actinomycetes for their plant growth-promotion in chickpea. A total of 89 actinomycetes were screened for their antagonism against fungal pathogens of chickpea by dual culture and metabolite production assays. Four most promising actinomycetes were evaluated for their physiological and plant growth-promotion properties under in vitro and in vivo conditions. All the isolates exhibited good growth at temperatures from 20 °C to 40 °C, pH range of 7–11 and NaCl concentrations up to 8%. These were also found highly tolerant to Bavistin, slightly tolerant to Thiram and Captan (except VAI-7 and VAI-40) but susceptible to Benlate and Ridomil at field application levels and were found to produce siderophore, cellulase, lipase, protease, chitinase (except VAI-40), hydrocyanic acid (except VAI-7 and VAI-40), indole acetic acid and β-1,3-glucanase. When the four actinomycetes were evaluated for their plant growth-promotion properties under field conditions on chickpea, all exhibited increase in nodule number, shoot weight and yield. The actinomycetes treated plots enhanced total N, available P and organic C over the un-inoculated control. The scanning electron microscope studies exhibited extensive colonization by actinomycetes on the root surface of chickpea. The expression profiles for indole acetic acid, siderophore and β-1,3-glucanase genes exhibited up-regulation for all three traits and in all four isolates. The actinomycetes were identified as Streptomyces but different species in the 16S rDNA analysis. It was concluded that the selected actinomycetes have good plant growth-promotion and biocontrol potentials on chickpea.
Keywords
Chickpea; Actinomycetes; PGP; Streptomyces; Biocontrol; Gene expression
Introduction
Chickpea (Cicer arietinum L.) is the second most widely grown food legume crop after common bean, with annual production of 13.8 mt worldwide.11 FAOSTAT. Food and Agriculture Organization Statistical Databases. Rome: Food and Agriculture Organization; 2014. Globally, more than 90% of chickpea production occurs in the semi-arid tropics of Asia and Africa. Asia accounts for 88% of global chickpea production whereas India is the largest producer accounting for 75% of Asia's chickpea production.22 Rao PP, Birthal PS, Bhagavatula S, Bantilan MCS. Chickpea and Pigeonpea Economies in Asia: Facts, Trends and Outlook. Patancheru, Andhra Pradesh, India: International Crops Research Institute for the Semi-Arid Tropics; 2010:76. Several biotic and abiotic factors were involved in low production of chickpea. The biotic factors include fungi, bacteria, viruses, nematodes, mycoplasma and insect pests. Fungi are the largest group affecting stems, roots, leaves, flowers and pods. Chickpea crop is mainly affected by Fusarium wilt, dry root rot, collar rot, Ascochyta blight and Botrytis gray mold caused by Fusarium oxysporum f. sp. ciceri (FOC), Macrophomina phaseolina, Sclerotium rolfsii, Ascochyta rabiei and Botrytis cinerea, respectively resulting in reduced crop yield.3,4
The microbes in rhizosphere help plants in growth-promotion and yield. Actinomycetes are one of the major components of rhizosphere microbial populations and are useful in soil nutrient cycling5,6 as well as plant growth-promotion (PGP).77 Merzaeva OV, Shirokikh IG. Colonization of plant rhizosphere by actinomycetes of different genera. Mikrobiologiia. 2006;75:271-276. Actinomycetes produce secondary metabolites such as lytic enzymes, PGP substances and antibiotics.88 Cattelan AJ, Hartel PG. Traits associated with plant growth-promoting rhizobacteria (PGPR). In: Socieda de Brasileira de Ciência do Solo. Tópicos em ciência do solo. Vicosa: Socieda de Brasileira de Ciência do Solo; 2000:213-234. The actinomycetes, mainly those belonging to Streptomyces spp., make up an important group of soil microbes. Streptomyces are abundant in soil and help in the degradation of complex molecules to simple molecules for plant growth and development.9,10 These are also reported to decompose organic matter, promote plant growth and control plant pathogens.1111 Nassar AH, El-Tarabily KA, Sivasithamparam K. Growth promotion of bean (Phaseolus vulgaris L.) by a polyamine-producing isolate of Streptomyces griseoluteus. Plant Growth Regul. 2003;40:97-106.
In the present study, actinomycetes isolated from rhizosphere and herbal vermicompost were characterized and evaluated for PGP properties and for biocontrol-related traits. The promising strains were also evaluated for their PGP in chickpea under field conditions.
Materials and methods
Actinomycetes isolation
Actinomycetes were isolated from herbal vermicompost (Jatropha curcas, Annona squamosa, Parthenium hysterophorus, Gliricidia sepium and Azadirachta indica) and chickpea rhizosphere soils. Ten grams of each vermicompost and rhizosphere soils were suspended in 90 mL of sterile physiological saline (0.85% NaCl in distilled water) in a bottle and kept for shaking on an orbital shaker (at 100 rpm) at 28 ± 2 °C for 1 h. At the end of shaking, the samples were serially diluted up to 105 dilutions and samples from 104 and 105 dilutions were spread plated (0.1 mL) on actinomycetes isolation (AIA) agar (HiMedia Laboratories, Mumbai, India) and incubated at 28 ± 2 °C for 7 days. Prominent colonies were isolated and stored on AI agar slants.
Selection of antagonistic actinomycetes against fungal pathogens of chickpea
A total of 89 actinomycetes were screened for their antagonistic activity against S. rolfsii, M. phaseolina (three strains viz. MP-6, MP-24 and MP-115) and FOC (acquired from legumes pathology, ICRISAT, Patancheru) by dual culture assay as per the protocols of Gopalakrishnan et al.1212 Gopalakrishnan S, Suresh P, Mamta S, et al. Evaluation of actinomycete isolates obtained from herbal vermicompost for the biological control of Fusarium wilt of chickpea. Crop Prot. 2011;30:1070-1078. on glucose casaminoacid yeast extract agar plates. The culture filtrates of the promising isolates, based on the dual culture assay, were extracted by partitioning against ethyl acetate (EtOAc) and the resultant organic (EtOAc) and aqueous fractions were evaporated on a rotary evaporator and collected in a minimal volume of methanol. Both the fractions were evaluated for their antagonistic potential against the three fungal pathogens of chickpea (M. phaseolina, FOC and S. rolfsii). For this, a fungal disc of 6 mm diameter was bored and kept at center of the potato dextrose agar plate amended with either organic or aqueous fractions (at a concentration of 0.5%). Control plates contained only methanol. The plates were incubated at 28 ± 2 °C for 5 days and inhibition of the pathogen was recorded for both dual culture and metabolite production assays on a scale of 0–4 as follows: 0 = no inhibition; 1 = slight inhibition; 2 = moderate inhibition; 3 = good inhibition and 4 = excellent inhibition.
Colony morphology of selected actinomycetes
Selected isolates of actinomycetes were streaked on AI agar by quadrant streaking technique and incubated for 5 days at 28 ± 2 °C. At the end of incubation, the isolated colonies were observed for their morphology. Gram staining was also performed1313 Aneja KR. Staining methods: Gram staining of bacteria. In: New Age. Experiments in Microbiology Plant Pathology and Biotechnology. New Age International Limited Publishers; 2003:102-106. and observed under light microscope.
Molecular identification of the selected actinomycetes
The selected actinomycetes were sent to Macrogen Inc., Seoul, Korea for identification by 16S rDNA analysis. The sequences obtained from Macrogen were compared with similar sequences from GenBank, compared using the BLAST program,1414 Altschul SF, Gish W,Miller W,Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403-410. aligned using the Clustal W software1515 Thompson JD, Gibson TJ, Plewniak F. Jeanmougin F, Higgins DG. The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876-4882. and the dendrogram inferred by neighbor-joining method.1616 Saitou N, Nei M. The neighbor-joining method: a new metho for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4:406-425. Bootstrap analysis was performed using the MEGA version 4 program to estimate the statistical stability of the branches in cluster with 1000 replications. The sequences (1460 bp for SAI-13, 1474 bp for SAI-291,475 bp for VAI-7 and 1472 bp for VAI-40) were submitted to NCBI and accession numbers obtained.
In vitro evaluation of actinomycetes for their physiological traits and fungicide tolerance
Physiological properties such as tolerance to pH, temperature, salinity and fungicides were studied for the selected actinomycetes. The actinomycetes were streaked on Bennett's agar (HiMedia Laboratories, Mumbai, India), adjusted to different pH (5, 7, 9 and 11) and saline concentrations (0–12% NaCl at the interval of 2%) and incubated at 28 ± 2 °C for 5 days. For temperature, the Bennett's agar plates were streaked with the actinomycetes and incubated at different temperatures (20 °C, 30 °C, and 40 °C) for 5 days. For test at 50 °C, the isolates were inoculated in Bennett's broth and incubated at 50 °C. The fungicide tolerance was evaluated as per the protocols of Gopalakrishnan et al.1717 Gopalakrishnan S, Upadhyaya H, Vadlamud S, et al. Plant growth-promoting traits of biocontrol potential bacteria isolated from rice rhizosphere. Springerplus. 2012;1(1):71. The actinomycetes were streaked on AI agar plates amended with fungicides Bavistin, Thiram, Benlate, Captan and Ridomil at field application levels (2500, 3000, 4000, 3000 and 3000 ppm) and incubated at 28 ± 2 °C for 5 days. At the end of 5 days incubation the growth of the actinomycetes were rated. The rating scale for pH, temperature and salinity were recorded on a scale of 0–3 as follows: 0 = no growth; 1 = slight growth; 2 = moderate growth and 3 = good growth.
Evaluation for production of extracellular enzymes, siderophore, indole acetic acid (IAA) and hydrocyanic acid (HCN)
Selected actinomycetes were evaluated for their PGP and biocontrol traits including siderophore, chitinase, cellulase, lipase, protease, HCN, β-1,3-glucanase and IAA production. Siderophore production was estimated as per the protocol of Schwyn and Neilands.1818 Schwyn B, Neilands JB. Universal chemical assay for the detection and determination of siderophores. Anal Biochem. 1987;160:47-56. Chitinase production was estimated by amending agar plates with colloidal chitin suspension and mineral salts according to the standard protocols of Hsu and Lockwood.1919 Hsu SC, Lockwood JL. Powdered chitin agar as a selective medium for enumeration of actinomycetes in water and soil. Appl Microbiol. 1975;29:422-426. Production of cellulase was detected by using standard protocols of Hendricks et al.2020 Hendricks CW, Doyle JD, Hugley B. A new solid medium for enumerating cellulose-utilizing bacteria in soil. Appl Environ Microbiol. 1995;61:2016-2019. The protease and lipase productions were estimated as per the protocols of Bhattacharya et al.2121 Bhattacharya A, Chandra S, Barik S. Lipase and protease producing microbes from the environment of sugar beet field. Ind J Agric Biochem. 2009;22:26-30. HCN was qualitatively assessed by the method described by Lorck.2222 Lorck H. Production of hydrocyanic acid by bacteria. Plant Physiol. 1948;1:142-146. Estimation of IAA was done as per the protocols of Patten and Glick.2323 Patten CL, Glick BR. Role of Pseudomonas putida indoleacetic acid in development of the host plant root system. Appl Environ Microbiol. 2002;68:3795-3801. The rating scales for siderophore, chitinase, cellulase, lipase and protease were as follows: 0 = no halo zone; 1 = halo zone of 1–10 mm; 2 = halo zone of 11–20 mm; 3 = halo zone of 21–30 mm; 4 = halo zone of 31–40 mm; and 5 = 41–50 mm. For HCN production, the following rating scale was used: 0 = no color change, 1 = light reddish brown, 2 = medium reddish brown and 3 = dark reddish brown.
Evaluation of PGP potential of actinomycetes by “ragdoll” method
Growth-promoting activity was evaluated by the ‘ragdoll' method as described by Chamblee and Green.2424 Chamblee DS, Green JT. Production and utilization of pastures and forages in North Carolina. N C Agric Res Serv Tech Bull. 1995;305:153. In brief, chickpea seeds (ICCV 2) were surface sterilized by using 2.5% sodium hypochlorite solution for 5 min and washed thoroughly with sterilized distilled water. Sterilized seeds were soaked in individual actinomycetes (108 colony forming units (CFU) mL−1) for 1 h and placed in one half of a wet paper towel, folded and rolled into a moderately tight tube and placed in a plastic bag. This tube was kept at (28 ± 2 °C) for 5 days. At the end of incubation, % germination, root and shoot lengths were measured.
Evaluation of PGP potential of actinomycetes under field conditions
The selected actinomycetes were evaluated for PGP potential on chickpea under on-station field conditions in 2013–14 post-rainy season at ICRISAT Patancheru (17°30' N; 78°16' E; altitude = 549 m), Hyderabad, Telangana, India. Chickpea variety ICCV 2 was used for this trial. Soils at the experimental site were of vertisol which contained 25% sand, 21% silt and 52% clay with alkaline pH of 7.5–8.5. The organic C content of this field was 0.56%. The rhizosphere soil (top 15 cm) contained 642 ppm of total N and 9.03 ppm of available P. The experiment was laid out in a randomized complete block design with three replicates with a plot size of 4 m × 3 ridges. The actinomycete cultures were grown in SCB at 28 ± 2 °C for 5 days. Chickpea seeds were treated with the actinomycete cultures (108 CFU mL−1) for 50 min and sown on 2nd November 2013 at a row-to row spacing of 60 cm and a plant-to-plant spacing of 10 cm. The actinomycete cultures (1000 mL; 108 CFU mL−1) were also applied once in 15 days to the soil close to the plant until flowering stage. The control plots contained no actinomycete strains. No serious phytopathogens or insect pest attacks were observed during the cropping period. Irrigation was done on 23 days after sowing (DAS) and 51 DAS whereas weeding on 22 DAS and 49 DAS. At 60 DAS, the nodule number, stem weight, pod number, pod weight, leaf weight and leaf area were noted and compared with un-inoculated control. The crop was harvested manually on 4th Feb 2014 and at harvest, stover yield, grain yield and total dry matter were noted. Rhizosphere soil samples were collected from a depth of 0–15 cm at both flowering (60 DAS) and crop maturity stages and analyzed for total N (ppm), available P (ppm) and organic C % according to the protocols of Novozamsky et al.,2525 Novozamsky I, Houba VJG, van Eck R, van Vark W.A novel digestion technique for multiple element analysis. Commun Soil Sci Plant Anal. 1983;14:239-248. Olsen and Sommers,2626 Olsen SR, Sommers LE. Phosphorus. In: Methods of Soil Analysis, Part2, Chemical and Microbial Properties. Agronomy Monograph No. 9, 2nd ed. Madison, WI, USA: AL Page, American Society of Agronomy; 1982:403-430. and Nelson and Sommers,2727 Nelson DW, Sommers LE. Total organic carbon and organic matter. In: Page AL, Miller RH, Keeney DR, eds. Methods of Soil Analysis. Part 3: Chemical and Microbiological Properties. Madison, WI: Soil Science of America, Inc.; 1982:539-579. respectively and soil biological properties including microbial biomass C, microbial biomass N and dehydrogenase activities as per the protocols of Anderson and Domsch,2828 Anderson TH, Domsch KH. Ratios of microbial biomass carbon to total organic carbon in arable soils. Soil Biol Biochem. 1989;21:471-479. Brooks et al.,2929 Brooks PC, Landman A, Pruden G, Jenkinson DS. Chloroform fumigation and the release of soil nitrogen; a rapid direct extraction method to measure microbial biomass nitrogen in soil. Soil Biol Biochem. 1985;17:837-842. and Casida,3030 Casida LE Jr. Microbial metabolic activity in soil as measured by dehydrogenase determinations. Appl Environ Microbiol. 1977;34:630-636. respectively.
Colonization studies
Chickpea roots were examined for colonization by actinomycetes under scanning electron microscope (SEM) at RUSKA lab, College of Veterinary Science, Rajendranagar, Hyderabad, Telangana, India, as per the protocols of Bozzola and Russell.3131 Bozzola JJ, Russell LD. Electron Microscopy: Principals and Techniques for Biologists. 2nd ed. Sudbury, MA: Jones and Barlett Publishers; 1999:19-24, 54-55, 63-67. For this, the seeds of chickpea (ICCV 2) were surface sterilized as explained earlier and allowed to sproutovernight. The sprouted seeds were soaked in selected actinomycetes for 50 min and transferred carefully into sand tubes containing sterilized coarse sand (50 g). Booster dose of actinomycete (1 mL; 108 CFU mL−1) was applied after 7 days. The tubes were incubated at 24 ± 2 °C in a light chamber with an average illumination of 9600 lx and photosynthetic photon flux of 350 µE m−2 s−1. After two weeks of incubation, chickpea seedlings were taken out and the roots were washed in 0.1 M phosphate buffer. Root tips of 4–5 mm length were cut and fixed in glutaraldehyde (2.5%) in phosphate buffer for 24 h at 4 °C. At the end of 24 h incubation, the root samples were again washed with phosphate buffer, post fixed in osmium tetraoxide (2%) for 4 h and dehydrated using a graded series of ethanol. The dehydrated samples were dried, with a critical-point liquid carbon dioxide as a transition fluid, and adhered onto aluminum specimen mounts with double stick adhesive tape. The mounted samples were coated with gold-palladium in an automated sputter coater (JEOL JFC-1600) and examined under SEM (JOEL-JSM 5600).
Gene expression studies
The selected actinomycetes were grown in Bennett's broth for 72 h. RNA was extracted from actinomycetes by conventional Trizol method.3232 Chomczynski PMackey K. Substitution of chloroform by bromo-chloropropane in the single-step method of RNA isolation. Anal Biochem. 1995;225:163-164. The quality and quantity of RNA was estimated by Nanodrop (Thermo Scientific, USA) and RNA integrity by 2100 Bioanalyzer (Agilent, USA). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed as per the manufacturer's instructions using Applied Biosystems 7500 Real Time PCR System with the SYBR green chemistry (Applied Biosystems, USA). Gene specific primers for IAA, siderophore and β-1,3-glucanase were designed using Primer3 software.3333 Rosen S, Skaletsky HJ. Primer 3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, eds. Bioinformatics Methods and Protocols: Methods in Molecular Biology. Totowa, NJ: Humana Press; 2000:365-386. Primers for IAA (F: GTCACCGGGATCTTCTTCAAC; R: GATGTCGGTGTTCTTGTCCAG); siderophore (F: ATCCTCAACACCCTGGTCTG; R: TCCTTGTACTGGTACGGGACTT) and β-1,3-glucanase (F: CCGAACACCACCTACTCCAC; R: CCAGGTTGAGGATCAGGAAG) were designed from the sequences collected from UniProtKB database (http://www.uniprot.org/uniprot) as described in Gopalakrishnan et al.3434 Gopalakrishnan S, Vadlamudi S, Bandikinda P, et al. Evaluation of Streptomyces strains isolated from herbal vermicompost for their plant growth-promotion traits in rice. Microbiol Res. 2014;169:40-48. RNA polymerase principal sigma factor HrdB (SCO5820) (F: GGTCGAGGTCATCAACAAGC; R: CTCGATGAGGTCACCGAACT) was used as the endogenous control. qRT-PCR reactions and conditions were conducted as described earlier.3434 Gopalakrishnan S, Vadlamudi S, Bandikinda P, et al. Evaluation of Streptomyces strains isolated from herbal vermicompost for their plant growth-promotion traits in rice. Microbiol Res. 2014;169:40-48. PCR reactions were carried out in 10 µL reactions containing 30 ng of first strand cDNA, 1X PCR buffer, 125 mM dNTPs, 1.5 mM MgCl2, 0.2 mM primers and 1 U Taq polymerase and PCR cycle was programmed as, 50 °C for 2 min and denaturation at 95 °C for 10 min followed by 40 cycles of denaturation at 95 °C for 15 s and annealing and extension at 60 °C for 1 min. The data obtained from different PCR runs or cDNA samples was analyzed using the mean of the CT values of the three biological replicates that were normalized to the mean CT values of the endogenous gene. The expression ratios were calculated using the 2− Δ ΔCt method and relative transcription levels were plotted graphically.
Statistical analysis
Data were analyzed by using analysis of variance (ANOVA) technique, by SAS GLM (General Linear Model) procedure (SAS Institute 2002-08, SAS version 9.3) considering isolates and replication as fixed in randomized complete block design. Isolate means were tested for significance and compared using Fisher's protected least significant difference.
Results
Screening for potential actinomycetes
Of the 89 isolates screened for their antagonistic potential against important pathogens of chickpea such as FOC, M. phaseolina and S. rolfsii by dual culture assay, four actinomycetes viz. SAI-13 and SAI-29 (isolated from chickpea rhizosphere), VAI-7 (from A. squamosa vermicompost) and VAI-40 (from J. curcas vermicompost) were found to be most promising. When the culture filtrates of these four isolates were partitioned against EtOAc, by solvent extraction method, only organic fractions were found active. Among the four isolates, the organic fractions of SAI-13 and SAI-29 were found to be potential against all the fungal pathogens (Table 1).
All the four isolates were found to be Gram positive and the colonies showed sporulating aerial mycelium. The colony morphology description of the four isolates is presented (Table 2). Analysis of 16S rDNA sequences by neighbor-joining method revealed that all four isolates matched to Streptomyces spp. (100%). The nucleotide sequences were submitted to GenBank and NCBI accession numbers were obtained as follows: SAI-13: KM220609, SAI-29: KM220608, VAI-7: KM220610; and VAI-40: KM220611 (Fig. 1).
Phylogenetic relationship between VAI-7, VAI-40, SAI-13 and SAI-29 and representative species based on full length 16S rDNA sequences constructed using the neighbor-joining method.
Physiological and biochemical traits of selected actinomycetes
All the four actinomycetes grew between pH 7 and 11, but maximum sporulation was observed at pH 9 while no growth was observed at pH 5. The actinomycete isolates also grew well at temperatures between 20 °C and 40 °C but unable to grow at 50 °C and all isolates tolerated NaCl concentration of 8% (SAI-13 tolerated up to 10%). When the isolates were tested for fungicide tolerance, all the four isolates were found tolerant to Bavistin and susceptible to Benlate and Ridomil whereas two of them, SAI-13 and SAI-29, were found moderately tolerant to Thiram and slightly tolerant to Captan (Table 3).
Under in vitro conditions, all the four actinomycetes were found to produce siderophore, cellulase, lipase, protease, IAA, β-1,3-glucanase, chitinase (except VAI-40) and HCN (except VAI-40 and VAI-7). Of the four isolates, SAI-29 produced higher amounts of HCN, IAA, and β-1,3-glucanasewhile SAI-13 produced higher amounts of lipase and protease (Table 4).
Production of extracellular enzymes and plant growth promoting traits by four actinomycetes.
PGP of chickpea by selected actinomycetes
The effect of actinomycetes on chickpea growth was demonstrated by “ragdoll” method in which all isolates exhibited increase in root (17%) and shoot (3%) lengths when compared with the control. Of the four actinomycetes tested, VAI-7 significantly enhanced both root and shoot lengths whereas VAI-40 and SAI-29 significantly enhanced only root lengths when compared to control (Fig. 2).
Under field conditions, a considerable increase in agronomic and soil mineral properties were observed in actinomycetes treated plots over control plots. At 60 DAS, there was an increase in nodule number (up to 19%), leaf area (up to 27%), pod number (up to 26%), leaf weight (up to 16%), plant height (up to 3%) and stem weight (up to 16%). While at final harvest, the actinomycetes treated plots exhibited enhanced the stover yield (up to 23%), grain yield (up to 20%), total dry matter (up to 17%), seed weight (up to 16%) and seed number (up to 22%) (Table 5). The rhizosphere soil from actinomycetes treated plots enhanced up to 11% of total N, 27% of available P, 8% of organic C, 33% of dehydrogenase activity and 22% of microbial biomass carbon, at flowering stage and 3% of total N, 19% of available P, 11% of organic C, 26% of dehydrogenase activity and 29% of microbial biomass carbon at harvest when compared with the control (Table 6).
Effect of the four actinomycetes on agronomic performance and yield potential of chickpea under field conditions – at crop maturity.
Effect of the four actinomycetes on rhizosphere soil mineral properties of chickpea under field conditions (2013–2014) –at flowering and crop maturity.
Colonization and gene expression studies
Colonization of actinomycetes on chickpea roots was confirmed by images of SEM in actinomycetes treated roots. All the isolates exhibited good colonization on chickpea roots without any damage to root surface. The hyphae of Streptomyces were also seen to grow and adhere to the surface of the root (Fig. 3).
In PGP gene expression profile studies, good quality RNA was isolated from all the four actinomycete strains. qRT-PCR analysis on selected PGP genes of actinomycetes revealed up-regulation of all the three genes and on all the four actinomycetes. β-1,3-Glucanase gene was highly up-regulated in SAI-29 (5 folds) followed by VAI-7, VAI-40 and SAI-13 while IAA gene was highly up-regulated in SAI-13 (4 folds) followed by VAI-7, VAI-40 and SAI-29. Siderophore gene was highly up-regulated in SAI-13 (1 fold) followed by SAI-29, VAI-7 and VAI-40 (Fig. 4).
Expression profile of IAA, β-1,3-glucanase and siderophore genes of four actinomycetes strains.
Discussion
Actinomycetes are used for PGP and biocontrol of plant pathogens in agriculture. For instance, Streptomyces spp. were reported to enhance PGP of crops such as tea,3535 Phukan I, Madhab M, Bordoloi M, et al. Exploitation of PGP microbes of tea for improvement of plant growth and pest suppression: a novel approach. Twc Bud. 2012;59:69-74. wheat,3636 Hamdali H, Hafidi M, Virolle MJ, Ouhdouch Y.Rock phosphate-solubilizing Actinomycetes: screening for plant growth-promoting activities. World J Microbiol Biotechnol. 2008;24:2565-2575. rice,3434 Gopalakrishnan S, Vadlamudi S, Bandikinda P, et al. Evaluation of Streptomyces strains isolated from herbal vermicompost for their plant growth-promotion traits in rice. Microbiol Res. 2014;169:40-48. bean,1111 Nassar AH, El-Tarabily KA, Sivasithamparam K. Growth promotion of bean (Phaseolus vulgaris L.) by a polyamine-producing isolate of Streptomyces griseoluteus. Plant Growth Regul. 2003;40:97-106. tomato3737 El-Tarabily KA. Promotion of tomato (Lycopersi conesculentum Mill.) plant growth by rhizosphere competent 1-aminocyclo propane-1-carboxylic acid deaminase-producing Streptomycete actinomycetes. Plant Soil. 2008;308:161-174. and pea.3838 Tokala RK, Strap JL, Jung CM, et al. Novel plant-microbe rhizosphere interaction involving Streptomyces lydicus WYEC108 and the pea plant (Pisum sativum). Appl Environ Microbiol. 2002;68:2161-2171. In the present study, when the 89 actinomycetes screened for their antagonistic potentials against important fungal pathogens of chickpea. Of which, four isolates (SAI-13, SAI-29, VAI-7 and VAI-40) were found to be promising. There was no inhibition of S. rolfsii by SAI-29 in dual culture assay however, when the pathogen reached the antagonist the growth of the pathogen was arrested. Hence, SAI-29 was further selected for metabolite production assay in which the organic fraction was found to be effective in controlling S. rolfsii. Similarly, VAI-40 was found to be effective in dual culture assay while not effective in metabolite production assay, perhaps the metabolite produced was of volatile in nature. Of the four isolates, SAI-13 and SAI-29 were found to have broad spectrum inhibition against all tested pathogens of chickpea. These four isolates found to vary in their shape, elevation, opacity, margins, color and size. Molecular identification of the four isolates, based on their 16S rDNA sequence analysis, revealed that all actinomycetes belong to Streptomyces spp. Similar observations were noted by Araújo3939 Araújo JM. Strategies for selective isolation of actinomycetes. In: Melo IS, Azevedo JL, eds. Microbial Ecology. Jaguariuna: EMBRAPA - CNPMA;1998:351-367. where he observed Streptomyces as dry, smooth or hairy colonies with airborne mycelium of different colors. However, these phenotypic characteristics of Streptomyces vary with the composition of the culture medium.4040 Cross T. Growth and examination of actinomycetes: some guidelines. In: Williams ST, Sharpe ME, Holt JG, eds. Bergey's Manual of Systematic Bacteriology. Baltimore: Williams and Wilkins; 1989:2340-2343.
In the present investigation, all the Streptomyces strains grew well at temperatures 20 °C to 40 °C, an alkaline pH of 11 and saline concentrations of up to 8%. Hence, it can be concluded that the Streptomyces isolates used in this study can be used in semi-arid tropics, alkaline and saline soils. The distribution of Streptomyces spp. in diverse ecosystems is one of the main reasons for ability to adapt to a wide range of environmental conditions, allowing them to survive in high temperatures, saline, acidic and alkaline soils.3939 Araújo JM. Strategies for selective isolation of actinomycetes. In: Melo IS, Azevedo JL, eds. Microbial Ecology. Jaguariuna: EMBRAPA - CNPMA;1998:351-367. These traits help the Streptomyces spp. in competing with the native microflora when introduced into the rhizosphere of the host.4141 Habe MH, Uesughi CH. An in vitro method for evaluating the ability of bacteria colonizing on tomato roots. Braz Phytopathol. 2000;25:657-660. The salinity and pH levels of the rhizosphere soil are important factors for the microbes to compete and survive in rhizosphere. Therefore, the tolerance for high salinity and pH should be the criteria for selection of microorganisms.4242 Drozdowicz AG. Microbiologia do solo. In: Roitman I, Travassos LR, Azevedo JL, eds. Tratado de microbiologia. São Paulo: Manole; 1987:17-28.
In this study, all the four Streptomyces spp. were tolerant to Bavistin whereas SAI-13 and SAI-29 were tolerant to Thiram and Captan at field application levels. These fungicides were generally used to control soilborne fungal pathogens. Hence, it is concluded that the four Streptomyces spp. are compatible with Bavistin, Thiram and Captan and hence can be treated together on the seeds to control soil borne fungal pathogens and thus reducing the use of fungicides in controlling pathogens.
The selected four Streptomyces spp. possess biocontrol as well as PGP properties such as production of IAA, siderophore, β-1,3-glucanase, lipase, protease, cellulase, chitinase (except VAI-40) and HCN (except VAI-7 and VAI-40). IAA is a phytohormone which comes under auxins group and helps in improving plant growth by stimulating cell elongation, root initiation, seed germination and seedling growth.4343 El-Tarabily KA, Nassar AH, Hardy GE, Sivasithamparam K. Plant growth promotion and biological control of Pythium aphanidermatum, a pathogen of cucumber, by endophytic actinomycetes. J Appl Microbiol. 2009;106:13-26. Siderophores are usually produced by various soil microbes including Streptomyces spp. to bind Fe3+ from the environment and make it available for its own growth; plants also utilize these as an iron source.4444 Wang Y,Brown HN, Crowley DE, Szaniszlo PJ. Evidence for direct utilization of a siderophore, ferrioxamine B, in axenically grown cucumber. Plant Cell Environ. 1993;16:579-585.Streptomyces spp. from rhizosphere soil has been reported to produce siderophores and inhibit the growth of phytopathogens.3838 Tokala RK, Strap JL, Jung CM, et al. Novel plant-microbe rhizosphere interaction involving Streptomyces lydicus WYEC108 and the pea plant (Pisum sativum). Appl Environ Microbiol. 2002;68:2161-2171. HCN production is also reported to play a role in disease suppression.4545 Wei G, Kloepper JW, SadikT. Induction of systemic resistance of cucumber to Colletotrichum orbiculare by selected strains of plant growth promoting rhizobacteria. Phytopathology. 1991;81:1508-1512. Some of the recent studies indicated that metabolites produced by microbes such as HCN may enhance plant establishment in rhizosphere.4646 Bhosale HJ, Kadam TA. Generic diversity and a comparative account on plant growth promoting characteristics of actinomycetes in roots and rhizosphere of Saccharum officinarum. Int J Curr Microbiol Appl Sci. 2015;4:230-244. The isolates from the rhizosphere soil of chickpea were observed to exhibit HCN production potential which promoted plant growth directly or indirectly or synergistically.4747 Joseph B, Patra RR, Lawrence R. Characterization of plant growth promoting rhizobacteria associated with chickpea (Cicer arietinum L). IntJ Plant Prod. 2007;1:141-152. Suwan et al.4848 Suwan N, Boonying W,Nalumpang S. Antifungal activity of soil actinomycetes to control chilli anthracnose caused by Colletotrichum gloeosporioides. J Agric Technol. 2012;8:725-737. proposed that actinomycetes act as potential as biological control agents because of its intense antagonistic activity via the production of various antifungal substances such as chitinase and β-1,3-glucanase.
In the present investigation, the effect of the four Streptomyces spp. on the growth of chickpea seedlings was studied by “ragdoll” method, in which VAI-7 exhibited maximum increase in shoot and root lengths. This observation was further confirmed in the field trials. Under field conditions, the Streptomyces spp. increased nodule number over un-inoculated control demonstrating a direct proof for enhancing nitrogen fixation. The Streptomyces strains used in this study exhibited increase in agronomic properties such as the shoot weight, leaf weight, leaf area, plant height, grain yield and stover yield over the un-inoculated control. They also increased the total N, available P, organic C %, microbial biomass C, microbial biomass N and dehydrogenase properties in plots treated with Streptomyces spp. The phosphate mineralization is mainly provided by phosphatases or phosphohydrolases. These enzymes convert the unavailable phosphate to available form by slow mineralization of phytic acid and poly phosphates.4949 Rodríguez H, Fraga R. Phosphate solubilizing bacteria and their role in plant growth promotion. Biotechnol Adv. 1999;17:319-339. In the present study all the actinomycetes produced lytic enzymes indicating their ability to convert complex molecules to simpler available forms, which may be attributed to the increased levels of total N and available P in the inoculated plots. The substrate used in measuring the dehydrogenase activity is 2,3,5 triphenyltetrazolium chloride (TTC) and was converted to triphenylformazan (TPF) by the action of dehydrogenase, which is directly proportional to the number of microorganisms in soil.2828 Anderson TH, Domsch KH. Ratios of microbial biomass carbon to total organic carbon in arable soils. Soil Biol Biochem. 1989;21:471-479. In the present study, all the plots exhibited increase in TPF concentration when compared with the un-inoculated control plots indicates that the Streptomyces spp. applied in the field were able to survive in the rhizosphere and confer PGP. Among the four strains of Streptomyces used in this study, VAI-7 was found to enhance highest grain yield and total dry matter (by 20% and 17%, respectively). The enhancement in yield by VAI-7 could be its both direct and indirect PGP traits including IAA, siderophore, chitinase, cellulase, lipase, β-1,3-glucanase and protease (Table 4). Further, as mentioned earlier, VAI-7 also enhanced highest shoot as well as root lengths of chickpea seedlings (Fig. 2). VAI-7 was also found to enhance greatly soil biological and mineral nutrient properties including microbial biomass carbon, dehydrogenase, total N, available P and organic carbon (Table 6). Hence, the Streptomyces strain VAI-7 could be exploited for its PGP and yield enhancement traits.
The SEM images, in this study, showed that all the four Streptomyces strains colonized the roots of chickpea without causing any damage. Compounds such as aromatic and phenolic compounds, sugars, amino acids, organic acids and carbohydrates from root exudates acts as chemo attractants that helps in root colonization.50,51 Colonization accounts to the proliferation of microbes but not their movement.11 FAOSTAT. Food and Agriculture Organization Statistical Databases. Rome: Food and Agriculture Organization; 2014. Weller5252 Weller DM. Biologica control of soil-borne plant pathogens in the rhizosphere with bacteria. Annu Rev Phytopathol. 1988;26:379-407. reported that a microorganism that colonizes root is ideal for use as biocontrol as well as plant growth-promoting agents.5353 YoussefYA, El-Tarabily KA, Hussein AM. Plectosporium tabacinum root rot disease of white lupine (Lupinus termis Forsk.) and its biological control by Streptomyces species. J Phytopathol. 2001;1490:29-33. Actinomycetes strains like Micromonospora spp., Streptomyces spp., Streptosporangium spp., and Thermobifida spp., were reported as best to colonize the plant rhizosphere, showing an immense potentiality as biocontrol agent against wide range of root pathogenic fungi.5454 Franco-Correa M, Quintana A, Duque C, Suarez C, Rodriguez MX, Jose-Miguel B. Evaluation of actinomycete strains for key traits related with plant growth promotion and mycorrhiza helping activities. Appl Soil Ecol. 2010;45:209-217. Association of actinomycetes confers many advantages to plants like production of antibiotics, extracellular enzymes, phytohormones, siderophores and phosphate solubilization, protects plant against biotic and abiotic stress.5555 Bailey BA, Bae H, Strem MD, et al. Fungal and plant gene expression during the colonization of cacao seedlings by endophytic isolates of four Trichoderma species. Planta. 2006;224:1449-1464. It is concluded that all the tested Streptomyces strains not only colonized on the roots but also proliferated and enhanced PGP in chickpea. In the present study, gene expression studies for IAA, siderophore and β-1,3-glucanase genes exhibited up-regulation of the three genes, supporting the biochemical results. The importance of gene expression has been widely recognized in gene function.5656 Muto H, Watahiki MK, Yamamoto KT. What makes each aux/IAA gene unique in its gene family, expression pattern or properties of the gene product? Plant Signal Behav. 2007;2:390-392.
-
Associate Editor: Jerri Édson Zilli
Acknowledgements
We thank Council of Scientific and Industrial Research, New Delhi, India, for the financial support provided to M Sreevidya during her PhD. This work was undertaken as part of the CGIAR Research Program on Grain Legumes. ICRISAT is a member of CGIAR Consortium. We would also like to thank ICRISAT and all of the staff members of the biocontrol unit, including Alekhya G, Satya A, Prasad PVS, Manohar P, Nagappa B, Bharath D and Jabbar A for their significant inputs in the laboratory and field experiments.
References
-
1FAOSTAT. Food and Agriculture Organization Statistical Databases Rome: Food and Agriculture Organization; 2014.
-
2Rao PP, Birthal PS, Bhagavatula S, Bantilan MCS. Chickpea and Pigeonpea Economies in Asia: Facts, Trends and Outlook Patancheru, Andhra Pradesh, India: International Crops Research Institute for the Semi-Arid Tropics; 2010:76.
-
3Akhtar MS, Siddiqui ZA. Effect of AM fungi on plant growth and root-rot diseases of chickpea. Am Eurasian J Agric Environ Sci 2010;8:544-549.
-
4Sharma M, Mangla UN, Krishnamurthy M, Vedez V,Pande S. Drought and Dry Root Rot of Chickpea Paper presented in 5th International Food Legumes Research Conference (IFLRCV) and European conference on Grain Legumes; 2010:26-30.
-
5Halder AK, Mishra AK, Chakarbarty PK. Solubilization of inorganic phosphates by Bradyrhizobium. Indian J Exp Biol 1991;29:28-31.
-
6Elliot LF, Lynch JM. The international workshop on establishment of microbial inocula in soils: cooperative research project on biological resource management of the organization for economic cooperation and development (OECD). Am J Altern Agric 1995;10:50-73.
-
7Merzaeva OV, Shirokikh IG. Colonization of plant rhizosphere by actinomycetes of different genera. Mikrobiologiia. 2006;75:271-276.
-
8Cattelan AJ, Hartel PG. Traits associated with plant growth-promoting rhizobacteria (PGPR). In: Socieda de Brasileira de Ciência do Solo Tópicos em ciência do solo Vicosa: Socieda de Brasileira de Ciência do Solo; 2000:213-234.
-
9Petrosyan P, García-Varela M, Luz-Madrigal A, Huitrón C, Flores ME. Streptomyces mexicanus sp. nov., a xylanolytic micro-organism isolated from soil. Int J Syst Evol Microbiol 2003;53(Pt 1):269-273.
-
10Ding CH, Jiang ZQ, Li XT, Li LT, Kusakabe I. High activity xilanase production by Streptomyces olivaceoviridis E-86. World J Microbiol Biotechnol 2004;20:7-10.
-
11Nassar AH, El-Tarabily KA, Sivasithamparam K. Growth promotion of bean (Phaseolus vulgaris L.) by a polyamine-producing isolate of Streptomyces griseoluteus Plant Growth Regul 2003;40:97-106.
-
12Gopalakrishnan S, Suresh P, Mamta S, et al. Evaluation of actinomycete isolates obtained from herbal vermicompost for the biological control of Fusarium wilt of chickpea. Crop Prot 2011;30:1070-1078.
-
13Aneja KR. Staining methods: Gram staining of bacteria. In: New Age. Experiments in Microbiology Plant Pathology and Biotechnology New Age International Limited Publishers; 2003:102-106.
-
14Altschul SF, Gish W,Miller W,Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol 1990;215:403-410.
-
15Thompson JD, Gibson TJ, Plewniak F. Jeanmougin F, Higgins DG. The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 1997;25:4876-4882.
-
16Saitou N, Nei M. The neighbor-joining method: a new metho for reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406-425.
-
17Gopalakrishnan S, Upadhyaya H, Vadlamud S, et al. Plant growth-promoting traits of biocontrol potential bacteria isolated from rice rhizosphere. Springerplus 2012;1(1):71.
-
18Schwyn B, Neilands JB. Universal chemical assay for the detection and determination of siderophores. Anal Biochem 1987;160:47-56.
-
19Hsu SC, Lockwood JL. Powdered chitin agar as a selective medium for enumeration of actinomycetes in water and soil. Appl Microbiol 1975;29:422-426.
-
20Hendricks CW, Doyle JD, Hugley B. A new solid medium for enumerating cellulose-utilizing bacteria in soil. Appl Environ Microbiol 1995;61:2016-2019.
-
21Bhattacharya A, Chandra S, Barik S. Lipase and protease producing microbes from the environment of sugar beet field. Ind J Agric Biochem 2009;22:26-30.
-
22Lorck H. Production of hydrocyanic acid by bacteria. Plant Physiol 1948;1:142-146.
-
23Patten CL, Glick BR. Role of Pseudomonas putida indoleacetic acid in development of the host plant root system. Appl Environ Microbiol 2002;68:3795-3801.
-
24Chamblee DS, Green JT. Production and utilization of pastures and forages in North Carolina. N C Agric Res Serv Tech Bull 1995;305:153.
-
25Novozamsky I, Houba VJG, van Eck R, van Vark W.A novel digestion technique for multiple element analysis. Commun Soil Sci Plant Anal 1983;14:239-248.
-
26Olsen SR, Sommers LE. Phosphorus. In: Methods of Soil Analysis, Part2, Chemical and Microbial Properties. Agronomy Monograph No. 9, 2nd ed. Madison, WI, USA: AL Page, American Society of Agronomy; 1982:403-430.
-
27Nelson DW, Sommers LE. Total organic carbon and organic matter. In: Page AL, Miller RH, Keeney DR, eds. Methods of Soil Analysis. Part 3: Chemical and Microbiological Properties Madison, WI: Soil Science of America, Inc.; 1982:539-579.
-
28Anderson TH, Domsch KH. Ratios of microbial biomass carbon to total organic carbon in arable soils. Soil Biol Biochem 1989;21:471-479.
-
29Brooks PC, Landman A, Pruden G, Jenkinson DS. Chloroform fumigation and the release of soil nitrogen; a rapid direct extraction method to measure microbial biomass nitrogen in soil. Soil Biol Biochem 1985;17:837-842.
-
30Casida LE Jr. Microbial metabolic activity in soil as measured by dehydrogenase determinations. Appl Environ Microbiol 1977;34:630-636.
-
31Bozzola JJ, Russell LD. Electron Microscopy: Principals and Techniques for Biologists 2nd ed. Sudbury, MA: Jones and Barlett Publishers; 1999:19-24, 54-55, 63-67.
-
32Chomczynski PMackey K. Substitution of chloroform by bromo-chloropropane in the single-step method of RNA isolation. Anal Biochem 1995;225:163-164.
-
33Rosen S, Skaletsky HJ. Primer 3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, eds. Bioinformatics Methods and Protocols: Methods in Molecular Biology Totowa, NJ: Humana Press; 2000:365-386.
-
34Gopalakrishnan S, Vadlamudi S, Bandikinda P, et al. Evaluation of Streptomyces strains isolated from herbal vermicompost for their plant growth-promotion traits in rice. Microbiol Res 2014;169:40-48.
-
35Phukan I, Madhab M, Bordoloi M, et al. Exploitation of PGP microbes of tea for improvement of plant growth and pest suppression: a novel approach. Twc Bud 2012;59:69-74.
-
36Hamdali H, Hafidi M, Virolle MJ, Ouhdouch Y.Rock phosphate-solubilizing Actinomycetes: screening for plant growth-promoting activities. World J Microbiol Biotechnol 2008;24:2565-2575.
-
37El-Tarabily KA. Promotion of tomato (Lycopersi conesculentum Mill.) plant growth by rhizosphere competent 1-aminocyclo propane-1-carboxylic acid deaminase-producing Streptomycete actinomycetes. Plant Soil 2008;308:161-174.
-
38Tokala RK, Strap JL, Jung CM, et al. Novel plant-microbe rhizosphere interaction involving Streptomyces lydicus WYEC108 and the pea plant (Pisum sativum). Appl Environ Microbiol 2002;68:2161-2171.
-
39Araújo JM. Strategies for selective isolation of actinomycetes. In: Melo IS, Azevedo JL, eds. Microbial Ecology. Jaguariuna: EMBRAPA - CNPMA;1998:351-367.
-
40Cross T. Growth and examination of actinomycetes: some guidelines. In: Williams ST, Sharpe ME, Holt JG, eds. Bergey's Manual of Systematic Bacteriology Baltimore: Williams and Wilkins; 1989:2340-2343.
-
41Habe MH, Uesughi CH. An in vitro method for evaluating the ability of bacteria colonizing on tomato roots. Braz Phytopathol 2000;25:657-660.
-
42Drozdowicz AG. Microbiologia do solo. In: Roitman I, Travassos LR, Azevedo JL, eds. Tratado de microbiologia São Paulo: Manole; 1987:17-28.
-
43El-Tarabily KA, Nassar AH, Hardy GE, Sivasithamparam K. Plant growth promotion and biological control of Pythium aphanidermatum, a pathogen of cucumber, by endophytic actinomycetes. J Appl Microbiol 2009;106:13-26.
-
44Wang Y,Brown HN, Crowley DE, Szaniszlo PJ. Evidence for direct utilization of a siderophore, ferrioxamine B, in axenically grown cucumber. Plant Cell Environ 1993;16:579-585.
-
45Wei G, Kloepper JW, SadikT. Induction of systemic resistance of cucumber to Colletotrichum orbiculare by selected strains of plant growth promoting rhizobacteria. Phytopathology 1991;81:1508-1512.
-
46Bhosale HJ, Kadam TA. Generic diversity and a comparative account on plant growth promoting characteristics of actinomycetes in roots and rhizosphere of Saccharum officinarum. Int J Curr Microbiol Appl Sci 2015;4:230-244.
-
47Joseph B, Patra RR, Lawrence R. Characterization of plant growth promoting rhizobacteria associated with chickpea (Cicer arietinum L). IntJ Plant Prod. 2007;1:141-152.
-
48Suwan N, Boonying W,Nalumpang S. Antifungal activity of soil actinomycetes to control chilli anthracnose caused by Colletotrichum gloeosporioides. J Agric Technol 2012;8:725-737.
-
49Rodríguez H, Fraga R. Phosphate solubilizing bacteria and their role in plant growth promotion. Biotechnol Adv 1999;17:319-339.
-
50Kloepper J, Tuzun S, Kuc J. Proposed definitions related to induced disease resistance. Biocontrol Sci Technol 1992;2:347-349.
-
51van Overbeek LS, van Elsas JD. Root exudates-induced promoter activity in Pseudomonas fluorescens mutants in the wheat rhizosphere. Appl Environ Microbiol 1995;61:890-898.
-
52Weller DM. Biologica control of soil-borne plant pathogens in the rhizosphere with bacteria. Annu Rev Phytopathol 1988;26:379-407.
-
53YoussefYA, El-Tarabily KA, Hussein AM. Plectosporium tabacinum root rot disease of white lupine (Lupinus termis Forsk.) and its biological control by Streptomyces species. J Phytopathol 2001;1490:29-33.
-
54Franco-Correa M, Quintana A, Duque C, Suarez C, Rodriguez MX, Jose-Miguel B. Evaluation of actinomycete strains for key traits related with plant growth promotion and mycorrhiza helping activities. Appl Soil Ecol 2010;45:209-217.
-
55Bailey BA, Bae H, Strem MD, et al. Fungal and plant gene expression during the colonization of cacao seedlings by endophytic isolates of four Trichoderma species. Planta 2006;224:1449-1464.
-
56Muto H, Watahiki MK, Yamamoto KT. What makes each aux/IAA gene unique in its gene family, expression pattern or properties of the gene product? Plant Signal Behav 2007;2:390-392.
Publication Dates
-
Publication in this collection
Jan-Mar 2016
History
-
Received
19 Apr 2015 -
Accepted
17 Aug 2015