In-house quantitative real-time PCR for the diagnosis of hepatitis B virus and hepatitis C virus infections

Zauli, Danielle Alves Gomes; Menezes, Carla Lisandre Paula de; Oliveira, Cristiane Lommez de; Mateo, Elvis Cristian Cueva; Ferreira, Alessandro Clayton de Souza

doi:10.1016/j.bjm.2016.07.008

Acessibilidade / Reportar erro

Brasil

Brazilian Journal of Microbiology

Español English

Brasil

Español English

sumário « anterior atual seguinte »

Sumário

Genetics and Molecular Microbiology • Braz. J. Microbiol. 47 (4) • Oct-Dec 2016 • https://doi.org/10.1016/j.bjm.2016.07.008 copy

In-house quantitative real-time PCR for the diagnosis of hepatitis B virus and hepatitis C virus infections

Authorship SCIMAGO INSTITUTIONS RANKINGS

Abstract

The quantification of viral nucleic acids in serum by real-time PCR plays an important role in diagnosing hepatitis B virus and hepatitis C virus infection. In this study, we developed an assay using specific primers and probes to quantify hepatitis B virus DNA or hepatitis C virus RNA in serum from infected patients. For standardization and validation of the assay, an international panel of hepatitis B virus/hepatitis C virus and standard plasmids was used. A correlation coefficient of 0.983 and 0.963 for hepatitis B virus and hepatitis C virus, respectively, was obtained based on cycle threshold values and concentrations of DNA or RNA. The standard curve showed a linear relationship from 19 IU/mL to 1.9 × 10⁹ IU/mL of serum, with a coefficient of determination (r²) of 0.99. In sera from patients infected with hepatitis B virus or hepatitis C virus viral loads (19 IU/mL and 1.9 × 10⁹ IU/mL), we quantified viral loads with a detection limit of 1.9 × 10² IU/mL. The real-time quantitative PCR assay developed in this study provides an ideal system for routine diagnosis and confirmation of indeterminate serological results, especially in immunosuppressed patients.

Keywords:
qPCR; Hepatitis B; Hepatitis C

Virus	Gene	Sequences of primers and probes (5'-3')	Amplicon size (base pairs)	Reference
HBV	S gene	^a a Forward primer. FW: CCTGGYTATCGYTGGATGTGT ^b b Reverse primer. RV: GGACAVACGKGCAACATACCTT Probe: 6FAM CTATGCCTCATCTTCTT MGB NFQ	116	¹⁷17 Sitnik R, Paes A, Mangueira CP, Pinho JR. A real-time quantitative assay for hepatitis B DNA virus (HBV) developed to detect all HBV genotypes. Rev Inst Med Trop. 2010;52:119-124.
HCV	Non-coding region	FW: AGCGTCTAGCCATGGCGTT RV: GCAAGCACCCTATCAGGCAGT Probe: FAM TCTGCGGAACCGGTGAGT MGB NFQ	238	¹⁸18 Clancy A, Crowley B, Niesters H, Herra C. The development of a qualitative real-time RT-PCR assay for the detection of hepatitis C virus. Eur J Clin Microbiol Infect Dis. 2008;27:1177-1182.

International standard	Primer concentration FW/RV	Ct value	Slope value
HBV 7^a a Viral load: 5,000,000 IU/mL (HBV 7/HCV 7).	50 nM/50 nM	28.86785507	−1.0434
50 nM/300 nM	26.90498924
50 nM/900 nM	26.2933445
300 nM/50 nM	25.48120117
300 nM/300 nM	23.62826729
300 nM/900 nM	23.69248581
HBV 2^b b Viral load: 50 IU/mL (HBV 2/HCV 2).	50 nM/50 nM	37.58005905	1.4634
50 nM/300 nM	39.04344177
50 nM/900 nM	Undetermined
300 nM/50 nM	Undetermined
300 nM/300 nM	Undetermined
300 nM/900 nM	Undetermined
HCV 7^a a Viral load: 5,000,000 IU/mL (HBV 7/HCV 7).	50 nM/50 nM	29.46348	0.7627
50 nM/300 nM	29.3045578
50 nM/900 nM	28.48422432
300 nM/50 nM	28.22242737
300 nM/300 nM	31.08761597
300 nM/900 nM	33.78520966
HCV 2^b b Viral load: 50 IU/mL (HBV 2/HCV 2).	50 nM/50 nM	Undetermined	Undetermined
50 nM/300 nM	36.86901855
50 nM/900 nM	Undetermined
300 nM/50 nM	Undetermined
300 nM/300 nM	Undetermined
300 nM/900 nM	Undetermined

Sociedade Brasileira de Microbiologia USP - ICB III - Dep. de Microbiologia, Sociedade Brasileira de Microbiologia, Av. Prof. Lineu Prestes, 2415, Cidade Universitária, 05508-900 São Paulo, SP - Brasil, Ramal USP 7979, Tel. / Fax: (55 11) 3813-9647 ou 3037-7095 - São Paulo - SP - Brazil
E-mail: bjm@sbmicrobiologia.org.br

Acompanhe os números deste periódico no seu leitor de RSS

[1] *Corresponding author at: Departamento de Pesquisa e Desenvolvimento, Instituto Hermes Pardini, Belo Horizonte, Av. Nac¸ões, 2448,Portaria A, Distrito Industrial 33200-000, Belo Horizonte, MG, Brazil. E-mail: danielle.zauli@hermespardini.com.br (D.A. Zauli).