Open-access Distribution of HCV genotypes among different exposure categories in Brazil

Abstract

Hepatitis C virus (HCV) infection is widespread and responsible for more than 60% of chronic hepatitis cases. HCV presents a genetic variability which has led to viral classification into at least 6 genotypes and a series of subtypes. These variants present characteristic geographical distribution, but their association with different responses to treatment with interferon and severity of disease still remains controversial. The aim of this study was to investigate the patterns of distribution of HCV genotypes among different exposure categories in Brazil. Two hundred and fifty anti-HCV positive samples were submitted to HCV-RNA detection by RT-PCR and their genotype was determined by restriction fragment length polymorphism (RFLP) analysis. In addition, the genotype/subtype of 60 samples was also determined by a reverse hybridization assay. HCV 1 was the most prevalent (72.0%), followed by type 3 (25.3%), HCV 2 (2.0%) and HCV 4 (0.7%). The HCV genotype distribution varied among the different exposure categories, with HCV 1 being more frequent among blood donors, hemophiliacs and hemodialysis patients. A high frequency of HCV 3 was observed in cirrhotic patients, blood donors from the South of Brazil and injecting drug users (IDUs). The general distribution of the HCV genotype in Brazil is similar to that in other regions of the world.

HCV; HCV genotypes; Brazil


Braz J Med Biol Res, March 1999, Volume 32(3) 279-282 (Short Communication)

Distribution of HCV genotypes among different exposure categories in Brazil

M.L.A. Oliveira1, F.I. Bastos2, R.R. Sabino1, U. Paetzold1, E. Schreier3, G. Pauli3 and C.F.T. Yoshida1

1Laboratório de Hepatites Virais, Departamento de Virologia, Instituto Oswaldo Cruz, and 2Centro de Informação em Ciência e Tecnologia, Fundação Oswaldo Cruz, Rio de Janeiro, RJ, Brasil

3Department of Virology, Robert Koch Institute, Berlin, Germany

Text

References

Abstract

Correspondence and FootnotesCorrespondence and FootnotesCorrespondence and Footnotes

Hepatitis C virus (HCV) infection is widespread and responsible for more than 60% of chronic hepatitis cases. HCV presents a genetic variability which has led to viral classification into at least 6 genotypes and a series of subtypes. These variants present characteristic geographical distribution, but their association with different responses to treatment with interferon and severity of disease still remains controversial. The aim of this study was to investigate the patterns of distribution of HCV genotypes among different exposure categories in Brazil. Two hundred and fifty anti-HCV positive samples were submitted to HCV-RNA detection by RT-PCR and their genotype was determined by restriction fragment length polymorphism (RFLP) analysis. In addition, the genotype/subtype of 60 samples was also determined by a reverse hybridization assay. HCV 1 was the most prevalent (72.0%), followed by type 3 (25.3%), HCV 2 (2.0%) and HCV 4 (0.7%). The HCV genotype distribution varied among the different exposure categories, with HCV 1 being more frequent among blood donors, hemophiliacs and hemodialysis patients. A high frequency of HCV 3 was observed in cirrhotic patients, blood donors from the South of Brazil and injecting drug users (IDUs). The general distribution of the HCV genotype in Brazil is similar to that in other regions of the world.

Key words: HCV, HCV genotypes, Brazil

Hepatitis C virus (HCV) was identified by Choo et al. (1) and there is a growing consensus to classify it into the family Flaviviridae (2). Hepatitis C constitutes a public health issue of major importance since more than 90% of patients develop chronic liver disease and this viral infection is considered to be the major risk factor for hepatocellular carcinoma in the world (3,4).

The HCV genome consists of a positive stranded RNA of approximately 9.5 kb. The genetic heterogeneity of HCV led to its classification into phylogenetic clusters. The widest variation is observed among HCV isolates of distinct genotypes, which present >25% of nucleotide divergence within the entire genome or subgenomic parts. These genotypes are further divided into subtypes, which present about 75-86% nucleotide homology. The narrowest divergence is found between viruses from a single strain, which constitute a quasispecies. Although there is no standardized classification system for HCV genetic variants, most investigators agree that there are at least 6 major genotypes and a series of subtypes (2,5).

Epidemiological data suggest that the distribution of HCV genotypes varies among different regions (3,5,6). In addition, an association between the genetic variants and routes of transmission has been reported (7,8). Although some authors found a correlation of HCV genotypes with clinical response to interferon therapy (9) as well as with the outcome of the disease (10), these aspects still remain controversial (11,12).

Little is known about the molecular epidemiology of HCV in Brazil. The aim of the present study was to investigate the distribution of HCV genotypes among Brazilian subjects according to their exposure categories.

Sera and epidemiological data were kindly supplied by different public health laboratories, public blood banks and other medical institutions from different Brazilian states, from 1994 to 1996. A total of 250 anti-HCV-positive samples were investigated for the presence of HCV-RNA by RT-PCR.

Among the 78 blood donors tested, 8 samples were from the State of Acre (AC), 14 from Amazonas (AM), 9 from Rio Grande do Sul (RS), 24 from Pará (PA) and 23 from Rio de Janeiro (RJ). In addition, we tested 13 samples from cirrhotic patients from the State of Espírito Santo (ES), 30 samples from hemophiliacs and 56 from injecting drug users (IDUs) from Rio de Janeiro. We also tested 73 samples from hemodialysis patients from different states: 22 from Ceará (CE), 18 from São Paulo (SP), 14 from Minas Gerais (MG) and 19 from Mato Grosso (MT).

Viral RNA was extracted from 200 µl of plasma, using the QIAmp Blood kit and QIAmp Tissue kit (QIAGEN GmbH, Hilden, Germany). The extracted RNA was eluted in 100 µl of DEPC-treated water. Reverse transcription (RT) was carried out with 2.5 µl of RNA in a final volume of 10 µl. The mixture was submitted to one cycle of 42oC/60 min and another of 95oC/5 min. In the first and second PCR rounds we targeted sequences within the HCV 5' non-coding region (HCV 5'NCR) and we used 2.5 µl of RT and first PCR product, respectively, in a final volume of 25 µl. The cycling protocol included 35 cycles of 94oC/1 min, 54oC/1 min and 72oC/2 min, followed by a final cycle of 72oC/5 min. The sequences and genomic positions for the outer primers used were 1b (5'GGTGCACGGTCTACGAGACC3'; 251-231) and 2a (5'GGCGACACTCCRCGAT3'; 5-21) and the inner primers were 56 (5'CGCAAGCACCCTATCAGGGCAGT3'; 35-21) and 4 (5'GAGGAACTACTGTCTTCACGCAGAA3'; 218-195). The 260-bp PCR product was submitted to electrophoresis using a 2% agarose gel in TBE buffer and visualized by ethidium bromide staining under ultraviolet light.

HCV genotyping by restriction fragment length polymorphism analysis (RFLP) was performed as described elsewhere (8) and genotypes were determined according to Simmonds' classification (13). Since RFLP did not permit the determination of HCV subtypes, 60 samples previously genotyped by RFLP were also submitted to reverse hybridization (RH) using the INNOLIPA HCV II test kit (Innogenetics, Zwijndrecht, Belgium).

Univariate analyses, comparing HCV genotypes distribution between different exposure categories, were carried out using Epiinfo version 5.0 (Centers for Disease Control and Prevention, Atlanta, GA, USA, 1990). The chi-square or 2-tailed Fisher exact test was employed and results were considered to be statistically significant when P<0.05.

One hundred and sixty (64%) of the 250 anti-HCV-positive samples were also positive for HCV RNA. Table 1 shows that the predictive value of PCR was higher among persons at risk such as hemophiliacs (100%), IDUs (76.8%), and cirrhotic patients (76.7%). The low frequency of HCV-RNA found among blood donors from the northern states may have been a consequence of sample damage due to unsuitable conditions of transportation and/or storage. HCV genotype was determined by RFLP in 150 samples. The most prevalent genotype was HCV 1 (109/150, 72.7%), followed by HCV 3 (38/150, 25.3%) and HCV 2 (3/150, 2.0%).

 

In the 60 samples tested by RH, the most frequent subtype was 1b (35.0%), followed by 1a (30.0%), 3a (24.9%), 1a and 1b (5.0%) and subtypes 1 and 4c4d (1.7% each).

Except for one sample in which HCV 1 was identified by RFLP and HCV 4c4d was identified by RH, the two methods showed 98.3% agreement.

The distribution of HCV genotypes among the different exposure categories is presented in Table 1. Among blood donors, 79.4% (27/34) had HCV 1 and 20.6% (7/34) had HCV 3. Among subjects from the northern region of Brazil (AC, PA and AM) and Rio de Janeiro (southeast), we found a predominance of HCV 1 infection (92.3 and 92.8%, respectively). However, a different profile was observed in blood donors from RS (south), among whom genotype 3 was the most prevalent (71.5%).

HCV 1 was detected in 78.4% (29/37) of samples from hemodialysis patients whereas HCV 3 was detected in 21.6% (8/37). Interestingly, individuals from the State of Ceará showed a higher frequency of HCV 3 (50.0%) than subjects from other states. A high frequency of HCV 1 (80.0%) was found among hemophiliacs, the group in which the only HCV 4 case was found in this study. Among cirrhotic patients, the majority of subjects were infected with genotype 1a, followed by genotype 3.

Although the most prevalent HCV genotype among IDUs was HCV 1 (56.4%), a relatively high proportion of HCV 3 was noted in this population if compared with other exposure categories in Rio de Janeiro (P = 0.04). Among blood donors, HCV 1 was the most frequent genotype. Interestingly, a higher frequency of genotype 3 was observed in the south. These results partially conflict with previous findings (14) where HCV 1 was the most frequent, although the authors also reported a high prevalence of HCV type 3 in that region.

Among hemodialysis patients, a significantly higher prevalence of genotype 3 was observed in subjects from Ceará and studies with larger number of samples should be carried out to confirm these findings.

Among hemophiliacs, genotype 1 was the most frequent. This has also been observed in Argentina (15) and the United States (5). The distribution of HCV genotypes among IDUs was similar to that observed in Berlin, Germany (16).

The agreement between the RFLP and INNOLIPA II results was 98.3%. RFLP is faster and easier to perform compared with other techniques, and suitable for molecular epidemiological studies of large number of samples.

The general distribution of HCV genotypes in different exposure categories in Brazil was similar to that for Europe, with a higher frequency of genotypes 1 and 3, followed by type 2 and sparse cases of type 4 (5). Future more extensive surveys should be conducted to assess geographic differences in distribution of HCV genotypes in Brazil.

We thank all institutions which kindly supplied the serum samples.

Address for correspondence: M.L.A. Oliveira, Laboratório de Hepatites Virais, Departamento de Virologia, Instituto Oswaldo Cruz, FIOCRUZ, Av. Brasil, 4365, 21040-360 Rio de Janeiro, RJ, Brasil. Fax: +55-21-270-6397. E-mail: lou@gene.dbbm.fiocruz.br

M.L.A. Oliveira is the recipient of a fellowship from the Robert Koch Institute, Berlin, Germany. F.I. Bastos and C.F.T. Yoshida are recipients of fellowships from CNPq. Received May 12, 1998. Accepted November 10, 1998.

Acknowledgments

References

  • 1. Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW & Houghton M (1989). Isolation of a cDNA clone derived from a blood-borne non-A, non-B hepatitis genome. Science, 244: 359-362.
  • 2. Okamoto H, Miyakawa Y & Mayumi M (1997). Molecular virology of hepatitis C virus. Viral Hepatitis Reviews, 3: 51-62.
  • 3. Gish RG & Lau JYN (1997). Hepatitis C: eight years old. Viral Hepatitis Reviews, 3: 17-37.
  • 4. Di-Bisceglie AM (1997). Hepatitis C and hepatocellular carcinoma. Hepatology, 26 (Suppl 1): 34S-38S.
  • 5. Schreier E, Roggendorf M, Driesel G, Hoehne M & Viazov S (1996). Genotypes of hepatitis C virus isolates from different parts of the world. Archives of Virology, 11 (Suppl): 185-193.
  • 6. Davidson F, Simmonds P, Ferguson JC, Jarvis LM, Dow BC, Follett EAC, Seed CRG, Krusius T, Lin C, Megyesi CA, Kiyokawa H, Olim G, Dusaisamy G, Cuypers T, Saeed AA, Teo D, Conradie J, Kew MC, Lin M, Muchaprayoon C, Ndimble OK & Yap PL (1994). Survey of major genotypes and subtypes of hepatitis C virus using RFLP of sequences amplified from the 5' non-coding region. Journal of General Virology, 75: 2393-2398.
  • 7. Pawlotsky JM, Tsakiris L, Roudot-Thoraval F, Pellet C, Stuyver L, Duval J & Dhumeaux D (1995). Relationship between hepatitis C virus genotypes and sources of infection with chronic hepatitis C. Journal of Infectious Diseases, 171: 1607-1610.
  • 8. Driesel G, Wirth D, Stark K, Baumgarten R, Sucker U & Schreier E (1994). Hepatitis C virus (HCV) genotype distribution in German isolates: studies on the sequence variability in the E2 and NS5 region. Archives of Virology, 139: 379-388.
  • 9. Bell H, Hellum K, Harthug S, Maeland A, Ritland S, Myrvang B, von-der-Lippe B, Raknerud N, Skauj K, Gutigatrd BG, Skjaerven R, Prescott RE, Simmonds P & Construct group (1997). Genotype, viral load and age as independent predictors of treatment outcome of interferon-alpha 2a treatment in patients with chronic hepatitis C. Scandinavian Journal of Infectious Diseases, 29: 17-22.
  • 10. Garcia-Samaniego J, Soriano V, Castilla J, Bravo R, Moreno A, Carbo J, Iniguez A, Gonzalez J & Munoz F (1997). Influence of hepatitis C virus genotypes and HIV infection on histological severity of chronic hepatitis C. The Hepatitis/HIV Spanish Study Group. American Journal of Gastroenterology, 92: 1130-1134.
  • 11. Kobayashi Y, Watanabe S & Konishi M (1993). Quantitation and typing of serum hepatitis C virus RNA in patients with chronic hepatitis C treated with interferon-beta. Hepatology, 18: 1319-1325.
  • 12. Margia A, Cascavilla I, Lezzi G, Spirito F, Maertens G, Parlatone L, Saracco G, Rizzetto M & Andriulli A (1997). HCV genotypes in patients with liver disease of different stages and severity. Journal of Hepatology, 26: 1173-1178.
  • 13. Simmonds P, Holmes EC, Cha TA, Chan SW, McOmish F, Irvine B, Bell E, Yap PL, Kolberg J & Urdea MS (1993). Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of NS-5 region. Journal of General Virology, 74: 2391-2399.
  • 14. Krug LP, Lunge VR, Ikuta N, Fonseca ASK, Cheinquer H, Ozaki LS & Barros SGS (1996). Hepatitis C virus genotypes in Southern Brazil. Brazilian Journal of Medical and Biological Research, 29: 1629-1632.
  • 15. Picchio GR, Nakatsumo M, Boggiano C, Sabbe R, Corti M, Daruich J, Perez-Bianco R, Tezamos-Pinto M, Kokka R, Wilber J & Moster D (1997). Hepatitis C virus (HCV) genotype and viral titer distribution among Argentinean hemophilic patients in the presence and absence of human immunodeficiency virus (HIV) co-infection. Journal of Medical Virology, 52: 219-225.
  • 16. Stark K, Schreier E, Mueller R, Wirth D & Bienzle U (1995). Prevalence and determinants of anti-HCV seropositivity and HCV genotype among intravenous drug users in Berlin. Scandinavian Journal of Infectious Diseases, 27: 331-337.
  • Correspondence and Footnotes
  • Publication Dates

    • Publication in this collection
      17 Mar 1999
    • Date of issue
      Mar 1999

    History

    • Received
      12 May 1998
    • Accepted
      10 Nov 1998
    location_on
    Associação Brasileira de Divulgação Científica Av. Bandeirantes, 3900, Cep: 14049-900 , Tel: +55 16 3630-2778, +55 16 3315-3173 - Ribeirão Preto - SP - Brazil
    E-mail: bjournal@terra.com.br
    rss_feed Stay informed of issues for this journal through your RSS reader
    Accessibility / Report Error