Resumo em Inglês:
Myocardial ischemic preconditioning upregulated protein 1 (Mipu1) is a newly discovered upregulated gene produced in rats during the myocardial ischemic preconditioning process. Mipu1 cDNA contains a 1824-base pair open reading frame and encodes a 608 amino acid protein with an N-terminal Krüppel-associated box (KRAB) domain and classical zinc finger C2H2 motifs in the C-terminus. Mipu1 protein is located in the cell nucleus. Recent studies found that Mipu1 has a protective effect on the ischemia-reperfusion injury of heart, brain, and other organs. As a nuclear factor, Mipu1 may perform its protective function through directly transcribing and repressing the expression of proapoptotic genes to repress cell apoptosis. In addition, Mipu1 also plays an important role in regulating the gene expression of downstream inflammatory mediators by inhibiting the activation of activator protein-1 and serum response element.Resumo em Inglês:
Rosai-Dorfman disease (RDD) is a nonmalignant histiocytic disorder of unknown origin that is extremely rare. By immunohistochemistry, the RDD cells are characteristically S-100 positive and CD1a negative. Emperipolesis is a common histopathological finding, although not specific for RDD. Lymph node and cutaneous manifestations are most frequent, but diverse organs can be affected. The clinical course is unpredictable regardless of treatment. Here, we present a series of 8 cases presenting lymph node and/or cutaneous lesions. Lymph node involvement was seen in diverse regions, including mediastinal and retroperitoneal. The treatment response to steroids was diversified, and the chemotherapy response was disappointing. Associated autoimmune diseases (Sjögren syndrome and antiphospholipid syndrome) were observed in 2 patients. Regardless of therapy modality, these patients exhibited a favorable prognosis in a follow-up duration that ranged from 15 to 80 months.Resumo em Inglês:
Germ cell tumors present contrasting biological and molecular features compared to many solid tumors, which may partially explain their unusual sensitivity to chemotherapy. Reduced DNA repair capacity and enhanced induction of apoptosis appear to be key factors in the sensitivity of germ cell tumors to cisplatin. Despite substantial cure rates, some patients relapse and subsequently die of their disease. Intensive doses of chemotherapy are used to counter mechanisms of drug resistance. So far, high-dose chemotherapy with hematopoietic stem cell support for solid tumors is used only in the setting of testicular germ cell tumors. In that indication, high-dose chemotherapy is given as the first or late salvage treatment for patients with either relapsed or progressive tumors after initial conventional salvage chemotherapy. High-dose chemotherapy is usually given as two or three sequential cycles using carboplatin and etoposide with or without ifosfamide. The administration of intensive therapy carries significant side effects and can only be efficiently and safely conducted in specialized referral centers to assure optimum patient care outcomes. In breast and ovarian cancer, most studies have demonstrated improvement in progression-free survival (PFS), but overall survival remained unchanged. Therefore, most of these approaches have been dropped. In germ cell tumors, clinical trials are currently investigating novel therapeutic combinations and active treatments. In particular, the integration of targeted therapies constitutes an important area of research for patients with a poor prognosis.Resumo em Inglês:
Preimplantation genetic diagnosis (PGD) was originally developed to diagnose embryo-related genetic abnormalities for couples who present a high risk of a specific inherited disorder. Because this technology involves embryo selection, the medical, bioethical, and legal implications of the technique have been debated, particularly when it is used to select features that are not related to serious diseases. Although several initiatives have attempted to achieve regulatory harmonization, the diversity of healthcare services available and the presence of cultural differences have hampered attempts to achieve this goal. Thus, in different countries, the provision of PGD and regulatory frameworks reflect the perceptions of scientific groups, legislators, and society regarding this technology. In Brazil, several texts have been analyzed by the National Congress to regulate the use of assisted reproduction technologies. Legislative debates, however, are not conclusive, and limited information has been published on how PGD is specifically regulated. The country requires the development of new regulatory standards to ensure adequate access to this technology and to guarantee its safe practice. This study examined official documents published on PGD regulation in Brazil and demonstrated how little direct oversight of PGD currently exists. It provides relevant information to encourage reflection on a particular regulation model in a Brazilian context, and should serve as part of the basis to enable further reform of the clinical practice of PGD in the country.Resumo em Inglês:
Although radical nephrectomy alone is widely accepted as the standard of care in localized treatment for renal cell carcinoma (RCC), it is not sufficient for the treatment of metastatic RCC (mRCC), which invariably leads to an unfavorable outcome despite the use of multiple therapies. Currently, sequential targeted agents are recommended for the management of mRCC, but the optimal drug sequence is still debated. This case was a 57-year-old man with clear-cell mRCC who received multiple therapies following his first operation in 2003 and has survived for over 10 years with a satisfactory quality of life. The treatments given included several surgeries, immunotherapy, and sequentially administered sorafenib, sunitinib, and everolimus regimens. In the course of mRCC treatment, well-planned surgeries, effective sequential targeted therapies and close follow-up are all of great importance for optimal management and a satisfactory outcome.Resumo em Inglês:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.Resumo em Inglês:
In anurans, changes in ambient temperature influence body temperature and, therefore, energy consumption. These changes ultimately affect energy supply and, consequently, heart rate (HR). Typically, anurans living in different thermal environments have different thermal sensitivities, and these cannot be distinguished by changes in HR. We hypothesized that Rhinella jimi (a toad from a xeric environment that lives in a wide range of temperatures) would have a lower thermal sensitivity regarding cardiac control than R. icterica (originally from a tropical forest environment with a more restricted range of ambient temperatures). Thermal sensitivity was assessed by comparing animals housed at 15° and 25°C. Cardiac control was estimated by heart rate variability (HRV) and heart rate complexity (HRC). Differences in HRV between the two temperatures were not significant (P=0.214 for R. icterica and P=0.328 for R. jimi), whereas HRC differences were. All specimens but one R. jimi had a lower HRC at 15°C (all P<0.01). These results indicate that R. jimi has a lower thermal sensitivity and that cardiac control is not completely dependent on the thermal environment because HRC was not consistently different between temperatures in all R. jimi specimens. This result indicates a lack of evolutive trade-offs among temperatures given that heart rate control at 25°C is potentially not a constraint to heart rate control at 15°C.Resumo em Inglês:
Resveratrol (Resv) is natural polyphenol found in grapes. This study evaluated the protective effect of Resv against the effects of uric acid (UA) in immortalized human mesangial cells (ihMCs). ihMCs were preincubated with Resv (12.5 µM) for 1 h and treated with UA (10 mg/dL) for 6 or 12 h. The intracellular calcium concentration [Ca2+]i was quantified by fluorescence using flow cytometry. Angiotensinogen (AGT) and pre-pro endothelin-1 (ppET-1) mRNA were assayed by quantitative real-time RT-PCR. Angiotensin II (AII) and endothelin-1 (ET-1) were assayed by ELISA. UA significantly increased [Ca2+]i. Pre-incubation with Resv significantly reduced the change in [Ca2+]i induced by UA. Incubation with UA for 6 or 12 h also increased AGT mRNA expression and AII protein synthesis. Resv blunted these increases in AGT mRNA expression and AII protein. Incubation with UA in the ihMCs increased ppET-1 expression and ET-1 protein synthesis at 6 and 12 h. When ihMCs were pre-incubated with Resv, UA had a significantly diminished effect on ppET-1 mRNA expression and ET-1 protein synthesis at 6 and 12 h, respectively. Our results suggested that UA triggers reactions including AII and ET-1 production in mesangial cells. The renin-angiotensin system may contribute to the pathogenesis of renal function and chronic kidney disease. Resv can minimize the impact of UA on AII, ET-1 and the increase of [Ca2+]i in mesangial cells, suggesting that, at least in part, Resv can prevent the effects of soluble UA in mesangial cells.Resumo em Inglês:
Hoodia gordonii is a plant species used traditionally in southern Africa to suppress appetite. Recently, it has been associated with a significant increase in blood pressure and pulse rate in women, suggesting sympathomimetic activity. The present study investigated the possible antidepressant-like effects of acute and repeated (15 days) administration of H. gordonii extract (25 and 50 mg/kg, po) to mice exposed to a forced swimming test (FST). Neurochemical analysis of brain monoamines was also carried out to determine the involvement of the monoaminergic system on these effects. Acute administration of H. gordonii decreased the immobility of mice in the FST without accompanying changes in general activity in the open-field test during acute treatment, suggesting an antidepressant-like effect. The anti-immobility effect of H. gordonii was prevented by pretreatment of mice with PCPA [an inhibitor of serotonin (5-HT) synthesis], NAN-190 (a 5-HT1A antagonist), ritanserin (a 5-HT2A/2C antagonist), ondansetron (a 5-HT3A antagonist), prazosin (an α1-adrenoceptor antagonist), SCH23390 (a D1 receptor antagonist), yohimbine (an α2-adrenoceptor antagonist), and sulpiride (a D2 receptor antagonist). A significant increase in 5-HT levels in the striatum was detected after acute administration, while 5-HT, norepinephrine and dopamine were significantly elevated after chronic treatment. Results indicated that H. gordonii possesses antidepressant-like activity in the FST by altering the dopaminergic, serotonergic, and noradrenergic systems.Resumo em Inglês:
Angiotensin II is a key player in the pathogenesis of renovascular hypertension, a condition associated with endothelial dysfunction. We investigated aliskiren (ALSK) and L-arginine treatment both alone and in combination on blood pressure (BP), and vascular reactivity in aortic rings. Hypertension was induced in 40 male Wistar rats by clipping the left renal artery. Animals were divided into Sham, 2-kidney, 1-clip (2K1C) hypertension, 2K1C+ALSK (ALSK), 2K1C+L-arginine (L-arg), and 2K1C+ALSK+L-arginine (ALSK+L-arg) treatment groups. For 4 weeks, BP was monitored and endothelium-dependent and independent vasoconstriction and relaxation were assessed in aortic rings. ALSK+L-arg reduced BP and the contractile response to phenylephrine and improved acetylcholine relaxation. Endothelium removal and incubation with N-nitro-L-arginine methyl ester (L-NAME) increased the response to phenylephrine in all groups, but the effect was greater in the ALSK+L-arg group. Losartan reduced the contractile response in all groups, apocynin reduced the contractile response in the 2K1C, ALSK and ALSK+L-arg groups, and incubation with superoxide dismutase reduced the phenylephrine response in the 2K1C and ALSK groups. eNOS expression increased in the 2K1C and L-arg groups, and iNOS was increased significantly only in the 2K1C group compared with other groups. AT1 expression increased in the 2K1C compared with the Sham, ALSK and ALSK+L-arg groups, AT2 expression increased in the ALSK+L-arg group compared with the Sham and L-arg groups, and gp91phox decreased in the ALSK+L-arg group compared with the 2K1C and ALSK groups. In conclusion, combined ALSK+L-arg was effective in reducing BP and preventing endothelial dysfunction in aortic rings of 2K1C hypertensive rats. The responsible mechanisms appear to be related to the modulation of the local renin-angiotensin system, which is associated with a reduction in endothelial oxidative stress.Resumo em Inglês:
The T-cell immunoglobulin and mucin domain (TIM) family is associated with autoimmune diseases, but its expression level in the immune cells of systemic lupus erythematosus (SLE) patients is not known. The aim of this study was to investigate whether the expression of TIM-3 mRNA is associated with pathogenesis of SLE. Quantitative real-time reverse transcription-polymerase chain reaction analysis (qRT-PCR) was used to determine TIM-1, TIM-3, and TIM-4 mRNA expression in peripheral blood mononuclear cells (PBMCs) from 132 patients with SLE and 62 healthy controls. The PBMC surface protein expression of TIMs in PBMCs from 20 SLE patients and 15 healthy controls was assayed by flow cytometry. Only TIM-3 mRNA expression decreased significantly in SLE patients compared with healthy controls (P<0.001). No significant differences in TIM family protein expression were observed in leukocytes from SLE patients and healthy controls (P>0.05). SLE patients with lupus nephritis (LN) had a significantly lower expression of TIM-3 mRNA than those without LN (P=0.001). There was no significant difference in the expression of TIM-3 mRNA within different classes of LN (P>0.05). Correlation of TIM-3 mRNA expression with serum IgA was highly significant (r=0.425, P=0.004), but was weakly correlated with total serum protein (rs=0.283, P=0.049) and serum albumin (rs=0.297, P=0.047). TIM-3 mRNA expression was weakly correlated with the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI; rs=-0.272, P=0.032). Our results suggest that below-normal expression of TIM-3 mRNA in PBMC may be involved in the pathogenesis of SLE.Resumo em Inglês:
Accumulating evidence has suggested that high salt and potassium might be associated with vascular function. The aim of this study was to investigate the effect of salt intake and potassium supplementation on brachial-ankle pulse wave velocity (PWV) in Chinese subjects. Forty-nine subjects (28-65 years of age) were selected from a rural community of northern China. All subjects were sequentially maintained on a low-salt diet for 7 days (3.0 g/day NaCl), a high-salt diet for an additional 7 days (18.0 g/day NaCl), and a high-salt diet with potassium supplementation for a final 7 days (18.0 g/day NaCl+4.5 g/day KCl). Brachial-ankle PWV was measured at baseline and on the last day of each intervention. Blood pressure levels were significantly increased from the low-salt to high-salt diet, and decreased from the high-salt diet to high-salt plus potassium supplementation. Baseline brachial-ankle PWV in salt-sensitive subjects was significantly higher than in salt-resistant subjects. There was no significant change in brachial-ankle PWV among the 3 intervention periods in salt-sensitive, salt-resistant, or total subjects. No significant correlations were found between brachial-ankle PWV and 24-h sodium and potassium excretions. Our study indicates that dietary salt intake and potassium supplementation, at least in the short term, had no significant effect on brachial-ankle PWV in Chinese subjects.Resumo em Inglês:
Our goal was to analyze the anatomical parameters of the lumbar spine spinous process for an interspinous stabilization device designed for the Chinese population and to offer an anatomical basis for its clinical application. The posterior lumbar spines (T12-S1) of 52 adult cadavers were used for measuring the following: distance between two adjacent spinous processes (DB), distance across two adjacent spinous processes (DA), thickness of the central spinous processes (TC), thickness of the superior margin of the spinous processes (TS), thickness of the inferior margin of the spinous processes (TI), and height of the spinous processes (H). Variance and correlation analyses were conducted for these data, and the data met the normal distribution and homogeneity of variance. DB decreased gradually from L1-2 to L5-S1. DA increased from T12-L1 to L2-3 and then decreased from L2-3 to L4-5. The largest H in males was noted at L3 (25.45±5.96 mm), whereas for females the largest H was noted at L4 (18.71±4.50 mm). Usually, TS of the adjacent spinous process was lower than TI. Based on the anatomical parameters of the lumbar spinous processes obtained in this study, an “H”-shaped coronal plane (posterior view) was proposed as an interspinous stabilization device for the Chinese population. This study reports morphometric data of the lumbar spinous processes in the Chinese population, which provides an anatomical basis for future clinical applications.