Análise do gene TAX1BP1 em pacientes com câncer de cabeça e pescoço

Resumos

No Brasil foram estimados 14.160 casos novos de câncer e cabeça e pescoço para o ano de 2008. O tabagismo e o etilismo são os principais fatores de riscos estabelecidos na etiologia dessa doença. OBJETIVO: Avaliar o polimorfismo T → A do gene TAX1BP1 (leu306ile) em pacientes com câncer de cabeça e pescoço e em uma população controle. CASUÍSTICA E MÉTODOS: Estudo retrospectivo onde foram avaliados o sexo, idade, tabagismo e etilismo de 191 pacientes com câncer de cabeça e pescoço e de 200 indivíduos sem história de neoplasia. A análise molecular foi realizada após extração de DNA genômico pela técnica de PCR-RFLP. RESULTADOS: Há predominância de pacientes do sexo masculino (84,82%), tabagistas (91,1%) e etilistas (77,49%). A avaliação molecular não mostrou diferença estatisticamente significante entre os dois grupos (p =0,32). A análise dos parâmetros clínicos e polimorfismos mostrou uma associação com câncer na cavidade oral (OR:2,38; IC 95%: 1,18-4,78; p = 0,01), os demais parâmetros não mostraram associação com o polimorfismo. CONCLUSÃO: Há evidências de associação entre o polimorfismo do gene TAX1BP1 e câncer de cavidade oral. Para os demais parâmetros analisados os resultados não sugerem uma associação com o polimorfismo do gene TAX1BP1.

bebidas alcoólicas; genética; neoplasias de cabeça e pescoço; tabaco


In Brazil, there were 14,160 new estimated cases of head and neck cancer for the year of 2008. Smoking and drinking are the main risk factors established in the etiology of this disease. AIM: to assess the T → A polymorphism in gene TAX1BP1 (leu306ile) in patients with head and neck cancer and a control population. SERIES AND METHODS: a retrospective study in which we assessed the gender, age, smoking and drinking habits of 191 patients with head and neck cancer and 200 individuals without history of neoplasia. The molecular analysis was carried out after genomic DNA extraction by the PCR-RFLP method. RESULTS: there is a predominance of males (84.82%), smokers (91.1%) and drinkers of alcohol (77.49%). Molecular assessment did not show statistically significant differences between the two groups (p =0.32). The analysis of clinical parameters and polymorphisms showed association with oral cavity cancer (OR: 2.38; CI 95%: 1.18-4.78; p = 0.01), the other parameters were not associated with the polymorphism. CONCLUSION: There is evidence of association between TAX1BP1 gene polymorphism and oral cavity cancer. For the remaining parameters analyzed, the results do not suggest association with the TAX1BP1 gene polymorphism.

alcohol drinking; genetics; head and neck neoplasms; tobacco


ARTIGO ORIGINAL

Análise do gene TAX1BP1 em pacientes com câncer de cabeça e pescoço

Mariangela Torreglosa RuizI; Janayna Fernanda BalachiII; Raquel Aldrighi FernandesIII; Ana Lívia Silva GalbiattiIV; José Victor ManigliaV; Érika Cristina Pavarino-BertelliVI; Eny Maria Goloni-BertolloVII

IDoutora em Ciências da Saúde, Bióloga da Unidade de Pesquisa em Genética e Biologia Molecular - UPGEM - Faculdade de Medicina de São José do Rio Preto - FAMERP

IIGraduada em Ciências Biológicas - UNESP São José do Rio Preto, Bióloga. Faculdade de Medicina de São José do Rio Preto - FAMERP

IIIAcadêmica de Medicina da Faculdade de Medicina de São José do Rio Preto - FAMERP. Faculdade de Medicina de São José do Rio Preto - FAMERP

IVGraduada em Ciências Biológicas - UNORP São José do Rio Preto, Mestranda em Ciências da Saúde - Faculdade de Medicina de São José do Rio Preto. Faculdade de Medicina de São José do Rio Preto - FAMERP

VLivre-Docente em Otorrinolaringologia e Cirurgia de Cabeça e Pescoço, Professor Adjunto do Departamento de Otorrinolaringologia e Cirurgia de Cabeça e Pescoço. Faculdade de Medicina de São José do Rio Preto - FAMERP

VILivre-Docente em Genética Humana e Médica, Professora Adjunta do Departamento de Biologia Molecular - Faculdade de Medicina de São José do Rio Preto - FAMERP

VIILivre-Docente em Genética Humana e Médica, Professora Adjunto. Faculdade de Medicina de São José do Rio Preto - FAMERP

RESUMO

No Brasil foram estimados 14.160 casos novos de câncer e cabeça e pescoço para o ano de 2008. O tabagismo e o etilismo são os principais fatores de riscos estabelecidos na etiologia dessa doença.

OBJETIVO: Avaliar o polimorfismo T → A do gene TAX1BP1 (leu306ile) em pacientes com câncer de cabeça e pescoço e em uma população controle.

CASUÍSTICA E MÉTODOS: Estudo retrospectivo onde foram avaliados o sexo, idade, tabagismo e etilismo de 191 pacientes com câncer de cabeça e pescoço e de 200 indivíduos sem história de neoplasia. A análise molecular foi realizada após extração de DNA genômico pela técnica de PCR-RFLP.

RESULTADOS: Há predominância de pacientes do sexo masculino (84,82%), tabagistas (91,1%) e etilistas (77,49%). A avaliação molecular não mostrou diferença estatisticamente significante entre os dois grupos (p =0,32). A análise dos parâmetros clínicos e polimorfismos mostrou uma associação com câncer na cavidade oral (OR:2,38; IC 95%: 1,18-4,78; p = 0,01), os demais parâmetros não mostraram associação com o polimorfismo.

CONCLUSÃO: Há evidências de associação entre o polimorfismo do gene TAX1BP1 e câncer de cavidade oral. Para os demais parâmetros analisados os resultados não sugerem uma associação com o polimorfismo do gene TAX1BP1.

Palavras-chave: bebidas alcoólicas, genética, neoplasias de cabeça e pescoço, tabaco.

INTRODUÇÃO

Neoplasia maligna de cabeça e pescoço é um termo que designa as lesões tumorais localizadas na cavidade oral (40%), faringe (15%), laringe (25%), e outros locais como glândulas salivares (20%)1,2. O tipo histológico mais frequente é o carcinoma espinocelular presente em mais de 90% dos casos 3,4. Esse tipo de tumor é caracterizado por uma grande agressividade local, recorrência. Cerca de 2/3 dos pacientes apresentam a doença em estágio avançado, comumente envolvendo os linfonodos regionais. As metástases à distância ocorrem em 10% dos pacientes5,6.

No Brasil, segundo o Instituto Nacional do Câncer (INCA), a incidência de câncer em cavidade oral, sítio mais representativos dentre estes tipos de tumores, para 2008 foram estimados 14.160 novos casos7.

O tabagismo e o etilismo são os principais fatores de risco para câncer de cabeça e pescoço. Estudos epidemiológicos mostram que cada um desses dois fatores, separadamente, aumenta o risco de desenvolver uma neoplasia dessa região em três vezes, e quando associados, o risco será de quinze vezes8-10.

Polimorfismos de nucleotídeos únicos (SNPs) constituem o tipo de variação mais comum do genoma humano e correspondem a polimorfismos do DNA afetando um único nucleotídeo, com frequência acima de 1% na população humana11-14. Um número cada vez maior destas alterações está sendo associado às bases moleculares de doenças envolvendo um componente genético, como o câncer, ou como um fator de risco para doenças adquiridas14.

Diversos polimorfismos genéticos e haplótipos envolvidos no metabolismo de drogas, transporte e mecanismos de ação têm sido investigados para a otimização de respostas ao tratamento, como por exemplo os polimorfismos C677T e A1298C do gene Metilenotetrahidrofolato redutase (MTHFR)15.

Nesse estudo foi avaliado o papel do polimorfismo de nucleotídeo único T → A, no desenvolvimento de carcinoma de cabeça e pescoço, presente no gene TAX1BP1, descrito por Brentani et al. em 200316. Este gene é um marcador de interesse para o estudo por ser selecionado em uma biblioteca não-enviesada (Projeto Genoma Humano do Câncer), que passou por uma primeira etapa de validação17.

O gene TAX1BP1 produz uma proteína que está vinculada ao vírus tipo 1 de células T da Leucemia Humana (Human T-cell leukemia virus type I binding protein 1) está localizado no cromossomo 7p15 e possui um polimorfismo T → A que resulta na troca do aminoácido Leucina (leu) por Isoleucina (ile) na posição 306 da proteína18. Foi identificado pela primeira vez como um alvo da proteína Tax do vírus da leucemia de células T humana20. TAX1BP1 interage também com outras moléculas importantes, como a A20 e TRAF6, que participam de processos de resposta inflamatória19,20.

Assim, o objetivo deste trabalho foi identificar o polimorfismo T → A que resulta na troca do aminoácido Leucina (leu) por Isoleucina (ile) na posição 306 da proteína do gene TAX1BP1 em pacientes com câncer de cabeça e pescoço e em uma população de indivíduos sem história de neoplasia e também avaliar a distribuição destes genótipos de acordo com as características clínico-patológicas do câncer de cabeça e pescoço.

CASUÍSTICA E MÉTODOS

Este estudo foi aprovado pelo aprovado pelo comitê de ética da instituição sob número 5566/2005.

Neste trabalho foram analisados 191 pacientes com câncer de cabeça e pescoço e 200 indivíduos sem história de neoplasia. Todas as amostras foram obtidas após consentimento livre e esclarecido de todos os participantes. Foram analisados o perfil sociodemográfico desses pacientes (sexo, idade) e a exposição a fatores de risco (tabagismo e etilismo). Informações sobre o tabagismo e etilismo foram limitadas quanto ao uso ou não de tabaco e álcool. Foram considerados tabagistas indivíduos que consomem cerca de 100 cigarros durante toda a vida e etilista aqueles que bebem mais que quatro drinques por semana21,22. Foram incluídos no grupo de pacientes indivíduos com diagnóstico histopatológico de carcinoma espinocelular de cabeça e pescoço. No grupo controle foram incluídos indivíduos de ambulatórios de outras especialidades médicas, como critério de exclusão foi investigada a história familial de câncer, excluindo os casos de neoplasias. Foi utilizado como tempo de seguimento de pacientes e controles 60 meses.

Nos pacientes, foram analisados os sítios primários de ocorrência do tumor e os tumores foram classificados de acordo com os parâmetros da Union International Control Cancer (IUCC), 2002 e American Joint Committee for Cancer (AJCC), 2002, em três critérios: tamanho do tumor (T), presença de linfonodos regionais comprometidos (N) e presença de metástase à distância (M)23,24.

O DNA genômico foi extraído a partir sangue periférico25. Para a avaliação molecular, foi utilizada a técnica de PCR-RFLP. Para a identificação dos alelos polimórficos foram realizadas reações em cadeia da polimerase (PCR) em um volume total de 20 µl, utilizando-se 50 ng de DNA genômico, 0,3mM de primer sense (5' - ACCTGGGTCTCCTAAATCCT - 3'), 0,3 mM de primer antisense (5' - AGCCTG CCAATCTCTTCTT - 3'), 200mM dNTP, 1X tampão de reação, 1,5mM MgCl2, 0,2 unidades de Taq polimerase. A amplificação por PCR foi realizada com uma etapa inicial de desnaturação por 5 minutos a 95ºC, seguida de 35 ciclos com desnaturação a 95ºC por 30 segundos, anelamento a 57ºC, extensão a 72ºC por 30 segundos e etapa de extensão final a 72ºC. Os produtos do PCR foram visualizados em gel de agarose 1,5%, corado com brometo de etídio.

Os produtos de amplificação foram submetidos à digestão enzimática com a endonuclease de restrição Apo I e este produto da digestão foi submetido à eletroforese em gel de agarose 2% a 80 V por 4 horas, para observação do padrão de migração entre os fragmentos de tamanhos. A presença do polimorfismo destrói o sítio de restrição, não ocorrendo o corte do amplificado de 264 pb. Na ausência do polimorfismo, o produto é digerido em dois fragmentos (um fragmento de 205 pb e outro fragmento de 59 pb).

Para a análise estatística, os dados demográficos foram tabulados por estatística descritiva e comparados pelo Teste Exato de Fisher. Este teste também foi utilizado para as analises estatísticas da distribuição genotípica e alélica dos polimorfismos.

Os modelos de regressão logística múltipla foram utilizados para determinar o efeito das variáveis analisadas em câncer de cabeça e pescoço. O modelo incluiu idade (referência: < 52 anos, mediana dos dois grupos), gênero (referência: feminino), hábito tabagista (referência: não fumantes) e hábito etilista (referência: não etilistas).

As características clínico-patológicas também foram analisadas por regressão logística múltipla. A classificação T foi dividida em tumores com pequena extensão (T1,T2) e com grande extensão (T3, T4). A classificação N foi dicotomizada em comprometimento de linfonodos negativo (N0), e positivo (N1, N2, N3). Os estádios foram divididos em precoce (estádios I, II) e categoria avançada da doença (III e IV).

Os resultados foram apresentados em odds ratio (OR) e intervalo de confiança de 95% (IC - 95%). O nível de significância foi estabelecido em 5% (p=0,05).

O método de Kaplan-Meier foi aplicado para avaliar as diferentes taxas de sobrevida e recorrência da doença entre os diferentes genótipos e o teste Log-Rank para medir estas diferenças entre os genótipos. Para a análise de sobrevida foram considerados como ponto final da análise (end point) o período compreendido entre o diagnóstico da doença e o óbito, e para a análise da recorrência, o end point foi o diagnóstico de recidiva.

RESULTADOS

A Tabela 1 mostra os dados demográficos dos 191 pacientes com câncer de cabeça e pescoço e dos 200 indivíduos sem história de neoplasia. A idade média dos pacientes com câncer de cabeça e pescoço foi de 58 anos, com desvio padrão de ± 9,69. Foi utilizado um grupo controle (indivíduos sem história de neoplasia) com a média de idade de 47 anos, com desvio padrão de ± 15,69. A análise estatística para essa variável mostrou significância entre os grupos (p< 0,0001). A mediana da idade dos pacientes e dos controles foi de 42 anos.

Em relação ao gênero, 84,82% dos pacientes eram do sexo masculino e 15,18% do sexo feminino. Já a frequência encontrada no grupo controle foi de 76,5% eram do sexo masculino e 23,5% do sexo feminino. A análise estatística mostrou significância entre esses dois grupos (p= 0,04).

Em relação aos hábitos tabagista e etilista, as informações foram limitadas quanto ao uso ou não de tabaco e álcool. No grupo dos pacientes com câncer de cabeça e pescoço 91,1% eram fumantes e 77,49% consumiam álcool. Nos indivíduos controles 51% eram tabagistas e 51% consumiam álcool. A análise estatística do uso de tabaco mostrou significância entre os grupos (p<0,0001), assim como a do consumo de álcool (p<0,0001). O sítio de tumor mais representativo entre os pacientes foi a cavidade oral (30%).

As frequências alélicas para os pacientes com câncer de cabeça e pescoço foram respectivamente (T=0,87 e A=0,13) e para os indivíduos controles (T=0,90 e A=0,10) não mostrando diferença estatisticamente significante entre os grupos (p=0,32). A frequência genotípica (Tabela 2) também não mostrou diferença entre os grupos (p= 0,3080). As frequências genotípicas encontram-se em Equilíbrio de Hardy-Weinberg entre os pacientes (X2 = 1,71; p = 0,19) e entre os indivíduos controles (X2 = 0,05; p = 0,81).

Como não foi possível realizar o pareamento entre os dados demográficos e fator de risco entre pacientes e controles foi realizado o teste de regressão logística múltipla, para avaliação da potencial interação entre os genótipos estudados e as características sociodemográficas (idade e gênero) e fatores de risco (tabagismo e etilismo) (Tabela 3) e não foram observadas diferenças entre os grupos para as características estudadas.

A análise entre o polimorfismo e parâmetros clínicos está apresentada na Tabela 4. Em relação ao sítio anatômico primário do tumor, a frequência do polimorfismo foi maior no câncer de cavidade oral (OR = 2,38; IC 95% 1,18 - 4,78; p = 0,01). Não foram encontradas associações em relação à extensão tumoral, comprometimento de linfonodos e o estadiamento tumoral. A análise para o critério M da não foi realizada, pois apenas 1 paciente apresentava a classificação M1.

As curvas de Kaplan-Meier estão apresentadas na Figura 1, e não mostraram diferenças estatísticas entre a presença do polimorfismo e a taxa de sobrevida (p = 0,4078) e o tempo de recidiva da doença (p = 0,8827). Para esta análise foi calculada a presença de recidiva e óbito a partir da primeira consulta (diagnóstico da doença) até a data da consulta ao prontuário médico. Em relação à recidiva 32,63 % dos pacientes apresentaram recorrência da doença, com uma média de 27 meses, e apenas 02 pacientes (2,11%) foram a óbito no período das análises.

DISCUSSÃO

Esse estudo mostrou-se compatível com os dados da literatura em relação à epidemiologia do câncer de cabeça e pescoço, a qual é mais frequente em homens, a partir da quinta década de vida, tabagistas, etilistas. Evidências epidemiológicas mostram que a incidência do câncer de cabeça e pescoço aumenta com a idade2,3.

Esta doença é relativamente rara em mulheres e particularmente, em países em desenvolvimento os indivíduos do sexo masculino são mais afetados que os do sexo feminino1,26. Embora essa neoplasia atinja preferencialmente os pacientes do sexo masculino, nos últimos anos houve um aumento notável na incidência entre mulheres, que deve refletir a mudança nos hábitos tabagistas e etilistas9,10.

Em relação aos fatores de risco, o tabagismo e o consumo de álcool, segundo a literatura são os principais fatores envolvidos na carcinogênese da neoplasia de cabeça e pescoço8-10 e esse estudo mostrou essa associação.

As frequências genotípicas encontram-se em equilíbrio de Hardy-Weinberg.

Os resultados não mostraram diferença significativa entre os grupos estudados e o polimorfismo do gene TAX1BP1, embora haja estudos correlacionando a presença desse gene e o surgimento de neoplasias, principalmente leucemias18,27. Há também estudos de expressão gênica mostrando expressão aumentada do gene TAX1BP1 em câncer de ovário 28 e artrite reumatoide29. Sabe-se que a proteína interage com A20 (atividade antiapoptótica). Esta proteína leva à ativação do complexo NF-KB o que acentua a proliferação, proteção à morte celular e eventualmente à transformação, mas esses mecanismos são pouco compreendidos30.

Não há na literatura a descrição das frequências desses polimorfismos e os respectivos efeitos no câncer de cabeça e pescoço, e não há trabalhos brasileiros sobre este assunto, o que reforça a importância deste estudo.

A frequência do alelo polimórfico foi maior no câncer de cavidade oral e pode ser explicada devido às diferenças histológicas peculiares às diferentes regiões anatômicas. Outros trabalhos sugerem que o comportamento biológico deste tipo de tumor é diferente em várias localizações anatômicas31.

Diversos estudos analisam a associação das características clínico-patológicas de pacientes com câncer de cabeça e pescoço e polimorfismos. Quanto à agressividade tumoral, neste estudo não foi demonstrada associação deste polimorfismo com a extensão (categoria T) e com o estadiamento do tumor nas três grandes regiões de cabeça e pescoço (cavidade oral, faringe e laringe) analisadas. O trabalho de Teng et al. em 200932, analisou a relação entre polimorfismos dos genes SDF-1-30A e CXCR4 e mostrou a relação deste último polimorfismos com tumores de estádios avançado (III e IV) em cavidade oral. Polimorfismos dos genes CYP1E1*5B e GSTM1 nulo também foram associados a estádios avançados da doença33.

A identificação de associação desses polimorfismos com o desenvolvimento de carcinoma de cabeça e pescoço, bem como de sua relação com resposta a carcinógenos poderá auxiliar no entendimento dos mecanismos envolvidos no processo neoplásico e na elaboração de estratégias de prevenção para esta doença.

CONCLUSÃO

Há evidências de associação entre o polimorfismo do gene TAX1BP1 e câncer de cavidade oral. Não há diferenças na distribuição do polimorfismo entre pacientes com câncer de cabeça e pescoço e indivíduos sem história de neoplasia. Também não há diferenças na distribuição dos genótipos entre os diferentes tamanhos de tumores, comprometimento de linfonodos, estadiamento, ocorrência de recidiva e óbito.

Este artigo foi submetido no SGP (Sistema de Gestão de Publicações) da BJORL em 28 de abril de 2009. cod. 6383

Artigo aceito em 24 de novembro de 2009

Unidade de Pesquisa em Genética e Biologia Molecular - UPGEM Av. Brigadeiro Faria Lima 5416 bloco U-6 São José do Rio Preto 15090-000.

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) e Centro Nacional de Desenvolvimento Científico e Tecnológico (CNPq).

  • 1. Döbrossy L. Epidemiology of head and neck cancer: magnitude of the problem. Cancer Metastasis Rev. 2005; 24:9-17.
  • 2. Ragin CCR, Modugno F, Gollin SM. The epidemiology and risk factors of head and neack cancer: a focus on a Human Papillomavirus. J Den Res. 2007;86:104-14.
  • 3. Casiglia J, Woo SB. A comprehensive review of oral cancer. Gen Dent. 2001;49:72-82.
  • 4. Deshpande AM, Wong DT. Molecular mechanisms of head and neck cancer. Expert Rev Anticancer Ther. 2008;8:799-809.
  • 5. Agulnik M. Malignancies of the head and neck: the role molecular targeted agents. Expert Opin Ther Targets. 2007;11:207-17.
  • 6. Argiris A, Karamouzis MV, Raben D, Ferris RL. Head and neck cancer. The Lancet. 2008;371:1695-709.
  • 7
    Instituto Nacional do Câncer, 2008. Disponível em URL: http://www.inca.gov.br Acessado em 27 de abril de 2009.
    » link
  • 8. Hashibe M, Brennan P, Benhamou S, Castellsague X, Chen C, Curado MP, et al. Alcohol drinking in never users of tobacco, cigarette smoking in never drinkers, and the risk of head and neck cancer: pooled analysis in the International Head and Neck Cancer Epidemiology Consortium. J Natl Cancer Inst. 2007; 99:777-89.
  • 9. Boffetta P, Hecht S, Gray N, Gupta P, Straif K. Smokeless tobacco and cancer. Lancet Oncol. 2008;9:667-75.
  • 10. Argiris A, Karamouzis MV, Raben D, Ferris RL. Head and neck cancer. Lancet. 2008; 371:1695-709.
  • 11. Carlson CS. Additional SNPs and linkage-disequilibrium analyses are necessary for whole-genome association studies in humans. Nat Genet. 2003;33:518-21.
  • 12. Sabeti PC, Reich DE, Higgins JM, Levine HZ, Richter DJ, Shaffner SF, et al. Detecting recent positive selection in the human genome from haplotype structure. Nature. 2002;419:832-7.
  • 13. Gresham D, Dunham MJ, Botstein D. Comparing whole genomes using DNA microarrays. Nat Rev Genet. 2008;9:291-302.
  • 14. Kruglyak L. The road to genome-wide association studies. Nat Rev Genet. 2008;9:314-8.
  • 15. Mattia E, Toffoli G. C677T and A1298C MTHFR polymorphisms, a challenge for antifolate and fluoropyrimidine-based therapy personalisation. Eur J Cancer. 2009;45:1333-51.
  • 16. Brentani H, Caballero OL, Camargo AA, da Silva AM, da Silva WAJr, Dias Neto E, et al. The generation and utilization of a cancer-oriented representation of the human transcriptome by using expressed sequence tags. Proc Natl Acad Sci USA. 2003; 100: 13418-23.
  • 17. Costa MCR, Silva WA, Holanda AJ, Tojal I, Dias-Neto E, Guimarães, PEM. et al Identification of coding single nucleotide polymorphisms (cSNPs) in gene expressed in tumoral cells using the HCGP-ORESTES database. Am J Hum Gen. 2001;69:540.
  • 18. Gachon F, Peleraux A, Thebault S, Dick J, Lemasson I, Devaux C, Mesnard JM. CREB-2, a cellular CRE-dependent transcription repressor, functions in association with Tax as an activator of the human T-cell leukemia virus type 1 promoter. J Virol. 1998; 72: 8332-7.
  • 19. Shembade N, Harhaj NS, Liebl DJ, Harhaj EW. Essential role for TAX1BP1 in the termination of TNF-a-, IL-1- and LPS-mediated NF-jB and JNK signaling. EMBO J. 2007;26:3910-22.
  • 20. Shembade N, Harhaj NS, Yamamoto M, Akira S, Harhaj EW. The human T-cell leukemia virus type 1 Tax oncoprotein requires the ubiquitin-conjugating enzyme Ubc13 for NF-kappaB activation. J Virol. 2007;81:13735-42.
  • 21. Ahrendt SA, Chown JT, Yang SC, Wu L, Zhang M-J, Jen J et al. Alcohol comsuption and cigarette smoking increase the frequency of p53 mutations in nonsmall cell lung cancer. Cancer Res. 2000;60:3155-9.
  • 22. Kjaerhein K, Gaard M, Andersen A. The role of alcohol, tobacco, and dietary factors in upper aerogastric tract cancer: a prospective study of 10,900 Norwegian men. Cancer Causes Controls. 1998;9:99-108.
  • 23. Greene FLPD, Fleming ID, Fritz A, Balch CM, Haller DG, Morrow M. AJCC Cancer Staging Manual 6 ed. Springer, NY, USA 2002.
  • 24
    Instituto Nacional do Câncer. UICC- União Internacional Contra o Câncer, 2002 - TNM - Classificação de Tumores Malignos 6ª. Edição. Ministério da Saúde. Rio de Janeiro: INCA 2004.
  • 25. Miller SA, DykesDD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells Nucleic Acids Res. 1988;16:1215.
  • 26. Stewart BW, Kleihues P (eds): World Cancer Report, WHO Internacional Agency for Research on Cancer, IARC Press, Lyon, 2003.
  • 27. Morriswood B, Morriswood B, Ryzhakov G, Puri C, Arden SD, Roberts R, et al. T6BP and NDP52 are myosin VI binding partners with potential roles in cytokine signalling and cell adhesion. J Cell Sci. 2007; 120: 2574-85.
  • 28. LEspérance S, Popa I, Bachvarova M, Plante M, Patten N, Wu L, et al. Gene expression profiling of paired ovarian tumors obtained prior to and following adjuvant chemotherapy: molecular signatures of chemoresistant tumors. Int J Oncol. 2006;29:5-24.
  • 29. Dieguez-Gonzalez R, Akar S, Calaza M, Perez-Pampin E, Costas J, Torres M, et al. Genetic variation in the NF{kappa}B pathway in relation to susceptibility to rheumatoid arthritis. Ann Rheum Dis. 2009;68:579-83.
  • 30. Shembade N, Harhaj NS, Parvatiyar K, Copeland NG, Jenkins NA, Matesic LE, Harhaj EW. The E3 ligase Itch negatively regulates inflammatory signaling pathways by controlling the function of the ubiquitin-editing enzyme A20. Nat Immunol. 2008;9:254-62.
  • 31. Timar J, Csuka O, Remenar E, Repassy G, Kasler M. Progression of head and neck squamous cell cancer. Cancer Metastasis Rev. 2005;24:107-27.
  • 32. Teng Y-H, Liu T-H, Tseng H-C, Chung T-T, Yeh C-M, Li Y-C, et al. Contribution of genetic polymorphisms of stromal cell-derived factor-1 and its receptor, CXCR4, to the susceptibility and clinicopathologic development of oral cancer. Head Neck. 2009;31:1282-8.
  • 33. Olivieri EHR, Silva SD, Mendonça FF, Urata YN, Vidal DO, Faria MAM, et al. CYP1A2*1C, CYP2E1*5B, and GSTM1 polymorphisms are predictors of risk and poor outcome in head and neck squamous cell carcinoma patients. Oral Oncology. 2009;45:73-9.

Datas de Publicação

  • Publicação nesta coleção
    31 Maio 2010
  • Data do Fascículo
    Abr 2010

Histórico

  • Recebido
    28 Abr 2009
  • Aceito
    24 Nov 2009
Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Sede da Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico Facial, Av. Indianópolia, 1287, 04063-002 São Paulo/SP Brasil, Tel.: (0xx11) 5053-7500, Fax: (0xx11) 5053-7512 - São Paulo - SP - Brazil
E-mail: revista@aborlccf.org.br