Abstract
Drug-resistant Acinetobacter baumannii is a frightening reality. The aim of this study is to examine the expression profiles of blaOXA-51 gene in carbapenemases producing A. baumannii treated with imipenem/sulbactam combination. Carbapenemases producing A. baumannii was identified among clinical isolates of A. baumannii obtained from patients at Shahid Rajaee hospital, Gachsaran, Iran, from January to June 2018. Synergism testing of imipenem/sulbactam on carbapenemases producing A. baumannii was carried out by broth microdilution method. Eventually, the expression of blaOXA-51 gene was carried out to investigate the inhibitory properties of imipenem/sulbactam combination against carbapenemases producing A. baumannii using quantitative real time RT-PCR. Among A. baumannii isolates, 24% were carbapenemases producing A. baumannii. Imipenem/sulbactam combination revealed synergistic and partial synergistic effect for all tested isolates (FIC= 0.313-0.75). Finally, imipenem/sulbactam combination displayed significant down-regulation of blaOXA-51 gene in carbapenemases producing A. baumannii. Imipenem synergizes with sulbactam against carbapenemases producing A. baumannii by targeting of the blaOXA-51 gene.
Keywords:
Acinetobacter baumannii
;
blaOXA-51
; Carbapenemases; Imipenem; Sulbactam
INTRODUCTION
Acinetobacter baumannii is an aerobic non-motile Gram-negative, non-fermentative and oxidase-negative bacillus and a frequent cause of life-threatening infections in hospitals. The combination of persistent presence of A. baumannii in the environment and its multidrug-resistant to many drugs determinants renders it a common nosocomial pathogen (Hou, Yang, 2015; Lin, Lan, 2014; Manchanda et al., 2010; Perez et al., 2007). It is well known that A. baumannii is highly resistant to major classes of antibiotics such as aminoglycosides, third generation cephalosporins and fluoroquinolone (Hou, Yang, 2015).
Carbapenems are considered as the gold standard against multidrug-resistant Gram-negative organisms. Carbapenems, including imipenem, meropenem, biapenem, ertapenem, and doripenem, are classified as β-lactam antibiotics. However, the number of carbapenem-resistant A. baumannii strains have been increasing rapidly (Da Silva, Domingues, 2016; Fritzenwanker et al., 2018; Karam et al., 2016; Papp-Wallace et al., 2011). Several mechanisms associated with resistance to carbapenems include production of β-lactamases. Carbapenemases are specific β-lactamases that are classified into three functional groups: class A serine carbapenemases (e.g., KPC and GES enzymes), class B metallo-β-lactamases (e.g., VIM, IMP, and NDM β-lactamases), and class D carbapenemases (e.g., OXA-23, −24/40, −48, −51, −55, −58, −143 and −235) through the expression of chromosomal and plasmid genes (Bahador et al., 2015; Bush, 2013; Higgins et al., 2013; Papp-Wallace et al., 2011). Although overproduction of class C β-lactamases (e.g., CMY-10 and PDC β-lactamases) do not involve robust carbapenemases, it may contribute to carbapenem resistance, particularly in combination with other drug-resistance mechanisms (Papp-Wallace et al., 2011). Different other mechanisms may be responsible for carbapenem-resistance in A. baumannii include loss or alterations of specific outer-membrane proteins, modification of penicillin binding proteins and AdeABC efflux pump (Da Silva, Domingues, 2016).
Class D carbapenemases, also known as OXA-type enzymes or oxacillinases, are the most clinically problematic enzymes in this regard. The majority of these enzymes have been identified in various Acinetobacter clinical isolates (Antunes et al., 2014; Diene, Rolain, 2014; Walther-Rasmussen, Hoiby, 2006). Moreover, the class D β-lactamase OXA-51 is ubiquitous and unique carbapenemases to emerge in multi-resistant of A. baumannii (Brown et al., 2005; Evans et al., 2008).
Outbreaks of antibiotic resistance A. baumannii have become increasingly common and have been recognized as a tremendous challenge worldwide (Bahador et al., 2015; Manchanda et al., 2010; Safari et al., 2013). Combination therapies are urgently needed for the treatment of A. baumannii infection. Despite the report of combination therapies with imipenem (Fishbain, Peleg, 2010; Lin, Lan, 2014; Spellberg, Bonomo, 2015), it is little known about the efficacy of imipenem/sulbactam on drug-resistant genes of A. baumannii (Montero et al., 2004). Therefore, the present study was designed to evaluate the imipenem/sulbactam combination effects on clinical isolates of carbapenemases producing A. baumannii. The study examined expression profiles of blaOXA-51 gene involved in the carbapenemases producing A. baumannii treated with imipenem/sulbactam combination.
MATERIAL AND METHODS
Antibiotics
Amikacin (AMK; 30 μg/disk), ampicillin/sulbactam (SAM, 10/10 µg/disc), cefixime (CFM; 5 µg/disc), cefotaxime (CTX; 30 µg/disc), ceftazidime (CAZ; 30 µg/disc), ceftriaxone (CRO; 30 µg/disc), ciprofloxacin (CIP, 5 µg/disc), gentamicin (GEN, 10 µg/disc), imipenem (IPM, 10 µg/disc), meropenem (MEM; 10 µg/disc), nitrofurantoin (NIT; 300 µg/disc), sulbactam (SUL; 10 µg/disc), trimethoprim/sulfamethoxazole (SXT; 25 µg/disc) (HiMedia Laboratories, Mumbai,. India), imipenem and sulbactam powder (Sigma-Aldrich Co. St. Louis, MO, USA). The antifungal powders were dissolved in dimethyl sulfoxide (DMSO) and stock solutions diluted based on Clinical and Laboratory Standard Institute (CLSI) guidelines (CLSI M07-A10).
Source of bacteria
Microbiological study was performed on 50 samples of A. baumannii isolated from blood (6%, n=3), urine (32%, n=16), wound (42%, n=21) and respiratory secretions (20%, n=10) of 258 patients admitted to the intensive care unit of Shahid Rajaee hospital, Gachsaran, Iran, within a 6-month period from January to June 2018. Clinical samples were inoculated onto blood agar (Merck) and MacConkey agar (Merck) medium and incubated at 37 ºC for 24 h at microbiology laboratory (Ghajavand et al., 2015). Acinetobacter baumannii ATCC BAA-747 was acquired from Iranian Research Organization for Science and Technology and stored in trypticase soy broth (TBS, Merck Research Laboratories, Darmstadt, Germany) supplemented with glycerol (30% v/v) at -70 ºC.
Bacterial identification
The clinical isolates were identified according to Gram reaction, morphological, cultural, and physiological properties. The chromogenic agar CHROMagar Acinetobacter (CHROMagar, Paris, France) was used for selective and rapid identification of Acinetobacter species. The isolates were further identified as A. baumannii by the amplification 16S rRNA gene. The amplified PCR products was confirmed by DNA sequencing. The sequence homology was detected using the nucleotide BLAST program (Biglari et al., 2017; Chen et al., 2017; Ghajavand et al., 2015).
Antibiotic susceptibility test
Antibiotic susceptibility of the clinical isolates was determined using disk diffusion method on Mueller-Hinton agar (Merck), referred to the standard operating procedures for disk diffusion (CLSI M02-A12, 2015). The susceptibility patterns of clinical isolates were analysed using software program WHONET 2017.
Detection of carbapenemases producing A. baumannii
All A. baumannii clinical isolates were tested for carbapenemases production using the phenotypic confirmatory test (Carba NP test), performed and interpreted according to CLSI standards (CLSI M100-S27, 2017; van der Zwaluw et al., 2015).
Synergism testing
In order to determine synergism between imipenem and sulbactam, antibacterial susceptibility of imipenem and sulbactam alone and in combination against carbapenemases producing A. baumannii isolates were determined via broth microdilution method (CLSI M07-A10). Hundred µL of the two-fold dilution of imipenem and sulbactam (range 0.125-512 μg/mL) alone or in combination were aliquoted in the wells of 96-well U-bottom microtiter plates in the presence of 100 μL of 2-8 × 104 colony-forming units (CFU)/mL of carbapenemases producing A. baumannii isolates and incubated at 35 ºC. The absorbance was measured at 630 nm using a Stat Fax 303 Reader (Awareness Technology, Inc., USA) after 24 h of incubation. The minimal inhibitory concentration (MIC) was defined as the lowest concentration of the antibacterial agents that reduced ≥50% or 90% of absorbance compared to the positive control. The synergistic activity of the imipenem/sulbactam combination was determined based on the fractional inhibitory concentration (FIC) index (Khodavandi et al., 2010).
Quantitative analysis of blaOXA-51 gene expression in carbapenemases producing A. baumannii
Expression of blaOXA-51 in carbapenemases producing A. baumannii isolate treated with imipenem and sulbactam alone and in combination was analysed by Quantitative Real-Time PCR. Briefly, total RNA was extracted from carbapenemases producing A. baumannii isolate according to the manufacturer’s operating instructions of RNeasy Mini Kit (Qiagen, Hilden, Germany) with slight modifications. The extracted RNA was treated with DNase (Fermentas, USA) to remove genomic DNA. RNA quality was checked by 1.2% (w/v) formaldehyde-denaturing agarose gel electrophoresis. The concentrations and absorbance ratio of RNA at A260/A280 and A260/A230 were measured using the Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE). According to the manufacturer’s protocol, total RNA (0.5 µg) was copied into single-stranded cDNA using Moloney Murine Leukemia Virus (M-MuLV) reverse transcriptase and random hexamer oligonucleotides (Fermentas, USA). A. baumannii blaOXA-51 gene was amplified from the synthesized cDNA with primers designed via Primer3 program. The following sequences of primers were used for blaOXA-51 gene: 5' AATGATCTTGCTCGTGCTTC 3′ (forward), 5′ CATGTCCTTTTCCCATTCTG 3′ (reverse) and 16S rRNA (house-keeping gene): 5' GTGGACGTTACTCGCAGAAT 3' (forward), 5' TCACGCTACACTGGATGCTA 3' (reverse). Real-time PCR was performed using ™SYBR Green qPCR Master Mix (Fermentas, USA) on a Bio-Rad MiniOpticonTM system (USA). Amplification conditions were as follows: 5 min at 95 ºC; 40 cycles of 15 s at 95 ºC, 20 s at 55 ºC and 15 s at 72 ºC. Melting curve analysis was performed in the range of 65 ºC to 95 ºC, 0.5 ºC per 5 s increments. The expression levels of blaOXA-51 gene were calculated by comparative Ct method (2−∆Ctformula) after normalization with 16S rRNA gene (Khodavandi et al., 2011; Schmittgen, Livak, 2008).
Ethics
This study was approved by Research Ethics Committee of our institute (Ethical code 14930554962002). The study protocol conformed to the ethical guidelines of the 2008 Declaration of Helsinki.
Statistical analysis
Results are expressed as mean value ± standard error of three independent replicate experiments. All experiments were repeated three times to compensate for possible errors. Statistical analysis was performed using analysis of variance (ANOVA). The comparison two means were calculated using the Tukey's Post hoc test. Values of p< 0.05 were considered significant. Statistical analysis was performed using the SPSS software (version 22; SPSS Inc., Chicago, IL).
RESULTS
A. baumannii clinical isolates were identified by morphological and biochemical methods. Of 258 patients from whom we obtained samples, 56.20% (n=145) were male and 43.80% (n=113) were female. Patients’ age ranged from 14 to 86 years old with a mean of 40.00 ± 0.10 years old. In this study, 50 (19.38%) A. baumannii isolates were identified. Table I shows the results of antibiotic susceptibility of the A. baumannii isolates. All clinical isolates of A. baumannii showed multidrug-resistance (MDR) patterns. Among isolates identified as MDR A. baumannii, 98% (n=49) possible extensively drug-resistant (XDR) and 12% (n=6) possible pandrug-resistant (PDR) were detected. An isolation rate of 24% (n=12) carbapenemases producing A. baumannii were obtained.
Table II summarizes the MIC and FIC values of imipenem and sulbactam alone and in combination against carbapenemases producing A. baumannii isolates. Imipenem/sulbactam combination against carbapenemases producing A. baumannii isolates displayed synergy and partial synergy effects (FIC= 0.313-0.75). All carbapenemases producing A. baumannii isolates were shown to be resistant to imipenem alone with MICs range from 8-32 µg/mL. Sulbactam alone revealed the inhibitory activity against all carbapenemases producing A. baumannii isolates. Imipenem/sulbactam combination significantly (p ≤0.001) reduced the MICs of imipenem and sulbactam against carbapenemases producing A. baumannii isolates.
Gene expression analysis
The expression levels of blaOXA-51 were evaluated to investigate the effect of imipenem/sulbactam combination on the carbapenemases producing A. baumannii isolates. The carbapenemases producing A. baumannii isolates treated with imipenem alone did not induce any significant changes in the expression levels of blaOXA-51 in comparison to untreated control (p = 0.123). The expression levels of blaOXA-51 were down-regulated (p ≤ 0.01) in the carbapenemases producing A. baumannii isolate treated with sulbactam alone and imipenem/sulbactam combination. TheblaOXA-51 gene was found significantly down-regulated by 3.03- and 3.70-fold after treated with MIC and 2× MIC of sulbactam alone, respectively (Tukey’s HSD, p ≤ 0.01). The carbapenemases producing A. baumannii isolate treated with imipenem/sulbactam combination showed a significant down-regulation in the expression levels of blaOXA-51 by 6.67- and 10.00-fold at concentrations of MIC and 2× MIC, respectively (Tukey’s HSD, p ≤ 0.01). The box plots allow comparison of blaOXA-51/16S rRNA ratio at different concentrations of imipenem and sulbactam alone and in combination based on MIC (Figure 1).
Box plots of blaOXA-51/16S rRNA ratio at different concentrations of imipenem and sulbactam alone and in combination based on MIC in carbapenemases producing A. baumannii isolate.
DISCUSSION
Infections caused by antibiotic-resistant A. baumannii are associated with serious mortality and morbidity (Bahador et al., 2015; Manchanda et al., 2010; Safari et al., 2013). The treatment options available for this antibiotic-resistant pathogen are limited. Previous studies demonstrated the efficacy of sulbactam in combination with antibiotics against antibiotic-resistant A. baumannii (Choi et al., 2004; 2006; Fishbain, Peleg, 2010; Viehman et al., 2014). The present study demonstrated that the effectiveness of imipenem/sulbactam combination against carbapenemases producing A. baumannii. Imipenem/sulbactam combination showed synergism and partial synergism with carbapenemases producing A. baumannii.
Based on our results, theA. baumannii presented multidrug-resistant to several different types of antibacterial agents especially to cefotaxime, ceftazidime, imipenem and meropenem. Our study and others have demonstrated carbapenems-resistant in A. baumannii (Bahador et al., 2015; Choi et al., 2004). To determine carbapenemases production in A. baumannii, the phenotypic confirmatory test was performed and interpreted as previously described by CLSI guidelines. Since the enzymatic degradation by β-lactamases is the most common resistance mechanisms of A. baumannii, bacterial cells are physiologically resistance to the β-lactam antibiotics (Handal et al., 2017; Poirel, Nordmann, 2006).
Sulbactam is a β-lactamase inhibitor with antibacterial activity against Acinetobacter species. Sulbactam binds to penicillin-binding proteins (PBPs) of Acinetobacter species, probably leading to bacterial death. However, sulbactam is degraded by the β-lactamases in A. baumannii. In addition, the activity of imipenem is attributed to binding to PBPs (Choi et al., 2004; 2006; McLeod et al., 2018; Penwell et al., 2015). These results suggest that the potent synergic effect of imipenem/sulbactam combination against carbapenemases producing A. baumannii. The affinity of sulbactam for PBP2 and also imipenem for PBP2 of Gram-negative bacteria may be the cause of such synergic effects in carbapenemases producing A. baumannii (Choi et al., 2004; Penwell et al., 2015). Montero et al. (2004) demonstrated that imipenem/sulbactam combination showed the strong bactericidal efficacy in pneumonia infections caused by moderately carbapenem-resistant A. baumannii. Wang et al. (2016) investigated the effect of meropenem, imipenem, sulbactam, colistin and tigecycline alone or in combination on biofilm-embedded carbapenem-resistant and carbapenem-susceptible A. baumannii. In their study, the combination of imipenem/sulbactam exhibited a killing effect against biofilm-embedded carbapenem-resistant and carbapenem-susceptible A. baumannii.
In our study, carbapenemases producing A. baumannii showed obvious expression level changes of blaOXA-51 after exposure to imipenem/sulbactam combination. This variation may be explained by the sulbactam promoting the effects of imipenem, mainly on the PBP2 of A. baumannii (Choi et al., 2004; 2006; McLeod et al., 2018; Penwell et al., 2015). Additionally, sulbactam inhibit A. baumannii carbapenemases may facilitate the binding of imipenem to the PBP2, thereby leading to down-regulation of blaOXA-51 in the carbapenemases producing A. baumannii treated with imipenem/sulbactam combination. In previous studies, blaOXA-51 was found to elucidate their carbapenemase activities in A. baumannii (Handal et al., 2017; Poirel, Nordmann, 2006). Hou, Yang, (2015) found that OXA-51 and OXA-23 were the main multidrug-resistant molecular target genes in A. baumannii. Hu et al. (2007) reported an OXA-66/OXA-51-like carbapenemase that confers imipenem resistance in A. baumannii. Transcriptional profile analysis of the blaOXA-51 in two clonally related isolates of A. baumannii indicated an eight-fold increased expression of blaOXA-51 in the genetic structure containing insertion sequence ISAba1 and ISAba9 compared with ISAba1 alone upstream of this gene (Figueiredo et al., 2009).
CONCLUSION
In summary, thisin vitrostudy found that imipenem/sulbactam combination could be the most effective against carbapenemases producing A. baumannii. Whether these events reflect the potential of imipenem/sulbactam combination for inhibition of blaOXA-51 gene in carbapenemases producing A. baumannii, which differentially expresses specific gene, requires further investigations to identify other probable molecular targets to this drug combination.
Acknowledgement:
The authors are thankful for financial support of this study by the Islamic Azad University of Gachsaran. Results of the current study are part of the MSc thesis (14930554962002).
REFERENCES
- 1 Antunes NT, Lamoureaux TL, Toth M, Stewart NK, Frase H, Vakulenko SB. Class D ß-lactamases: are they all carbapenemases? Antimicrob Agents Chemother. 2014;58(4):2119-25.
- 2 Bahador A, Raoofian R, Pourakbari B, Taheri M, Hashemizadeh Z, Hashemi FB. Genotypic and antimicrobial susceptibility of carbapenem-resistant Acinetobacter baumannii: analysis of is Aba elements and bla OXA-23-like genes including a new variant. Front Microbiol. 2015;6:1249.
- 3 Biglari S, Hanafiah A, Mohd Puzi S, Ramli R, Rahman M, Lopes BS. Antimicrobial resistance mechanisms and genetic diversity of multidrug-resistant Acinetobacter baumannii isolated from a teaching hospital in Malaysia. Microb Drug Resist. 2017;23(5):545-55.
- 4 Brown S, Young HK, Amyes SG. Characterisation of OXA-51, a novel class D carbapenemase found in genetically unrelated clinical strains of Acinetobacter baumannii from Argentina. Clin Microbio Infect. 2005;11(1):15-23.
- 5 Bush K. Proliferation and significance of clinically relevant ß-lactamases. Ann N Y Acad Sci. 2013;1277:84-90.
- 6 Chen LK, Kuo SC, Chang KC, Cheng CC, Yu PY, Chang CH, Chen TY, Tseng CC. Clinical antibiotic-resistant Acinetobacter baumannii strains with higher susceptibility to environmental phages than antibiotic-sensitive strains. Sci Rep. 2017;7(1):6319.
- 7 Choi JY, Park YS, Cho CH, Park YS, Shin SY, Song YG, Yong D, Lee K, Kim JM. Synergic in-vitro activity of imipenem and sulbactam against Acinetobacter baumannii. Clin Microbiol Infect. 2004;10(12):1098-101.
- 8 Choi JY, Kim CO, Park YS, Yoon HJ, Shin SY, Kim YK, Kim MS, Kim YA, Song YG, Yong D, Lee K, Kim JM. Comparison of efficacy of cefoperazone/sulbactam and imipenem/cilastatin for treatment of Acinetobacter bacteremia. Yonsei Med J. 2006;47(1):63-9.
- 9 Clinical Laboratory Standards Institute (CLSI). Methods for Dilution Antibacterial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard, Tenth Edition. Document M07-A10. Wayne, USA, 2015.
- 10 Clinical Laboratory Standards Institute (CLSI). Performance Standards for Antibacterial Disk Susceptibility Tests; Approved Standard, Twelfth Edition. Document M02-A12. Wayne, USA, 2015.
- 11 Clinical Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing; Supplement M100-S27. Wayne, USA, 2017.
- 12 Da Silva GJ, Domingues S. Insights on the horizontal gene transfer of carbapenemase determinants in the opportunistic pathogen Acinetobacter baumannii. Microorganisms. 2016;4(3):pii: E29.
- 13 Diene SM, Rolain JM. Carbapenemase genes and genetic platforms in Gram-negative bacilli: Enterobacteriaceae, Pseudomonas and Acinetobacter species. Clin Microbiol Infect. 2014;20(9):831-8.
- 14 Evans BA, Hamouda A, Towner KJ, Amyes SG. OXA-51-like beta-lactamases and their association with particular epidemic lineages of Acinetobacter baumannii. Clin Microbiol Infect. 2008;14(3):268-75.
- 15 Figueiredo S, Poirel L, Papa A, Koulourida V, Nordmann P. Overexpression of the naturally occurring blaOXA-51 gene in Acinetobacter baumannii mediated by novel insertion sequence ISAba9. Antimicrob Agents Chemother. 2009;53(9):4045-7.
- 16 Fishbain J, Peleg AY. Treatment of Acinetobacter infections. Clin Infect Dis. 2010;51(1):79-84.
- 17 Fritzenwanker M, Imirzalioglu C, Herold S, Wagenlehner FM, Zimmer KP and Chakraborty T. Treatment options for carbapenem-resistant gram-negative infections. Dtsch Arztebl Int. 2018;115(20-21):345-52.
- 18 Ghajavand H, Esfahani BN, Havaei SA, Moghim S, Fazeli H. Molecular identification of Acinetobacter baumannii isolated from intensive care units and their antimicrobial resistance patterns. Adv Biomed Res. 2015;24:110.
- 19 Handal R, Qunibi L, Sahouri I, Juhari M, Dawodi R, Marzouqa H, Hindiyeh M. Characterization of carbapenem-resistant Acinetobacter baumannii strains isolated from hospitalized patients in Palestine. Int J Microbiol. 2017;2017:8012104.
- 20 Higgins PG, Pérez-Llarena FJ, Zander E, Fernández A, Bou G, Seifert H. OXA-235, a novel class D ß-lactamase involved in resistance to carbapenems in Acinetobacter baumannii. Antimicrob Agents Chemother. 2013;57(5):2121-6.
- 21 Hou C, Yang F. Drug-resistant gene of blaOXA-23, blaOXA-24, blaOXA-51 and blaOXA-58 in Acinetobacter baumannii. Int J Clin Exp Med. 2015;8(8):13859-63.
- 22 Hu WS, Yao SM, Fung CP, Hsieh YP, Liu CP, Li JF. An OXA-66/OXA-51-like carbapenemase and possibly an efflux pump are associated with resistance to imipenem in Acinetobacter baumannii. Antimicrob Agents Chemother. 2007;51(11):3844-52.
- 23 Karam G, Chastre J, Wilcox MH, Vincent JL. Antibiotic strategies in the era of multidrug resistance. Crit Care. 2016;20(1):136.
- 24 Khodavandi A, Alizadeh F, Aala F, Sekawi Z, Chong PP. In vitro investigation of antifungal activity of allicin alone and in combination with azoles against Candida species. Mycopathologia. 2010;169(4):287-95.
- 25 Khodavandi A, Harmal NS, Alizadeh F, Scully OJ, Sidik SM, Othman F Sekawi Z, Ng KP, Chong PP. Comparison between allicin and fluconazole in Candida albicans biofilm inhibition and in suppression of HWP1 gene expression. Phytomedicine. 2011;19(1):56-63.
- 26 Lin MF, Lan CY. Antimicrobial resistance in Acinetobacter baumannii: from bench to bedside. World J Clin Cases. 2014;2(12):787-814.
- 27 Manchanda V, Sanchaita S, Singh N. Multidrug resistant Acinetobacter. J Glob Infect Dis. 2010;2(3):291-304.
- 28 McLeod SM, Shapiro AB, Moussa SH, Johnstone M, McLaughlin RE, de Jonge BLM, Miller AA. Frequency and mechanism of spontaneous resistance to sulbactam combined with the 2 novel ß-lactamase inhibitor ETX2514 in clinical isolates of Acinetobacter baumannii. Antimicrol Agents Chemother. 2018;62(2):pii:e01576-17.
- 29 Montero A, Ariza J, Corbella X, Doménech A, Cabellos C, Ayats J, Tubau F, Borraz C, Gudiol F. Antibiotic combinations for serious infections caused by carbapenem-resistant Acinetobacter baumannii in a mouse pneumonia model. J Antimicrob Chemother. 2004;54(6):1085-91.
- 30 Papp-Wallace KM, Endimiani A, Taracila MA, Bonomo RA. Carbapenems: past, present, and future. Antimicrob Agents Chemother. 2011;55(11):4943-60.
- 31 Penwell WF, Shapiro AB, Giacobbe RA, Gu RF, Gao N, Thresher J, McLaughlin RE, Huband MD, DeJonge BL, Ehmann DE, Miller AA. Molecular mechanisms of sulbactam antibacterial activity and resistance determinants in Acinetobacter baumannii. Antimicrob Agents Chemother. 2015;59(3):1680-9.
- 32 Perez F, Hujer AM, Hujer KM, Decker BK, Rather PN, Bonomo RA. Global challenge of multidrug-resistant Acinetobacter baumannii. Antimicrob Agents Chemother. 2007;51(10):471-84.
- 33 Poirel L, Nordmann P. Carbapenem resistance in Acinetobacter baumannii: mechanisms and epidemiology. Clin Microbiol Infect. 2006;12(9):826-36.
- 34 Safari M, Saidijam M, Bahador A, Jafari R, Alikhani MY. High prevalence of multidrug resistance and metallo-beta-lactamase (MBL) producing Acinetobacter baumannii isolated from patients in ICU wards, Hamadan, Iran J Res Health Sci. 2013;13(2):162-7.
- 35 Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008;3(6):1101-8.
- 36 Spellberg B, Bonomo RA. Combination therapy for extreme drug-resistant Acinetobacter baumannii: ready for prime time? Crit Care Med. 2015;43(6):1332-4.
- 37 van der Zwaluw K, de Haan A, Pluister GN, Bootsma HJ, de Neeling AJ, Schouls LM. The carbapenem inactivation method (CIM), a simple and low-cost alternative for the Carba NP test to assess phenotypic carbapenemase activity in Gram-negative rods. PLOS One. 2015;10(3):e0123690.
- 38 Viehman JA, Nguyen MH, Doi Y. Treatment options for carbapenem-resistant and extensively drug-resistant Acinetobacter baumannii infections. Drugs 2014;74(12): 1315-33.
- 39 Walther-Rasmussen J, Hoiby N. OXA-type carbapenemases. J Antimicrob Chemother. 2006;57(3):373-83.
- 40 Wang YC, Kuo SC, Yang YS, Lee YT, Chiu CH, Chuang MF, Lin JC, Chang FY, Chen TL. Individual or combined effects of meropenem, imipenem, sulbactam, colistin, and tigecycline on biofilm-embedded Acinetobacter baumannii and biofilm architecture. Antimicrob Agents Chemother. 2016;60(8):4670-6.


