Accessibility / Report Error
Ciência Animal Brasileira, Volume: 14, Issue: 3, Published: 2013
  • Performance of castrated kid goats treated with calendula and associations Produção Animal

    Ferreira, Sérgio Fernandes; Oliveira, Erica Bertha Führich Raupp Bezerra de Mello; Fonseca, Carlos Elysio Moreira da; Ferreira, Maria Ignez Carvalho; Morenz, Mirton José Frota

    Abstract in Portuguese:

    O objetivo do presente experimento foi avaliar as respostas de desempenho de caprinos castrados, submetidos a dois tratamentos da ferida cirúrgica: tratamento convencional com pomada à base de óxido de zinco, óleo de pinho, caulim e xilol e spray à base de permetrina, fenoxibenzil e DDVP (diclorvós) e tratamento alternativo com uso de fitoterápico com pomada à base de extrato de Calendula offcinalis e associações. Foram utilizados doze cabritos sem raça definida com peso inicial médio de 15,5 kg, criados em confinamento total, separados em dois grupos dispostos em delineamento inteiramente casualizado para constituir dois tratamentos com seis repetições cada, visando comparar o desempenho dos animais tratados de forma convencional em relação ao tratamento com extrato de Calendula offcinalis e associações. Empregada a técnica de orquiectomia (castração) por abertura da bolsa escrotal e com cordão espermático descoberto no dia 0, os dois grupos foram tratados até a completa cicatrização da ferida cirúrgica no 51º dia de experimentação. As medidas biométricas analisadas foram ganho de peso (kg), ganho de altura de cernelha (cm), ganho de altura de garupa (cm), ganho de perímetro torácico (cm) e escore de condição corporal. Os resultados foram analisados pelo pacote estatístico SAEG e teste de Tukey (P>0,05). Não houve diferença significativa entre os tratamentos (P>0,05) para nenhum dos parâmetros analisados. Todas as características biométricas, à exceção do escore corporal, aumentaram no período de avaliação. Não houve impacto negativo no uso de fitoterápico em relação às características observadas.

    Abstract in English:

    The purpose of this experiment was to evaluate the performance responses of castrated goats, submitted to two surgical wound treatments: conventional treatment with ointment made of zinc oxide, pine oil, kaolin and xylene and permethrin, phenoxybenzyl and DDVP spray (dichlorvos) and alternative phytotherapic treatment using herbal medicine with ointment made of Calendula offcinalis extract and associations. Twelve undefined breed goats with an average initial weight of 15.5 kg, raised in total confinement, were separated into two groups and arranged in a completely randomized design to constitute two treatments with six replicates each, in order to compare the performance of animals treated conventionally and with Calendula offcinalis extract and associations. We employed the orchiectomy (castration) technique by opening the scrotum and spermatic cord on day 0, and both groups were treated until complete healing of the surgical wound on the 51st day of trial. We analyzed the following biometric parameters: weight gain (kg), withers height gain (cm), croup height gain (cm), thotacic perimeter gain (cm) and body condition score. The results were analyzed using the Statistical Package SAEG and Tukey's test (P> .05). There was no significant difference between treatments (P> 0.05) for any of the parameters analyzed. All biometric characteristics, with the exception of body condition, increased during the evaluation period. There was no negative impact of the use of herbal medicine on the characteristics observed.
  • Effect of high stocking densities on growth and survival of Litopenaeus vannamei in final growout phase, reared in biofloc technology (BFT) system Produção Animal

    Silva, Adriana Ferreira; Lara, Gabriele Rodrigues; Ballester, Eduardo Cupertino; Krumennauer, Dariano; Abreu, Paulo Cesar; Wasielesky Jr, Wilson

    Abstract in Portuguese:

    O objetivo deste estudo foi avaliar o efeito de altas densidades de estocagem na sobrevivência, crescimento e na taxa de conversão alimentar de camarões Litopenaeus vannamei, na fase final de engorda em sistema de Biofloc Technology (BFT), mantendo os mesmos parâmetros de água para todos os tratamentos. Os camarões (11,96 ± 1,14g) foram estocados em microcosmos (tanques de 0,50 m²), conectados a um raceway de cultivo BFT. O experimento teve duração de 45 dias. Os camarões foram estocados nas densidades de 150, 300, 450 e 600 camarões/m². Bioflocos foram coletados para análise de composição proximal. Os resultados foram submetidos à ANOVA uma via e as diferenças foram comparadas pelo teste de Tukey (α = 0.05). No T300 e T450, o crescimento e sobrevivência dos camarões não foram afetados pelas altas densidades. A maior biomassa alcançada (T450) foi de 5,1 kg/m² e a melhor conversão alimentar foi de 1,54 no T150. Os resultados deste estudo indicam que as densidades de estocagem no sistema proposto podem ser elevadas, mas não superiores a 450 camarões/m². Observou-se ainda que mesmo se a qualidade de água for mantida igual para todos os tratamentos, há efeito negativo entre densidade e crescimento dos camarões, confirmando que esse efeito é comportamental.

    Abstract in English:

    The aim of this study was to evaluate the effect of high stocking densities on survival, growth and feed conversion rates of Litopenaeus vannamei shrimp, in final growout phase, in a Biofloc Technology (BFT) culture system, keeping the same water parameters for all treatments. Shrimps (11.96 ± 1.14 g) were stocked in microcosms (0.50/m² tanks), connected to a BFT system raceway. The study was carried out for 45 days. The shrimp were stocked at densities of 150, 300, 450 and 600 shrimp/m². Bioflocs were collected for analysis of proximate composition. The results were submitted to one-way ANOVA, and differences were compared by Tukey test (α = 0.05). In T300 and T450, growth and survival were not affected by high stocking densities. The highest biomass reached (T450) was 5.1kg/m² and the best feed conversion rate was 1.54 in T150. The results of this study indicate that stocking densities in the proposed system can be high, but not exceeding 450 shrimp/m². Furthermore, even maintaining the same water parameters for all treatments, there was a negative effect between density and shrimp growth, confirming that this effect is behavioral.
  • Doses and sources of nitrogen on yield and bromatological composition of xaraés grass

    Costa, Kátia Aparecida de Pinho; Severiano, Eduardo da Costa; Silva, Fabiano Guimarães; Borges, Elenildo Ferreira; Epifânio, Patrícia Soares; Guimarães, Kátia Cylene

    Abstract in Portuguese:

    O objetivo do trabalho foi avaliar o efeito de doses e fontes de nitrogênio na produção de massa seca e composição bromatológica do capim-xaraés em diferentes estações do ano. O experimento foi conduzido no Campus da Faculdade de Agronomia da Universidade de Rio Verde, no período de outubro de 2008 a janeiro de 2010. O delineamento experimental utilizado foi em blocos completos ao acaso, em esquema fatorial 2 x 4, com medidas repetidas no tempo, com quatro repetições. Foram testadas duas fontes de nitrogênio (sulfato de amônio e uréia) e quatro doses de nitrogênio (0, 200, 400 e 600 kg ha-1). As avaliações foram realizadas durante o ano, nas estações de outono, inverno, primavera e verão, nas mesmas parcelas. Os resultados demonstraram que a máxima produção de massa seca e teores de PB do capim-xaraés nas fontes de ureia e sulfato de amônio foram estimados nas doses de 500 e 472 kg ha-1 e de 407 e 396 kg ha-1 de N, respectivamente. E para os teores de NDT a dose máxima foi de 404,74 kg ha-1 de N, na fonte de sulfato de amônio. Esse resultado indica que independente da fonte nitrogenada, a aplicação de doses crescentes de até 400 kg ha-1 de nitrogênio no capim-xaraés é suficiente para manter uma alta produção de massa seca, associada ao valor nutritivo da forragem. A fonte de sulfato de amônio mostrou maior eficiência na produção de massa seca do capim-xaraés nas estações analisadas.

    Abstract in English:

    This study evaluated the effect of nitrogen sources and doses on dry matter yield and bromatological composition of xaraés grass throughout the year. The experiment was carried out at the Agronomy Faculty of Rio Verde University from October 2008 to January 2010. The experiment consisted of a randomized complete block design in a 2 x 4 factorial arrangement with measures repeated in time, and four replications. We tested two nitrogen sources (ammonium sulfate and urea) and four nitrogen levels (0, 200, 400 and 600 kg ha-1). The evaluations were conducted on the same plots throughout the year and during all four seasons (autumn, winter, spring, and summer). The results demonstrated that the maximum grass production of dry matter and crude protein of xaraés grass for the sources of urea and ammonium sulfate were estimated at doses of 500 and 472 kg ha-1 and 407 and 396 kg N ha-1, respectively. And for TDN level the maximum dose was 404.74 kg ha-1 N, for the source of ammonium sulfate. This result indicates that, regardless of the source, the application of increasing doses of up to 400 kg ha-1 of nitrogen in xaraés grass is sufficient to maintain a high dry matter production, associated with the nutritional value of the forage. The source ammonium sulfate demonstrated higher efficacy for xaraés grass dry matter production in the seasons evaluated, however additional studies are needed to evaluate the economical feasibility of its use.
  • Inclusion of different sources of starch in diet for jundiá (Rhamdia quelen): metabolic and biochemical parameters Produção Animal

    Lovatto, Naglezi de Menezes; Goulart, Fernanda Rodrigues; Correia, Viviani; Ferreira, Cristiano Costenaro; Silva, Leila Picolli da; Radünz Neto, João

    Abstract in Portuguese:

    O presente estudo foi conduzido com o objetivo de avaliar a influência da ingestão de diferentes fontes de amido sobre indicadores metabólicos e enzimáticos em sangue e fígado de jundiás. O experimento foi realizado durante 20 dias, em sistema de recirculação de água. Foram utilizados 60 peixes (peso médio inicial de 60±4g), divididos em três tratamentos, compostos por dietas com inclusão de aveia descascada; farelo de arroz desengordurado e uma dieta controle, todas com 37% PB e 3200 Kcal ED/Kg. Não houve diferença significativa para os parâmetros de crescimento. As análises hepáticas demonstraram redução no teor de glicogênio para o tratamento que continha aveia; no entanto, sem alterações aparentes na atividade das enzimas alanina-aminotransferase e glicose-6-fosfatase. Quanto às análises sanguíneas, não foram observadas diferenças significativas nas determinações de colesterol total, colesterol HDL e albumina, porém, os níveis séricos de proteínas totais foram maiores para o tratamento com farelo de arroz desengordurado e os níveis de triglicerídeos foram menores nos animais que receberam dieta contendo aveia como fonte amídica. Pode-se concluir que o jundiá é capaz de metabolizar diferentes fontes de carboidrato, sem a necessidade de utilizar a proteína, tanto da dieta quanto a corporal, como fonte de energia.

    Abstract in English:

    This study was conducted to evaluate the influence of ingestion of different sources of starch on enzymatic and metabolic indicators in blood and liver of Rhamdia quelen. The experiment was conducted during 20 days in water recirculation system. Sixty fishes (initial average weight 60g) were used and divided into three treatments composed of the following diets: inclusion of peeled oats, defatted rice bran and control diet, all with 36% crude protein and 3,200 Kcal DE/Kg. There was no significant difference in growth parameters. The analysis demonstrated a reduction in liver glycogen content for the treatment with oats; however, no apparent changes in the activity of the enzymes alanine-aminotransferase and glucose-6-phosphatase were observed, raising the possibility that the fishes did not use gluconeogenesis. The blood analysis, showed no significant differences in the determinations of total cholesterol, HDL cholesterol and albumin; however, serum levels of total protein were higher for treatment with defatted rice bran, and triglyceride levels were lower in animals that received diet containing oat as starch source. It can be concluded that Rhamdia quelen is able to metabolize various sources of carbohydrate, without the need to use either diet or body protein as an energy source.
  • Monitoring of toxigenic fungi and aflatoxins in rations used in aquaculture Produção Animal

    Cardoso Filho, Francisco das Chagas; Calvet, Rodrigo Maciel; Rosa, Carlos Alberto da Rocha; Pereira, Maria Marlúcia Gomes; Costa, Amilton Paulo Raposo; Muratori, Maria Christina Sanches

    Abstract in Portuguese:

    Objetivou-se determinar a ocorrência de fungos e aflatoxinas em rações para peixes. Foram analisadas 36 amostras de ração para peixes, sendo essas com duas composições proteicas (juvenil/engorda) e em duas formas de uso (lacrado/aberto). Foi realizada a contagem, isolamento e a identificação das espécies de Aspergillus e Penicillium, a capacidade toxígena das cepas da seção Flavi, e ainda fez-se a pesquisa de aflatoxinas na ração. As médias das contagens fúngicas variaram de 2,96 a 4,00 UFC/g em log10, e não houve diferença significativas entre os tratamentos. As espécies mais isoladas foram: Aspergillus flavus, Eurotion spp. e Penicillium implicatum. Concluiu-se que as rações analisadas apresentaram elevadas contagens fúngicas, as cepas de Aspergillus flavus isoladas não eram produtoras de aflatoxinas e não foram detectadas aflatoxinas nas amostras de ração analisadas.

    Abstract in English:

    The aim of this study was to determine the occurrence of fungi and aflatoxins in fish feeds. We analyzed 36 samples of feed for fish, with two protein compositions (juvenile/fattening) and two forms of use (sealed/open). Aspergillus and Penicillium species were counted, isolated and identified, the toxic capacity of Flavi strains was measured and aflatoxins in the feed were researched. The mean fungal counts ranged from 2.96 to 4.00 log10 CFU/g and there was no significant difference between treatments. The most isolated species were Aspergillus flavus, Eurotion spp. and Penicillium implicatum. We concluded that the feeds studied had high fungal counts; the isolated Aspergillus flavus strains were not producers of aflatoxin; and aflatoxin was not detected in the feed samples analyzed.
  • Correlation between biometric and production parameters in colonies of Melipona quadrifasciata anthidioides Lepeletier (Hymenoptera: Apidae) Produção Animal

    Faquinello, Patricia; Brito, Baden Bell Pereira; Carvalho, Carlos Alfredo Lopes de; Paula-Leite, Meiby Carneiro de; Alves, Rogerio Marcos de Oliveira

    Abstract in Portuguese:

    Em colônias de melíponas, características biométricas podem estar associadas às características de produção; portanto, o estudo da correlação é de grande valia como ferramenta para o processo de seleção de colônias. O objetivo deste trabalho foi estimar as correlações entre os parâmetros biométricos e produtivos de Melipona quadrifasciata anthidioides. Foram analisadas 128 colônias, provenientes de 60 colônias parentais e duas gerações, F1 e F2. Os parâmetros avaliados foram: peso da rainha e colônia; número, largura e comprimento dos discos de cria; número, largura, profundidade e volume dos potes de mel; número, largura e profundidade dos potes de pólen; tamanho da glossa e a estimativa da população e da produção de mel. O peso da rainha apresentou correlação com o número de discos de cria (0,23), da população (0,23), da mesma forma que a característica de número de potes de pólen está relacionada com largura e comprimento dos discos de cria e população (0,88; 0,54 e 0,52, respectivamente). A característica produção de mel está relacionada com o número (0,93), largura (0,50) e volume (0,47) dos potes de mel. Os resultados mostraram que a produção de mel está correlacionada diretamente com as características de número, volume, diâmetro e altura dos potes de mel. Por outro lado, o tamanho da população demonstrou estar correlacionada com o número dos discos de cria e o número dos potes de pólen.

    Abstract in English:

    In meliponini colonies, biometric characteristics may be associated with production traits, thus the study of correlations is extremely useful as a tool for colony selection process. The aim of this study was to estimate the correlations between biometric and productive parameters of Melipona quadrifasciata anthidioides. We analyzed 128 colonies, from 60 parental and two generations, F1 and F2. The following parameters were evaluated: queen and colony weight; number, length and width of brood disks; number, width, depth and volume of honey pots; number, width and depth of pollen pots; glossa size, and estimate of the population and honey production. The queen weight was correlated with the number of brood disks (0.23) and population (0.23), as well as the characteristic number of pollen pots is related to the length and width of brood disks and population (0.88, 0.54 and 0.52, respectively). The characteristic honey production is related to the number (0.93), width (0.50) and volume (0.47) of honey pots. The results showed that honey production is directly correlated with number, volume, width and depth of honey pots. On the other side, the population size was correlated with the number of brood disks and pollen pots.
  • Replacement of fish meal by poultry viscera meal in the feed of Leporinus macrocephalus Produção Animal

    Schwertner, Volnei; Diemer, Odair; Higuchi, Leticia Hayashi; Klein, Sidnei; Boscolo, Wilson Rogério; Feiden, Aldi

    Abstract in Portuguese:

    O presente estudo teve como objetivo avaliar o desempenho produtivo de alevinos de piavuçu, alimentados com diferentes níveis de inclusão de farinha de vísceras de aves na substituição da farinha de peixe. O experimento foi conduzido em uma estufa localizada na Universidade Estadual do Oeste do Paraná durante um período de 45 dias. Foram utilizados 200 alevinos com comprimento inicial médio de 4,7 ± 0,37 cm e peso inicial médio de 1,407 ± 0,03 g, distribuídos em 20 tanques-redes. O delineamento experimental foi inteiramente casualizado com cinco tratamentos e quatro repetições com cinco níveis de substituição de farinha de peixe por farinha de vísceras de aves (0, 25, 50, 75, 100%). Os parâmetros avaliados foram o desempenho produtivo e a composição química dos animais. A inclusão de farinha de vísceras de aves na substituição da farinha de peixe na alimentação de alevinos de piavuçu pode ser realizada sem comprometer o desempenho zootécnico dos animais.

    Abstract in English:

    The present study aimed at evaluating the productive performance of Leporinus macrocephalus fed with different levels of inclusion of poultry viscera meal replacing fish meal. The experiment was conducted in a stove located in the Universidade Estadual do Oeste do Paraná during 45 days. We used 200 fish with average initial length of 4.7 ± 0.37 cm and average initial weight of 1.407 ± 0.03 g, distributed in 20 net-cages. The experimental design was randomized with five treatments and five replicates with five levels of replacement of fish meal by poultry viscera meal (0, 25, 50, 75, 100%). The parameters evaluated were the productive performance and the chemical composition of animals. The inclusion of poultry viscera meal in the substitution of fish meal in the feeding of Leporinus macrocephalus can be used without impairing the performance of the animals.
  • Behavioral parameters of cull cows grazing millet or sudan grass Produção Animal

    Pacheco, Rangel Fernandes; Alves Filho, Dari Celestino; Brondani, Ivan Luiz; Restle, João; Pizzuti, Luiz Angelo Damian; Cattelam, Jonatas

    Abstract in Portuguese:

    Objetivou-se com este estudo avaliar os parâmetros comportamentais e as estratégias de deslocamento e alimentação de vacas de descarte em pastagens de milheto ou capim sudão. Os tratamentos consistiram em: pastagem de milheto (Pennisetum americanum (L.) Leeke) ou pastagem de capim sudão (Sorghum bicolor cv. sudanense), ambos tratamentos submetidos ao pastejo contínuo de vacas de descarte, ao longo de 63 dias experimentais, subdividido em três períodos. Foram utilizadas 20 vacas de descarte cruza Charolês x Nelore, de idade média de 8 anos e peso vivo médio inicial de 445 kg. Os animais foram distribuídos em 10 piquetes, sendo utilizados cinco piquetes para cada tratamento comportando duas vacas. As avaliações comportamentais foram realizadas durante 24 horas ininterruptas. O delineamento experimental foi inteiramente casualizado com 2 tratamentos e 3 períodos de avaliação. O tempo de pastejo das vacas apresentou interação (P=0,0035) entre tratamento e período, sendo o menor tempo destinado à atividade no primeiro período na pastagem de milheto (504 minutos) comparado com o segundo período desse mesmo tratamento (587 minutos) e terceiro período nas pastagens de capim sudão (535 minutos). Os tempos de ruminação e ócio foram semelhantes entre os tratamentos; no entanto, o de ócio diminuiu e o de ruminação aumentou com o avanço dos períodos. As espécies de forrageiras não influenciaram as variáveis relacionadas às estratégias de deslocamento e alimentação. Com o avanço do ciclo das pastagens, o número de passos por minuto, estações por minuto e por dia diminuíram enquanto a taxa de bocado e número de bocados por dia aumentaram. Os parâmetros comportamentais de vacas de descarte em pastagens de milheto ou capim sudão são similares; no entanto, o avanço do ciclo vegetativo dessas espécies proporciona modificações no padrão comportamental dos animais.

    Abstract in English:

    The objective of this study was to evaluate the behavioral parameters and strategies of displacement and feeding of cull cows grazing millet or sudan grass. The treatments consisted of: pearl millet (Pennisetum americanum (L.) Leeke) or sudan grass (Sorghum bicolor cv. Sudanense). Both treatments were submitted to continuous grazing of cull cows over 63 experimental days subdivided into three periods. Using 20 Charolais x Nellore cull cows, at the average age of 8 years and average weight of 445 kg. The animals were divided into 10 paddocks, five paddocks used for each treatment comprising two cows. The behavioral assessments were carried out for 24 hours straight. The experimental design was completely randomized with two treatments and three periods. The grazing time of cows showed interaction (P = 0.0035) between treatment and period, and the shortest time for the activity in the first period on pearl millet (504 minutes) compared to the second period of that same treatment (587 minutes) and the third period on sudan grass pastures (535 minutes). The times of rumination and idling were similar between treatments; however, the idling time decreased and rumination increased with time periods. The forage species did not affect the variables related to the strategies of displacement and feeding. With the advancement of cycle pastures the number of steps per minute, stations per minute and per day decreased while the bite rate and the number of bites per day increased. The behavioral parameters of cull cows grazing sudan grass or millet are similar; however, the advancement of the vegetative cycle of these species provides changes in the behavioral pattern of the animals.
  • Identification of bacteria in the semen in different breeding systems and the effect of Kilol-L® Medicina Veterinária

    Fernandes, Gabriela de Oliveira; Leal, Diogo Ramos; Moreira, Nathalia Hack; Silva, Thiago Antonio de Souza Nascimento; Ramos, Alexandre Floriani; Neves, Jairo Pereira

    Abstract in Portuguese:

    O objetivo deste trabalho foi identificar e quantificar as bactérias do sêmen fresco de ovino, avaliar o uso do higienizante Kilol-L® antes da coleta do sêmen e testar a sensibilidade das cepas bacterianas frente ao antibiograma. Foram selecionados 24 ovinos machos, clinicamente sadios, com idade média de quatro anos, da raça Santa Inês, agrupados em dois sistemas de criação: a pasto (n=12) e confinamento (n=12). Dos 120 ejaculados coletados, 99 tiveram crescimento bacteriano correspondendo a 82,5% das amostras. Os gêneros bacterianos isolados com maior frequência foram Staphylococcus spp., Bacillus spp., Streptococcus spp., Corynebacterium spp., Listeria spp.e Escherichia coli. Dos antibióticos testados, a amicacina e a gentamicina foram 100% eficazes para Bacillus spp. e E. coli. O ceftiofur foi efetivo para todas as bactérias isoladas, exceto Rodococcus equi. Streptococcus spp. foram sensíveis à ampicilina e eritromicina, Staphylococcus spp. foram sensíveis à gentamicina. O uso Kilol-L® reduziu o número de unidades formadoras de colônias (UFC/mL) do ejaculado sem prejudicar a sua qualidade. Dos antibióticos testados, ceftiofur e gentamicina foram os mais efetivos frente às cepas bacterianas isoladas. Dessa forma, a utilização desses antibióticos no meio diluidor do sêmen ovino é uma alternativa para controlar o crescimento bacteriano.

    Abstract in English:

    The objective of this study was to identify and quantify bacteria from fresh ram semen, evaluate the use of sanitizer Kilol-L® prior to semen collection, and test the sensitivity of bacterial strains against antibiotics. We selected 24 Santa Inês rams clinically healthy, at 4 years of aged, and grouped them into two systems: on pasture (n=12) and confined (n=12). The microbiological results indicated that of the total of 120 ejaculates, 99 had bacterial growth, representing 82.5% of the samples. The most frequently isolated bacteria were Bacillus spp., Corynebacterium spp., Escherichia coli, Listeria spp., Staphylococcus spp., and Streptococcus spp. From the tested antibiotics, amicacin and gentamicin were 100% effective for Bacillus spp. and E. Coli. Ceftiofur was effective for all isolates except for Rodococcus equi. Streptococcus spp. were susceptible to ampicillin and erythromycin and Staphylococcus spp. were sensitive to gentamycin. The use of Kilol-L® reduced the number of Colony Forming Units (CFU/mL) from ejaculate without damaging semen quality. From the tested antibiotics, ceftiofur and gentamicin were more effective against the isolated bacterial strains; thus the use of these antibiotics in the ram semen extender is an alternative to control bacterial growth.
  • Morphological characteristics of the spermatic funicle between goats with or withought scrotal bipartition Medicina Veterinária

    Nunes, Aline Soares; Conde Júnior, Aírton Mendes; Ferraz, Maíra Soares; Machado Júnior, Antônio Augusto Nascimento; Schroder, Deise Cristine; Carvalho, Maria Acelina Martins

    Abstract in Portuguese:

    Estudou-se a morfologia do funículo espermático em caprinos com escroto bipartido e não bipartido. Foram formados três grupos de caprinos: I - escroto não bipartido; II - escroto bipartido até 50% do comprimento testicular; e III - escroto bipartido acima de 50% do comprimento testicular. O comprimento do funículo espermático, o músculo cremáster, o segmento da artéria testicular do funículo e histologia do funículo espermático foram avaliados. Em todos os grupos, a artéria testicular mostrou-se única (95%) ou dividida (5%), rodeada por veias sem válvulas e com diâmetros variados e irregulares. No grupo I, o tecido adiposo subcapsular envolvia as veias, fato não observado nos demais grupos. Nos grupos II e III, esse tecido apresentou-se em placas, circundando o funículo, tornando-se mais espesso próximo ao mesoducto, sugerindo isolamento térmico entre os vasos e o ducto deferente. Os caprinos do grupo III apresentaram maior comprimento do funículo (média=10,25cm) e da artéria testicular (média=152,80cm), em comparação com os grupos I (8,06 e 103,25 cm) e II (8,60 e 121,80 cm). Esse fato pode favorecer as trocas térmicas entre sangue arterial e venoso. O comprimento do músculo cremáster não diferiu estatisticamente (P>0,05) entre os grupos I (19,37cm), II (18,61cm) e III (20,06cm). Desse modo, concluiu-se que a bipartição escrotal proporciona variações no funículo espermático de caprinos.

    Abstract in English:

    We studied the morphology of the spermatic funicle in goats according to their scrotum conformation. Animals were divided into three experimental groups: I - non-bipartite scrotum; II - bipartite scrotum up to 50% of testicular length; and III - bipartite scrotum over 50% of testicular length. We evaluated the length of the spermatic funicle, cremaster muscle, the segment of the umbilical artery and spermatic funicle histology. In all groups the testicular artery was found to be single (95%) or divided (5%), surrounded by numerous veins without valves and varied and irregular diameters. In group I, the subcapsular adipose tissue was involving the veins. In groups II and III, this tissue was showed as plates surrounding the funicle, becoming thicker near the mesoductus, suggesting the presence of thermal insulation between the vessels and the vas deferens. We found that goats from group III showed greater length of funiculus (mean=10.25cm) and testicular artery (mean=152.80 cm), in comparison with groups I (8.06 and 103.25 cm) and II (8.60 and 121.80 cm). This may facilitate heat exchange between arterial and venous blood. The length of the cremaster muscle did not differ statistically (P>0.05) between groups I (19.37 cm), II (18.61) and III (20.06 cm).
  • Microbiological and physico-chemical evaluation of pork leg treated with organic acids and/or steam under pressure in the control of surface contamination by Salmonella Typhimurium Medicina Veterinária

    Machado, Andréa Rosa; Gouveia, Fábio Carvalho; Picinin, Lídia Cristina Almeida; Kich, Jalusa Deon; Cardoso, Marisa Ribeiro de Itapema; Ferraz, Sandra Maria

    Abstract in Portuguese:

    Suínos portadores assintomáticos são o principal fator de risco para a contaminação de carcaças durante o processamento industrial. Diferentes formas de prevenção e controle têm sido testadas no pós abate, dentre elas o uso de vapor e/ou ácidos orgânicos, que podem ser alternativas de baixo custo e alta eficiência. No presente estudo, testou-se o uso de solução de ácidos orgânicos e aplicação de vapor sob pressão, usados isoladamente ou em associação. Como poucas pesquisas trazem informações sobre o fato desses tratamentos promoverem ou não mudanças nas características físico-químicas da carne suína, o presente experimento se propôs também a avaliar as possíveis alterações físico-químicas de pernis submetidos a esses tratamentos. Porções de pernil foram contaminadas artificialmente com Salmonella Typhimurium DT 177 e, posteriormente, divididas em quatro tratamentos: imersão em solução fisiológica por 5 segundos (controle, T1); imersão em solução fisiológica acrescida de ácidos orgânicos 1000 ppm por 5 segundos (T2); aspersão de vapor sob pressão de 4 bar à temperatura de 140ºC (T3); e T3 seguido por T2 (T4). Após o tratamento, uma área de 100cm² foi amostrada por meio de swab para quantificação da Salmonella residual pela técnica do número mais provável (NMP). Foram avaliados também o aspecto, coloração, consistência e odor, antes e após cada tratamento dos pernis, bem como análises físico-químicas visando à determinação do percentual de lipídeos, proteínas, pH, umidade e voláteis, também antes e após cada tratamento. Observou-se que o uso de vapor associado à imersão em solução de ácidos orgânicos a 1000 ppm apresentou melhor eficiência na redução das contaminações superficiais (100% de frequência de redução), porém a melhor eficácia foi observada através da redução de 0,8 log base 10 do NMP na pele e 0,77 log base 10 do NMP na musculatura através do uso de solução fisiológica (T1) e solução de ácidos orgânicos (T2), respectivamente. Os resultados obtidos revelaram que os tratamentos utilizados não interferiram nos atributos físico-químicos, como aspecto, cor, odor e consistência. O tratamento de vapor associado aos ácidos orgânicos diminuiu o pH e aumentou o teor de umidade e voláteis da carne, porém não descaracterizou a qualidade físico-química da carne suína, que permaneceu dentro de seus padrões ideais, apta ao consumo humano.

    Abstract in English:

    Asymptomatic carrier pigs are the main risk factor for carcass contamination during the slaughter. Several post-slaughter prevention programs have been tested, such as organic acids and steam under pressure. These alternatives show low cost and high efficiency. This study tested the use of organic acid solutions and steam, in isolated tests and its associations. This experiment also evaluated the physical-chemistry features of the pork. Forty pork legs were contaminated with Salmonella Typhimurium DT 177 and subsequently divided into 4 treatments: immersion in physiological solution for 5 seconds (control, T1); immersion in physiological solution with 1000 ppm of organic acids for 5 seconds (T2); sprinkling of steam under pressure (4 bar) at 140ºC (T3); and T2 after T3 (T4). An area of 100cm² was sampled through superficial swabs for Salmonella counts by Most Probable Number method (MPN). Aspect, color, consistency, smell, and levels of fat, protein, pH, and moisture were also evaluated before and after each treatment. The use of steam associated to the immersion in organic acid solution showed better efficiency for reduction of superficial contamination (decreasing 100% of counts) but the better effectiveness was observed through the decreasing of 0.8 log of MPN at skin and 0.77 log of MPN at muscle by using the physiological solution (T1) and the organic acid solution (T2), respectively. The steam treatment associated with the organic acid solutions (T4) decreased the pH and increased moisture of pork legs, although it did not mischaracterize the quality (within required parameters for human consumption). All the other treatments did not change physical-chemistry fefatures.
  • Natural poisoning of dairy cattle by Cestrum laevigatum (Solanaceae) in the state of Pernambuco - Brazil Medicina Veterinária

    Coutinho, Luiz Teles; Costa, Nivaldo de Azevêdo; Mendonça, Carla Lopes de; Afonso, José Augusto B.; Riet-Correa, Franklin; Dantas, Antônio Flávio M.; Silva, Nivan Antônio Alves da

    Abstract in Portuguese:

    Este trabalho teve por objetivo relatar um surto de intoxicação natural por Cestrum laevigatum em um rebanho leiteiro no Agreste do Estado de Pernambuco. Foram resgatadas informações epidemiológicas e clínicas. De um lote de 60 vacas, oito adoeceram e, dessas, quatro vieram a óbito e duas foram necropsiadas onde fragmentos de sistema nervoso central, fígado, vesícula biliar, baço e rim foram coletados para análise histopatológica. Foram colhidas amostras de sangue para realização de provas hematológicas e de bioquímica clínica. Os animais apresentavam apatia, tremores musculares, diminuição do apetite, desidratação em graus variados, comprometimento da dinâmica reticuloruminal, além de fezes em quantidade reduzida, ressecadas com presença de muco e estrias de sangue. Os exames laboratoriais revelaram aumento da atividade sérica da aspartatoaminotransferase e da gamaglutamiltransferase, além de hipoalbuminemia. Na necropsia evidenciou-se fígado aumentado de volume e superfície de corte com aspecto de noz-moscada além de áreas de hemorragias no coração, traqueia, abomaso, baço, intestino e bexiga; na microscopia observou-se necrose hepática centrolobular associada à hemorragia acentuada. Tais achados caracterizaram o quadro de intoxicação por Cestrum laevigatum e deram subsídios para adoção das medidas de controle e prevenção.

    Abstract in English:

    The aim of the present study was to report an outbreak of natural poisoning by Cestrum laevigatum in dairy cattle in the "Agreste" region of Pernambuco state, Brazil. Epidemiological and clinical data were collected. Among a lot of 60 cows, eight became ill and four died. Two cows underwent necropsy, during which fragments of the central nervous system, liver, gall bladder, spleen and kidney were collected for histopathlogical analysis. Blood samples were collected for hematological and biochemical tests. The animals exhibited apathy, muscle tremors, reduced appetite, different degrees of dehydration and compromised reticulorumen dynamics as well as a small quantity of dry feces with the presence of mucus and blood. The laboratory exams revealed an increase in serum activity of aspartate aminotransferase and gamma glutamyltransferase as well as hypoalbuminemia. The necropsy revealed an enlarged liver and cutting surface with a nutmeg aspect as well as areas of hemorrhaging in the heart, trachea, abomasum, spleen, intestine and bladder. The microscopic analysis revealed centrilobular hepatic necrosis associated to accentuated hemorrhaging. These findings characterized poisoning by Cestrum laevigatum and led to the adoption of control and prevention measures.
  • Evaluation of sheep oocytes submitted to heat stress during in vitro maturation Medicina Veterinária

    Santos Junior, Edivaldo Rosas dos; Chaves, Ricardo Macêdo; Silva, José Carlos Ferreira da; Moura, Marcelo Tigre; Bartolomeu, Cláudio Coutinho; Gonçalves, Paulo Bayard Dias; Lima, Paulo Fernandes de; Oliveira, Marcos Antônio Lemos de

    Abstract in Portuguese:

    Neste trabalho foi avaliado o efeito do estresse calórico durante a maturação de oócitos sobre a produção in vitro de embriões ovinos. Os ovários foram obtidos em abatedouro e os oócitos colhidos de folículos de 2 a 6 mm de diâmetro. Após seleção, os oócitos, em 10 replicações, foram colocados para maturação in vitro (MIV) durante 24 horas. Os oócitos submetidos ao estresse térmico de 41º C durante 3, 6, 12, 18 e 24 horas foram posteriormente transferidos para completar a MIV a 39 ºC, mesma temperatura utilizada para maturação dos oócitos do grupo controle. O desenvolvimento dos embriões foi determinado nos dias 3, 4, 5 e 8 pós-fecundação. A avaliação da qualidade dos embriões foi efetuada através da contagem total de células coradas pelo DAPI e da determinação do número de blastômeros positivos para apoptose através do teste de TUNEL. Observou-se que o estresse térmico diminuiu (P < 0,05) a capacidade de maturação dos oócitos de acordo com o tempo de exposição à temperatura de 41º C. No grupo de oócitos incubados a 39° C, 70,70% maturou, enquanto que nos grupos expostos ao estresse térmico, apenas 45,28%, 35,17%, 12,30%, 9,74% e 4,60% maturaram, respectivamente, após 3, 6, 12, 18 e 24 horas de incubação. A duração de exposição dos oócitos ao estresse calórico foi inversamente proporcional (P < 0,05) à capacidade de desenvolvimento embrionário e diretamente proporcional (P < 0,05) ao número de blastocistos positivos para apoptose. Todavia, o efeito deletério do estresse térmico sobre a clivagem e os embriões nos estádios de 8 a 16 células e de mórula foi crescente (P > 0,05) somente até 18 horas de incubação. Os resultados permitem concluir que o estresse calórico durante a maturação in vitro de oócitos reduz a quantidade e a qualidade dos embriões ovinos produzidos in vitro determinadas pela alta incidência de apoptose.

    Abstract in English:

    The aim of this work was to evaluate the effect of heat stress during oocyte maturation on ovine in vitro embryo production. Ovaries were collected at abattoirs and oocytes retrieved from follicles ranging from 2 and 6 mm in diameter. After selection, all oocytes, in 10 replicates, were placed in in vitro maturation (IVM) during 24 hours. The oocytes were submitted to heat stress at 41º C during 3, 6, 12, 18 and 24 hours and were further transferred to 39º C in order to complete IVM, which was the temperature of maturation of control oocytes. Embryonic development was determined on days 3, 4, 5, and 8 post-fertilization. Embryo evaluation was performed as total cell count by DAPI staining and determination of positive blastomere for apoptosis by the TUNEL assay. We observed that heat stress diminishes (P < 0.05) oocyte maturation capacity in accordance with exposure time at 41º C. In the group of oocytes incubated at 39 ºC, 70.70% matured, while in the groups exposed to heat stress at 41º C, only 45.28%, 35.17%, 12.30%, 9.74% and 4.60% matured after 3, 6, 12, 18 and 24 hours of incubation, respectively. The duration of exposure to heat stress was inversely proportional (P < 0.05) to embryonic developmental capacity and directly proportional (P < 0.05) to the number of blastocysts positive to apoptosis. However, the cleavage rate and embryonic development from 8 to 16 cells and morulae stages were affected by heat stress (P > 0.05) only up to 18 hours of incubation. The results allow the conclusion that heat stress during oocyte in vitro maturation reduces the quantity and quality of ovine embryos produced in vitro determined by the high incidence of apoptosis.
  • Fluorescent PCR associated with capillary electrophoresis as a diagnostic tool of bacteria in semen Medicina Veterinária

    Dias, Francisca Elda Ferreira; Nunes, Cáris Marone; Cavalcante, Tânia Vasconcelos; Castro, Andréa Azevedo Pires de; Ferreira, Jorge Luis; Garcia, José Fernando

    Abstract in Portuguese:

    Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10³ bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial.

    Abstract in English:

    This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
  • Identification of wild mammals from Pantanal Sul-Matogrossense carriers of Leptospira spp. Medicina Veterinária

    Vieira, Anahi Souto; Rosinha, Grácia Maria Soares; Vasconcellos, Silvio Arruda; Moaris, Zenaide Maria de; Viana, Rosielle Campozano; Oliveira, Carina Elisei de; Soares, Cleber Oliveira; Araújo, Flabio Ribeiro de; Mourão, Guilherme Miranda; Bianchi, Rita de Cassia; Olifiers, Natalie; Rademaker, Vitor; Rocha, Fabiana Lopes; Pellegrin, Aiesca Oliveira

    Abstract in Portuguese:

    Foi realizado um levantamento da infecção por Leptospira spp. em mamíferos silvestres do Pantanal sul-mato-grossense com o emprego da reação de soroaglutinação microscópica (SAM) e da reação em cadeia da polimerase (PCR). Os sorovares de maior frequência nos animais investigados foram Hardjobovis (28%), Icterohemorhagiae (12%), M-110/2006 (isolado de Cerdocyon thous; 16%), Canicola (L014 isolada de Bos taurus, 4%), Whitcombi (4%), Pomona (20%), Autumnalis (12%) e Copenhageni (M9/99 isolada de Rattus norvegicus, 4%). Das 79 amostras examinadas pela PCR, 21 (26,58%) foram positivas, com a amplificação de um fragmento de aproximadamente 331pb. Dois fragmentos amplificados obtidos de amostras de C. thous foram clonados, sequenciados e identificados como L. interrogans por análise filogenética.

    Abstract in English:

    A survey of Leptospira spp. in wild mammals from the southern Pantanal of Mato Grosso do Sul was performed by microscopic agglutination test (MAT) and polymerase chain reaction (PCR). The serovars most frequently found were Hardjobovis (28%), Icterohemorhagiae (12%), M110/2006 strain (isolated from Cerdocyon thous, 16%), Canicola (L014 isolated from Bos Taurus, 4%), Whitcombi (4%), Pomona (20%), Autumnalis (12%) and Copenhageni (M9/99 isolated from Rattus norvegicus, 4%). From the 79 samples tested by PCR, 21 (26.58%) were positive, resulting in the amplification fragment of approximately 331pb. Two amplified fragments from C. thous were cloned, sequenced and identified as L. interrogans by phylogenetic analysis.
  • Administration of propylene glycol, cobalt and vitamin B12 to sheep and its effects on the electrophoretic profile of serum proteins of the lambs Medicina Veterinária

    Campos, Anne Grace Silva Siqueira; Afonso, José Augusto Bastos; Mendonça, Carla Lopes de; Santos, Rogério Adriano dos

    Abstract in Portuguese:

    Este trabalho foi desenvolvido com o objetivo de avaliar a influência da administração de propilenoglicol, cobalto e vitamina B12, sobre o perfil eletroforético das proteínas séricas nas ovelhas e respectivas crias. O estudo foi realizado utilizando-se 18 ovelhas prenhes que foram divididas em grupos de forma aleatória aos 30 dias antes da data prevista para o parto, para serem fornecidos os suplementos até o momento antecedente ao parto. Os grupos foram os seguintes: Grupo 1 (G1/n=6) Grupo Controle; Grupo 2 (G2/n=6) Grupo Cobalto e Vitamina B12 (em que foi fornecido 1mg de cobalto via oral diariamente e 2 mg de vitamina B12 via intramuscular semanalmente); e Grupo 3 (G3/n=6) Grupo Propilenoglicol (administração de 30 mL de propilenoglicol via oral diariamente). Com isso, pôde-se observar que as frações proteicas em sua maioria sofrem variações com o desenvolvimento etário, em especial as proteínas totais séricas, albumina, beta-globulina e gama-globulina e o fator determinante para essas variações foi a ingestão do colostro. Além disso, não houve influência da ingestão dos componentes pelas ovelhas sobre o perfil destas variáveis nos borregos.

    Abstract in English:

    This work was carried out to evaluate the influence of administration of propilene glycol, cobalt and vitamin B12, on the electrophoretic profile of serum proteins on sheep and their offspring. The study was conducted using 18 pregnant ewes which were randomly divided into groups at 30 days before the date scheduled for delivery in order to be given supplements until the date preceding the birth. The groups were as follows: Group 1 (G1/n=6) Control Group; Group 2 (G2/n=6) Cobalt and Vitamin B12 (wich was received 1mg of cobalt orally daily and 2mg of vitamin B12, intramuscularly weeckly); and Group 3 (G3/n=6) Propylene Glycol (administration of 30mL of propylene glycol orally daily). We observed that mosto f the protein fractions vary with age development, particularly total serum protein, albumin, beta-globulin and gamma-globulin, and the determinant factor for these changes is colostrum intake. Furthermore, there was no influence of intake by sheep of the components studied on the profile of these variables in lambs.
  • Testis histologic and histomorphometric evaluations of cattle with digital dermatitis Medicina Veterinária

    Silva, Danilo Rezende; Moura, Maria Ivete; Miguel, Marina Pacheco; Silva, Luiz Antônio Franco da; Matos, Moema Pacheco Chediak; Moura, Veridiana Maria Brianezi Dignani

    Abstract in Portuguese:

    A infecção da região digital é a causa mais comum de claudicação em bovinos, podendo levar à inutilização de animais de alta produção e destinados à reprodução. Este estudo teve como objetivo avaliar aspectos histológicos e histomorfométricos dos testículos de bovinos com dermatite digital. Foram analisadas diferentes porções dos testículos de 20 bovinos da raça Nelore, entre 25 e 30 meses, sendo 10 com de dermatite digital e 10 saudáveis. Todas as amostras testiculares avaliadas apresentaram algum grau de degeneração do epitélio tubular seminífero. Infiltrado inflamatório intersticial mononuclear foi observado em testículos de bovinos saudáveis e com dermatite digital. A altura do epitélio tubular seminífero de todas as regiões testiculares foi maior nos animais com dermatite digital, assim como foram observados maior área da luz tubular e maior diâmetro tubular nos testículos desses bovinos. Concluiu-se que bovinos jovens da raça Nelore apresentam diferentes graus de degeneração testicular, bem como orquite intersticial crônica inespecífica, sem relação com a dermatite digital. Ainda, as alterações histomorfométricas dos testículos desses bovinos não possuem relação com a enfermidade podal.

    Abstract in English:

    The infection of the digital area is the most common cause of lameness in cattle, leading to the rejection of high-production animals destined to reproduction. This study aimed at histological and histomorphometric evaluations of the testis of bovines with digital dermatitis. Different portions of testis from 20 Nellore animals, ten healthy and ten with digital dermatitis, between 25 and 30 months of age, were analyzed. All analyzed testis showed some degree of degeneration of the seminiferous epithelium. Mononuclear interstitial infiltrate was observed in testis of both healthy bovines and the ones with digital dermatitis. Bovines with digital dermatitis presented higher height of seminiferous tubular epithelium in all regions of testis, larger area of the tubular lumen, and larger tubular diameter. We concluded that young Nellore bovines show different degrees of testicular degeneration, as well as chronic nonspecific interstitial orchitis, unrelated to digital dermatitis. The testis histomorphometric changes of these animals are not related with foot disease.
Universidade Federal de Goiás Universidade Federal de Goiás, Escola de Veterinária e Zootecnia, Campus II, Caixa Postal 131, CEP: 74001-970, Tel.: (55 62) 3521-1568, Fax: (55 62) 3521-1566 - Goiânia - GO - Brazil
E-mail: revistacab@gmail.com