Brazilian ground beef authentication by multiplex polymerase chain reaction

Oliveira, Andrey Carlos do Sacramento de; Pedroso, Silvia Cristina da Silva; Cardilli, Diogo José; Leite, Fábio Pereira Leivas; Ferreira, Gabrielle Virgínia Lopes; Silva, Andréia Silva da; Roos, Talita Bandeira; Moraes, Carina Martins de; Sousa, Roberta Sales; Monteiro, Roseli do Socorro Dias

doi:10.1590/0103-8478cr20160574

Acessibilidade / Reportar erro

Brasil
SciELO.org - Rede SciELO
Blog SciELO em Perspectiva

Abrir menu

Brasil

Español English

Ciência Rural

Submissão de manuscritos
Sobre o periódico
Corpo Editorial
Instruções aos autores
Contato

sumário « anterior atual seguinte »

Resumo (Inglês)
Resumo (Português)

Texto (Inglês)

Download PDF (Inglês)

Compartilhe

Compartilhe
E-mail
Facebook
Twitter
Google+
LinkedIn
Reddit
StambleUpon
CiteULike
Mendeley

Sumário

Compartilhe
E-mail
Facebook
Twitter
Google+
LinkedIn
Reddit
StambleUpon
CiteULike
Mendeley

Resumo (Inglês)
Resumo (Português)

Texto (Inglês)

Download PDF (Inglês)

ANIMAL PRODUCTION • Cienc. Rural 48 (02) • 2018 • https://doi.org/10.1590/0103-8478cr20160574 copy

Brazilian ground beef authentication by multiplex polymerase chain reaction

Autenticação de carne moída brasileira através de uma reação em cadeia da polimerase multiplex

Authorship SCIMAGO INSTITUTIONS RANKINGS

ABSTRACT:

The aim of the present study was to assess the efficacy ofmultiplex PCR in detecting the adulterationof commercially available ground beefvia addition and/orsubstitution ofground buffalo meat. Experimentally adulterated ground beefsamples were prepared in triplicate, and dilutions of DNA from Bos taurus and Bubalusbubalis were prepared to determine the detection limit of the method. Concurrently, 91 ground meatsamples sold as “ground beef” were collected from differentstores in northern Brazil andanalyzed bymultiplex PCR. Buffalo DNA was detected in 17.5% of the collected ground meat samples.Our results showed that multiplex PCR is an efficient method for detectingthe incorporation of groundbuffalo meatatpercentages ranging from 10 to 100% and the incorporation of beef at percentages ranging from0.1 to 100% intoground meat samples.

Key words
species identification; Bos taurus; Bubalusbubalis; DNA; adulteration

Authorship

Andrey Carlos do Sacramento de Oliveira

Laboratório de Higiene e Qualidade de Alimentos e Laboratório de Microbiologia, Faculdade de Medicina Veterinária, Programa de Pós-graduação em Saúde Animal na Amazônia, Instituto de Medicina Veterinária, Universidade Federal do Pará (UFPA), Campus Castanhal, BR 316, Km 62, Bairro Saudade, 68740-970, Castanhal, PA, Brasil. Universidade Federal do ParáBrazilCastanhal, PA, BrazilLaboratório de Higiene e Qualidade de Alimentos e Laboratório de Microbiologia, Faculdade de Medicina Veterinária, Programa de Pós-graduação em Saúde Animal na Amazônia, Instituto de Medicina Veterinária, Universidade Federal do Pará (UFPA), Campus Castanhal, BR 316, Km 62, Bairro Saudade, 68740-970, Castanhal, PA, Brasil.

Silvia Cristina da Silva Pedroso

Agência de Defesa Agropecuária do Estado do Amapá, Macapá, AP, Brasil. Agência de Defesa Agropecuária do Estado do AmapáBrasilMacapá, AP, BrasilAgência de Defesa Agropecuária do Estado do Amapá, Macapá, AP, Brasil.

Diogo José Cardilli

Ministério da Agricultura, Pecuária e Abastecimento, Vigilância Agropecuária Internacional (VIGIAGRO), Belém, PA, Brasil.Vigilância Agropecuária InternacionalBrasilBelém, PA, BrasilMinistério da Agricultura, Pecuária e Abastecimento, Vigilância Agropecuária Internacional (VIGIAGRO), Belém, PA, Brasil.

Fábio Pereira Leivas Leite

Laboratório de Bacteriologia, Centro de Desenvolvimento Tecnológico (CDTec), Faculdade de Biotecnologia, Universidade Federal de Pelotas (UFPel), Pelotas, RS, Brasil.Universidade Federal de PelotasBrazilPelotas, RS, BrazilLaboratório de Bacteriologia, Centro de Desenvolvimento Tecnológico (CDTec), Faculdade de Biotecnologia, Universidade Federal de Pelotas (UFPel), Pelotas, RS, Brasil.

Gabrielle Virgínia Lopes Ferreira

Andréia Silva da Silva

Talita Bandeira Roos

Carina Martins de Moraes ^*E-mail: carinamoraes@ufpa.br. *Corresponding author.

Roberta Sales Sousa

Roseli do Socorro Dias Monteiro

Laboratório de Higiene e Qualidade de Alimentos, Universidade Federal do Pará (UFPA), Castanhal, PA, Brasil.Universidade Federal do ParáBrazilCastanhal, PA, BrazilLaboratório de Higiene e Qualidade de Alimentos, Universidade Federal do Pará (UFPA), Castanhal, PA, Brasil.

E-mail: carinamoraes@ufpa.br. ^*Corresponding author.

SCIMAGO INSTITUTIONS RANKINGS

Figures | Tables

Figures (1)
Tables (1)

Thumbnail

Figure 1
1.5% agarose gel showing the presence of cattle (346 bp) and buffalo (220 bp) DNA. 1.1 A, B: Conventional PCR (A: reverse primer cattle; B: reverse primer buffalo) of binary mixtures of bovine and buffalo DNA. L: 1 kbDNA ladder; Bt: cattle control (346 bp); Bb: buffalo control (220 bp); 1: 41ng of cattle DNA/0.00ng of buffalo DNA; 2: 40.99ng of cattleDNA/0.0041ng of buffalo DNA; 3: 40.95ng of cattle DNA/0.041ng of buffalo DNA; 4: 40.59ng of cattle DNA/0.41ng of buffalo DNA; 5:38.95ng ofc attle DNA/2.05ng of buffalo DNA; 6: 36.9ng of cattle DNA/4.1ng of buffalo DNA; 7: 30.75ng of cattle DNA/10.25ng of buffaloDNA; 8: 20.5ng of cattle DNA/20.5ng of buffalo DNA; 9: 10.25ng of cattle DNA/30.75ng of buffalo DNA; 10: 4.1ng of cattle DNA/36.9ngof buffalo DNA; 11: 2.05ng of cattle DNA/38.95ng of buffalo DNA; 12: 0.41ng of cattle DNA/40.59ng of buffalo DNA; 13: 0.041ng of cattle DNA/40.95ng of buffalo DNA; 14: 0.0041ng of cattle DNA/40.99ng of buffalo DNA; 15: 0.00ng of cattle DNA/41ng of buffalo DNA; C-:negative control.1.2 Multiplex PCR on experimentally adulterated ground meats. L: 1 kb DNA ladder; Bt: cattle control (346 bp); Bb: buffalo control (220bp); Ss: pig control; Oa: lamb control; Gg: chicken control; Ssa: fish control; C-: negative control; 1.2A:lanes 1 to 5: 41ng of DNA; lanes 6to 10: 40.99ng of DNA; 1.2B:lanes 1 to 5: 40.95ng of DNA; lanes 6 to 10: 40.59ng of DNA; 1.2C:lanes 1 to 5: 38.95ng of DNA; lanes 6 to10: 36.9ng of DNA; 1.2D:1 to 5: 30.75ng of DNA; lanes 6 to 10: 20.5ng of DNA; 1.2E: lanes1 to 5: 10.25ng of DNA; lanes 6 to 10: 4.1ng ofDNA; 1.2F:lanes1 to 5: 2.05ng of DNA; lanes 6 to 10: 0.41ng of DNA; 1.2G: lanes1 to 5: 0.041ng of DNA; lanes 6 to 10: 0.0041ng of DNA.1.3A: Ground meat samples collected in the municipality of Belém. L: 1 kb DNA ladder; Bt: cattle control (346 bp); Bb: buffalo control (220bp); lanes B1 to B5: absence of adulteration with cattle DNA (346 bp); 1.3B: Ground meat samples collected in the municipality of Santarém,L: 1 kb DNA ladder; Bt: cattle control (346 bp); Bb: buffalo control (220 bp); lanes S1 to S4: adulteration by addition of cattle (346 bp) andbuffalo (220 bp) DNA; 1.3C: Ground meat samples collected in the municipality of Macapá, L: 1 kb DNA ladder; Bt: cattle control (346 bp);Bb: buffalo control (220 bp); M1, M2 and M4: adulteration by substitution with buffalo DNA (220 bp); M3 and M5: absence of adulterationwith cattle DNA (346 bp); 1.3D: Ground meat samples collected in the municipality of Belém, L: 1 kb DNA ladder; Bt: cattle control (346bp); Bb: buffalo control (220 bp); lanes B6 to B8: adulteration by substitution with buffalo DNA (220 bp).

Thumbnail

Table 1
Primers used to amplify sequences specific to buffalo and cattle previously reported by LÓPEZ-CALLEJA et al. (2005LÓPEZ-CALLEJA, I.; et al. PCR Detectionofcows’ milk in waterbuffalomilkand mozzarella cheese. International Dairy Journal, v.15, p.1122-1129, 2005. Disponível em: <Disponível em: http://dx.doi.org/10.1016/j.idairyj.2004.12.003 >. Acesso em:30 set. 2015. doi: 10.1016/j.idairyj.2004.12.003.
http://dx.doi.org/10.1016/j.idairyj.2004... ).

Figure 1 1.5% agarose gel showing the presence of cattle (346 bp) and buffalo (220 bp) DNA. 1.1 A, B: Conventional PCR (A: reverse primer cattle; B: reverse primer buffalo) of binary mixtures of bovine and buffalo DNA. L: 1 kbDNA ladder; Bt: cattle control (346 bp); Bb: buffalo control (220 bp); 1: 41ng of cattle DNA/0.00ng of buffalo DNA; 2: 40.99ng of cattleDNA/0.0041ng of buffalo DNA; 3: 40.95ng of cattle DNA/0.041ng of buffalo DNA; 4: 40.59ng of cattle DNA/0.41ng of buffalo DNA; 5:38.95ng ofc attle DNA/2.05ng of buffalo DNA; 6: 36.9ng of cattle DNA/4.1ng of buffalo DNA; 7: 30.75ng of cattle DNA/10.25ng of buffaloDNA; 8: 20.5ng of cattle DNA/20.5ng of buffalo DNA; 9: 10.25ng of cattle DNA/30.75ng of buffalo DNA; 10: 4.1ng of cattle DNA/36.9ngof buffalo DNA; 11: 2.05ng of cattle DNA/38.95ng of buffalo DNA; 12: 0.41ng of cattle DNA/40.59ng of buffalo DNA; 13: 0.041ng of cattle DNA/40.95ng of buffalo DNA; 14: 0.0041ng of cattle DNA/40.99ng of buffalo DNA; 15: 0.00ng of cattle DNA/41ng of buffalo DNA; C-:negative control.1.2 Multiplex PCR on experimentally adulterated ground meats. L: 1 kb DNA ladder; Bt: cattle control (346 bp); Bb: buffalo control (220bp); Ss: pig control; Oa: lamb control; Gg: chicken control; Ssa: fish control; C-: negative control; 1.2A:lanes 1 to 5: 41ng of DNA; lanes 6to 10: 40.99ng of DNA; 1.2B:lanes 1 to 5: 40.95ng of DNA; lanes 6 to 10: 40.59ng of DNA; 1.2C:lanes 1 to 5: 38.95ng of DNA; lanes 6 to10: 36.9ng of DNA; 1.2D:1 to 5: 30.75ng of DNA; lanes 6 to 10: 20.5ng of DNA; 1.2E: lanes1 to 5: 10.25ng of DNA; lanes 6 to 10: 4.1ng ofDNA; 1.2F:lanes1 to 5: 2.05ng of DNA; lanes 6 to 10: 0.41ng of DNA; 1.2G: lanes1 to 5: 0.041ng of DNA; lanes 6 to 10: 0.0041ng of DNA.1.3A: Ground meat samples collected in the municipality of Belém. L: 1 kb DNA ladder; Bt: cattle control (346 bp); Bb: buffalo control (220bp); lanes B1 to B5: absence of adulteration with cattle DNA (346 bp); 1.3B: Ground meat samples collected in the municipality of Santarém,L: 1 kb DNA ladder; Bt: cattle control (346 bp); Bb: buffalo control (220 bp); lanes S1 to S4: adulteration by addition of cattle (346 bp) andbuffalo (220 bp) DNA; 1.3C: Ground meat samples collected in the municipality of Macapá, L: 1 kb DNA ladder; Bt: cattle control (346 bp);Bb: buffalo control (220 bp); M1, M2 and M4: adulteration by substitution with buffalo DNA (220 bp); M3 and M5: absence of adulterationwith cattle DNA (346 bp); 1.3D: Ground meat samples collected in the municipality of Belém, L: 1 kb DNA ladder; Bt: cattle control (346bp); Bb: buffalo control (220 bp); lanes B6 to B8: adulteration by substitution with buffalo DNA (220 bp).

Table 1 Primers used to amplify sequences specific to buffalo and cattle previously reported by LÓPEZ-CALLEJA et al. (2005LÓPEZ-CALLEJA, I.; et al. PCR Detectionofcows’ milk in waterbuffalomilkand mozzarella cheese. International Dairy Journal, v.15, p.1122-1129, 2005. Disponível em: <Disponível em: http://dx.doi.org/10.1016/j.idairyj.2004.12.003 >. Acesso em:30 set. 2015. doi: 10.1016/j.idairyj.2004.12.003.
http://dx.doi.org/10.1016/j.idairyj.2004... ).

Primers	Sequence (5’-3’)	Target species	Amplicon Size	Tm
Rev cat	AAATAGGGTTAGATGCACTGAATCCAT	Bos taurus	346 bp	55.18°C
Rev buf	TTCATAATAACTTTCGTGTTGTTGGGTGT	Bubalus bubalis	220 bp	55.85°C
For buf - cat	CTAGAGGAGCCTGTTCTATAATCGATA	-	-	56.70°C

How to cite

copy

Universidade Federal de Santa Maria Universidade Federal de Santa Maria, Centro de Ciências Rurais , 97105-900 Santa Maria RS Brazil , Tel.: +55 55 3220-8698 , Fax: +55 55 3220-8695 - Santa Maria - RS - Brazil
E-mail: cienciarural@mail.ufsm.br

Acompanhe os números deste periódico no seu leitor de RSS

Versão para download de PDF

PDF

Inglês

Versões e tradução automática

Versão original do texto

English

Tradução automática

Google Translator
Microsoft Translator

Como citar

RIS

BIBTEX

Outros formatos de citação e exportação:

SciELO - Scientific Electronic Library Online
Rua Dr. Diogo de Faria, 1087 – 9º andar – Vila Clementino 04037-003 São Paulo/SP - Brasil
E-mail: scielo@scielo.org

Leia a Declaração de Acesso Aberto

Métricas

Brazilian ground beef authentication by multiplex polymerase chain reaction

PlumX

Mensagem

[1] E-mail: carinamoraes@ufpa.br. ^*Corresponding author.